1. Each strand of DNA is polarized, having 5 and a 3 end. Explain how two strands of DNA assemble into the double stranded DNA form:

Transcription

1 BIOS10191, Fall 2017, Midterm Exam Name: I UNDERSTAND THAT I MUST COMPLY WITH THE UNIVERSITY OF NOTRE DAME HONOR CODE WHEN EXECUTING THIS EXAMINATION. Part 1. Multiple Choice and Fill-in Blanks. Signed: 1. Each strand of DNA is polarized, having 5 and a 3 end. Explain how two strands of DNA assemble into the double stranded DNA form: 2. Which of the primers listed here would allow the upper strand to be copied by DNA polymerase? (for example, as happens in a PCR reaction). Check all that would work ACGAGAG----- STR site -----CAGAAGG TGCTCTC----- STR site -----GTCTTCC--- 5 TGCTCTC 5 GGAAGAC 5 ACGAGAG 5 CCTTCTG 3. The image at right shows the results of four DNA samples examined for STRs (short tandem repeats). Place the experimental steps leading to this result in the proper order. A. The size of the DNA fragments is determined. B. 20 PCR cycles are carried out. C. Primers and DNA polymerase is added. D. DNA is purified from biological material. E. DNA is loaded into the gel wells. (First) (Final) 4. The experiment showed in Q3 was carried out to gain evidence in a paternity legal case. Lane A is the mother, lane B is the child and lane C is the alleged biological father. Is this evidence consistent with individual C being the biological father? YES NO (Circle one) 1

2 5. For the human family tree shown at right, which individuals (A-J) will possess the same mitochondrial DNA sequences as the mother/grandmother represented as the filled in black circle? List these here: 6. When researching a genetic disease, you learn that the mutant form of the disease gene has a single nucleotide base pair change that is responsible for a MET (Methionine) à ARG (Arginine) change in the protein. What codon is used to place ARG in the mutant form of the protein? Use the codon table at right. 7. For individuals showing a sex-linked recessive medical condition, the most common genetic mechanism is that the disease-causing gene was passed from a: A) carrier mother to son. B) father to son. C) carrier mother to daughter. D) father to daughter. E) carrier mother and carrier father to child. 8. People who can roll their tongues contain a dominant allele (tongue rolling). If a person does not contain this version of the tongue rolling gene, they cannot roll their tongue no matter how hard they try. Consider the following situation: A homozygous dominant tongue roller mates with a non-tongue roller. What is the probability that their offspring will be able to roll their tongue? A. 0% B. 25% C. 50% D. 75% E. 100% 9. The process of translation is best represented by which of the diagrams shown at right? Page 2

3 10. Is the pedigree shown at right consistent with the inheritance pattern expected for Huntington s disease? YES NO 11. What genetic attribute of the defective gene allows individuals carrying the Huntington s diseasecausing genes to be diagnosed prior to showing disease symptoms? 12. Many genetic diseases are recessive and so only afflict individuals that are homozygous for the mutated form of the gene. For a genetic disease that results in infant mortality, these afflicted individuals: A. have biological parents who are both heterozygous for the disease-causing gene. B. have only one biological parent who is heterozygous for the disease-causing gene. C. have a biological parent afflicted with the disease. D. have both biological parents afflicted with the disease. 13. Liver cells and kidney cells do different tasks because they: A) start off with the same DNA, but destroy unnecessary genes. B) start off with the same DNA, but gain different genes from stem cells. C) contain completely different DNA and genes. D) contain the same DNA but use different genes. E) None of the above 14. Transcription factors influence the expression of genes by: A. stabilizing proteins. B. influencing DNA synthesis. C. influencing RNA splicing. D. binding coding domains. E. binding promoter domains. 15. The transcription factors used to create induced pluripotent stem cells: A. stimulate genes active in embryonic stem cells. B. stimulate genes that trigger differentiation. C. repress cell signal receptor genes. D. act by binding to specific sequences in the DNA. E. cause mutations in cell cycle genes. Page 3

4 16. The difference between embryonic stem cell (ESC) and adult stem cell (ASC) is: A) ESCs can differentiate into all cell types in the body whereas differentiation in ASCs is limited to the cell types of their tissue of origin. B) ESCs can be grown in massive quantities in laboratory conditions whereas ASCs cannot be grown in large quantities. C) ASCs are larger in size than ESCs and thus easier to manipulate in the laboratory. D) ASCs contain twice the amount of DNA and therefore more difficult to reprogram by using transcription factors. E) ESCs contain twice the amount of DNA and therefore more difficult to reprogram by using transcription factors. 17. To the right is a diagram of the cell cycle. Identify a cellular event occurring during the period labeled in the diagram as A and B: period A: period B: A 18. Analysis of the DNA from cancer cells usually reveals that these cells possess two different types of genetic mutations. One type causes the activation of (1), the second type causes inactivation of (2). A. (1) transcription factors; (2) oncogenes B. (1) oncogenes; (2) transcription factors C. (1) tumor suppressor genes; (2) oncogenes. D. (1) tumor suppressor genes; (2) transcription factors E. (1) oncogenes; (2) tumor suppressor genes. B A 19. Key observations on the typical progression of cells to a cancerous behavior are that (check all that apply): Multiple genetic changes occur. Proteins coded by a class of genes called oncogenes become less active or inactive. Proteins coded by a class of genes called oncogenes become overactive. Proteins coded by a class of genes called tumor suppressors become less active or inactive. Proteins coded by a class of genes called tumor suppressors become overactive. Page 4

5 20. Here are some statements explaining why bacteria are much more likely to show increased antibiotic resistance now than 50 years ago. Which statement do you think is accurate and BEST describes the mechanism? A. Increased usage builds up increased resistance. B. Bacteria encountering a sublethal dose (of antibiotic) are able to produce antibodies and pass it on to the next generation. C. Bacteria gain resistance toward antibiotics every time they (antibiotics) are used. D. If (antibiotics) not used properly, bacteria become resistant to the drug (antibiotic). E. Use of antibiotics allows resistant bacteria to survive and reproduce. 21. How does penicillin kill bacterial cells? A. Penicillin is the food for molds capable of killing bacteria. B. It weakens the cell wall surrounding the bacterial cell membrane. C. It prevents synthesis of the phospholipids required for making a cell membrane. D. It inhibits bacterial protein synthesis. 22. MRSA (=methicillin-resistant Staphylococcus aureus) are medically important bacteria because they are responsible for infections that are very difficult to treat. Which of the following statements is true when methicillin is used to treat methicillin-resistant bacterial (write T (true) or F (false) on each line): These treated cells will prevent the growth of bread mold. These treated cells will have a defective cell wall. These treated cells will not have a nucleus containing DNA. These treated cells are capable of growing in the presence of methicillin. 23. An Ro value greater than one (Ro > 1) is capable of triggering an epidemic. Which of these statements is the best definition of the Ro value? A. The number of non-immunized individuals at risk of infection. B. The number of immunized individuals that remain at risk of infection. C. The average number of secondary cases caused by one infectious individual. D. The density of the population at the location of the initial infectious individual. E. The assessment of how well herd immunity will protect the population. 24. The restriction enzyme EcoR1 recognizes the palindromic site 5 -GAATTC-3 within DNA. Describe what will happen to this DNA sequence if it is treated with EcoR1: 5 CAAAAGTCTTAAGAATTCAAGGTCAATTCAAAAGAATCGCCTTAAGCGAATCGAATA 3 3 GTTTTCAGAATTCTTAAGTTCCAGTTAAGTTTTCTTAGCGGAATTCGCTTAGCTTAT 5 Page 5

6 25. Which of the following four interventions are required to create a goat capable of producing the human antithrombin protein within the goat s milk (expressed in mammary gland). Circle YES or NO for each. YES NO YES NO YES NO YES NO Making a hybrid gene with the human antithrombin promoter upstream of the goat antithrombin protein coding sequence. Making a hybrid gene with the goat antithrombin promoter upstream of the human antithrombin protein coding sequence. Change the open reading frame so that triplet codons will now specify the correct amino acids found in the human antithrombin gene. Use a goat mammary gland promoter so that the antithrombin protein will be present in the milk. 26. The concept of a crop refuge works if: A. there is an area of the farm not sprayed with RoundUp herbicide. B. there is an area of the farm planted with non-gmo crops. C. a major fraction of the pest populations is Bt-resistant. D. most farmers are planting GMO crops. E. Monsanto and other patent holders are rewarded for their innovations. 27. The most likely reason that a person would be allergic to a GMO crop is: A. there is at least one new protein expressed in the GMO crop that is not found in conventional crops. B. some herbicide residue will be present on the GMO crop at harvest time. C. there are no weeds in the GMO crop field to detoxify soil contaminants. D. there are non-plant DNA sequences found in all cells of the GMO crop. 28. Some GMO crops are referred to as Roundup ready. What is the reason for creating a Roundup ready crop? A. Allows the crop to thrive without extensive irrigation. B. Causes the crop to be avoided by certain insect pests. C. Causes the crop to be resistant to herbicides that kill weeds. D. Speeds up growth and seed maturation so the crop is harvested sooner. 29. As a possible step towards developing a new treatment for cystic fibrosis, rats inhaled a mist containing lung precursor cells. Prior to this step, the precursor cells were genetically modified so that they express the functional version of the gene mutated in cystic fibrosis. If this strategy would be used to treat human patients, it would be an example of: A. ex-vivo gene delivery therapy. B. in-vivo gene delivery therapy. C. transcription factor therapy. D. germ line gene modification. Page 6

7 30. Immediately following the binding of Cas9 to a DNA sequence complementary to the Cas9 guide RNA, the DNA is: A. replicated. B. transcribed. C. cut. D. repaired. E. amplified. Part 2. Short Answers 1-4. Answer each question. Each of these four answers should be written in 2-3 sentences. 1. Women are at a significantly higher risk of developing breast cancer or ovarian cancer if they inherit certain versions of the BRCA1 and BRCA2 genes. What experimental steps take place in the clinical laboratory to determine if a woman carries these BRCA 1 and BRCA 2 versions? 2. Describe the mechanism by which sun exposure increases the risk of skin cancer? 3. What property of a GMO crop triggers the concern that some people may prove to be allergic to the GMO crop? 4. Describe a common scenario for which DNA fingerprinting would not be admissible as evidence in a court of law? Page 7

8 PART 1. Answer Key Correct answers on all questions worth one point unless noted here. 1. The DNA strands run in opposite directions (antiparallel) (+1 pt) and held together by A-T and G-C base pairing (+1 pt) CCTTCTG or ACGAGAG. (dependent on how question is interpreted.) 3. D-C-B-E-A (+1 pt for 3 in correct order, +1 for 5 in correct order) 4. NO 5. A, C, E, F, I, J 6. AGG 7. A 8. E 9. D 10. YES 11. >40 triplet repeat sequence in gene 12. A 13. D 14. E 15. A or D 16. A 17. A=G1 (Gap 1), cell growth/decision to divide, B=S (synthesis), DNA synthesis 18. E 19. Multuple genetic changes occur, oncogenes become overactive, tumor suppressors become less active. 20. E 21. B 22. F, F, T, T 23. C 24. There is one GAATTC site in DNA sequence so it is cut into two pieces 25. NO, YES, NO, YES 26. B 27. A 28. C 29. A 30. C PART 2 1. Evaluation of the versions of the BRCA genes present in an person is done through DNA testing. First, DNA is obtained from a somatic cell, usually blood or mouth tissue. This DNA is subjected to PCR to amplify the BRCA 1 and BRCA 2 genes. The PCR products are tested by DNA sequencing/restriction digestion to determine the allele types present. 2. Sunlight contains UV light. UV light damages DNA/is mutagenic. When mutations occur in tumor suppressors and oncogenes, the cells exhibit increased proliferation, and may eventually acquire the behaviors of cancer cells. 3. GMO crops contain additional genes in the genome. These are transcribed to RNA andtranslated to proteins. Therefore, GMO crops contain proteins that are not found in Page 8

9 the original food crop. A person may have an allergic reaction when exposed to one of these proteins. So the person might not be allergic to the original food crop yet still develop an allergy to the GMO crop. 4. DNA fingerprinting is a reliable source of evidence. The major reason it would not be admissible is that evidence at the crime scene was not collected properly, may have been tampered with, or may have been mixed up at the laboratory. Page 9