ksierzputowska.com Research Title: Using novel TALEN technology to engineer precise mutations in the genome of D. melanogaster

Size: px
Start display at page:

Download "ksierzputowska.com Research Title: Using novel TALEN technology to engineer precise mutations in the genome of D. melanogaster"

Transcription

1 Research Title: Using novel TALEN technology to engineer precise mutations in the genome of D. melanogaster Research plan: Specific aims: 1. To successfully engineer transgenic Drosophila expressing TALENs (transcription activator-like effector nucleases), which has been accomplished only once before [3]. 2. To use the newly developed TALEN technology to precisely excise a short genomic sequence that was a product of a previously used genetic engineering technique, homologous recombination. 3. To sequence the various mutations induced by the engineered TALENs in the Drosophila genome to better understand the limitations of this new technology. 4. To create Drosophila in which homologous recombination may be used without a genetic byproduct. Background and significance: The Reenan laboratory pioneered the use of homologous recombination (HR) in Drosophila, a tool for precisely engineering in vivo genetic mutations (Fig. 1). This technique allows for genome manipulation with surgical precision and produces a single by-product in the form of a short sequence known as the LoxP site [1]. Research carried out by Leila Rieder, a fifth-year graduate student in the lab, focuses on post-transcriptional processing in the paralytic gene, which encodes a sodium channel. Using HR to modify the paralytic gene, she discovered that the LoxP site, previously believed to be inert, causes the transcript structure to interfere with the activity of a specific RNA helicase (Maleless, or Mle). The LoxP site, a by-product of HR, is a short sequence capable of forming a perfect duplex secondary structure in the RNA through intramolecular base pairing (Fig. 2). This property enables the LoxP site to potentially disrupt any double-stranded RNA-dependent molecular machinery, such as the Mle helicase. Disproving the belief that the loxp site is inert, we discovered that loxp interferes with the molecular phenotype observed when we add in the Mle helicase. By targeting the LoxP site with TALENs, our goal is to disrupt, or possibly completely remove, this sequence from the endogenous locus. This would allow us to use the homologous recombination technique in the future without genetic byproduct, remove the LoxP interference with the Mle helicase in previously-engineered animals, and further demonstrate the utility of TALENs in the flexible genetic model organism Drosophila. Just last year, Miller et al [2] demonstrated the use of TALENs to excise small, targeted pieces of the genome in human cells. Very recently Liu et al [3] showed that this technology can be used easily, quickly, and effectively in Drosophila. We intend to use this novel approach to excise the LoxP site from transgenic flies that were the product of HR. Successful manipulation of the LoxP site through TALENs would provide any scientist using homologous recombination in the future with a method for removing the LoxP byproduct. As we will sequence the TALEN-induced mutations, our findings regarding TALEN specificity and precision in large sequence excision will benefit Drosophilists looking to explore this technology and others who choose to use TALENs in whole organisms.

2 Preliminary Studies: Cre recombinase is an endonuclease that recognizes and cuts specifically at LoxP sites. In theory, crossing a fly whose genome contains the LoxP site to a fly expressing the Cre enzyme would cause the enzyme to cleave the LoxP site, causing a double-stranded break in the DNA, and triggering one of the DNA repair pathways. Repair of the broken strand off of a wild-type chromosome could produce a recombinant fly that has replaced part of the LoxP site with a wild-type sequence. Our original approach, which crossed transgenic flies homozygous for the LoxP site to flies expressing Cre, produced flies with unknown genotypes in the region of the LoxP. By developing a sensitive and efficient screening assay, I genotyped these animals to determine whether a recombination event occurred (Fig. 3). I screened over 500 flies and had no success in disrupting the LoxP site. Little success in big numbers caused me to search for an alternate method of removing the LoxP site. TALENs proved to be useful in excising small sequences of target DNA from the genome of various model systems such as yeast [4] and human cells [2]. The only publication to date using TALEN technology in Drosophila demonstrated the efficacy of TALENs at creating small modifications to the genome, the largest being a 12 base-pair deletion [3]. Our proposed use of the TALEN technology to excise a sequence triple in size of those documented [3] is so far novel in concept and. To date, no data has been published on a deliberate, complete excision of a sequence within a genome. Our proposed project will not only be highly publishable in this aspect, but will also enable us to report on the limitations and precision of this technology in a living organism. Research Design and Methods: The TALEN technology is unparalleled in the simplicity and manipulability of its targeting mechanism. Each TALE repeat recognizes a single base pair in a DNA sequence, therefore assembly of TALE repeats can be engineered to bind any DNA sequence (Fig. 4). Fusing TALEs to an endonuclease allows for targeted DNA cleavage [2, 5]. Cermak et al [4] present a method for assembling custom TALENs in just 5 days using the Golden Gate TALEN and TAL effector kit (available through AddGene). We intend to follow the detailed protocol and software provided by Cermak et al [4] to design the sequences for the TALENs. Then we will make use of the protocol by Liu et al (the only Drosophila protocol available to date) for plasmid creation and steps following construct injection into syncytial embryos. As our laboratory is not equipped to inject plasmids into fly embryos, we will use the P-element injection service offered by Genetic Services, Inc., which we have used in the past, with much success. Now having flies that express the TALENs, which in itself is currently new and publishable, we will cross them into the flies produced by HR whose genomes contain the LoxP site, and then use the genetic screening technique described previously to look for disruptions in the LoxP. Based on numbers reported by Liu et al [3], we expect to see modifications in 17.2%-66.7% of injected embryos. Once animals with LoxP mutations are identified, their genomes will be sequenced to determine the extent of modification achieved via TALENs. This will provide us with a clear report on the extent of excision, and therefore the precision of TALEN technology for the Drosophila/genetic engineering fields. Finally, we can use the HR/TALEN modified Drosophila with the Mle enzyme to look for interactions that are not impeded by the LoxP.

3 Based on numbers given by Liu et al, the entire process, from the design and creation of a TALEN, to its microinjection into the Drosophila embryo and finally the detection of gene modification can, in theory, be accomplished within three to six months, which makes it a perfect time frame for an undergraduate research cumulating in a senior thesis project. I have worked in the Reenan lab for three years and have gained skills in Drosophila husbandry, genetic manipulating and phenotypic screening. This project is ideally suited for me as an experienced undergraduate; it enables me to work independently under guided supervision of two mentors, Dr. Reenan and Leila Rieder. Sources: (1) Staber, C.J. et al. Perturbing A-to-I RNA editing using genetics and homologous recombination. Methods in Molecular Biology. 718, (2011). (2) Miller, J. et al. A TALE nuclease architecture for efficient genome editing. Nat. Biotechnol. 29, (2011). (3) Liu, J. et al. Efficient and specific modifications of the Drosophila genome by means of an easy TALEN strategy. JGG. 39, (2012). (4) Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Nuc. Acids Res. 39 (12), e82. (2011). (5) Boch, Jens. TALEs of genome targeting. Nat. Biotechnol. 29, (2011).

4 Figures Figure 1. The Basics of in vivo Homologous Recombination (adapted from Staber et al., 2011). (a)the targeting vector containing arms homologous to the gene of interest (yellow) is randomly integrated into the fly genome. (b)flp and I-SceI enzymes excise the homology arm region, which carries a selectable marker (red) flanked by two LoxP sites (green). Activation of a DNA repair pathway triggers recombination at the endogenous locus (white). (c)cre recombinase excises the sequence between the LoxP sites. (d)targeted locus post-cre with the selectable marker gene removed and the single LoxP byproduct. Figure 2. Predicted secondary structure of the LoxP sequence in the paralytic pre-mrna. The LoxP site (shown in gray) is capable of forming a perfect duplex secondary structure due to the presence of two inverted repeats. This structure may disrupt any double stranded RNA-dependent molecular machinery, such as RNA helicases.

5 Figure 3. Diagnostic assay using the PacI and SpeI restriction enzymes. Flies are screened for the disruption of the LoxP site using a double digest. DNA is extracted from 3 pooled flies, amplified via PCR, and then digested with PacI and SpeI and separated on EtBr-stained agarose gel. Lengths of bands correspond to the expected digestion pattern based on the fly genome. Lanes 1, 100 bp ladder, 2-4: controls in the form of a wild type fly (2), transgenic fly with the ECSΔ mutation (3), transgenic fly homozygous for LoxP (4). Lanes 5-7 recombinant flies with unknown genomes. Lanes 5 and 6 represent pooled flies with either the wild type, or the ECSΔ mutation. Lane 7 contains only ECSΔ flies. If a recombination event occurred to disrupt the LoxP, the digest would show 2 bands, which correspond to the ECSΔ mutation, and bands of bigger size than those of the LoxP, but smaller than pure wildtype. No such pattern was observed in 500 flies screened using this method. Figure 4. Assembled TALEN. The TALEN is assembled from the DNA-binding amino acid residues (Repeat Variable Diresidues) from TAL effectors (proteins secreted by plan pathogens) and the Fok1 endonuclease. RVDs make specific contacts with nucleotides one RVD corresponds to one base in the DNA, ex. yellow RVD corresponds to adenosine (A). This allows for assembly of custom TALE repeat arrays that will recognize any DNA sequence. The repeat domain is tethered to the Fok1 enzyme which, upon dimerization, cleaves DNA and therefore enables genome editing.

Supplementary Figures and Figure legends

Supplementary Figures and Figure legends Supplementary Figures and Figure legends 3 Supplementary Figure 1. Conditional targeting construct for the murine Satb1 locus with a modified FLEX switch. Schematic of the wild type Satb1 locus; the conditional

More information

Genome manipulation by homologous recombination in Drosophila Xiaolin Bi and Yikang S. Rong Date received (in revised form): 9th May 2003

Genome manipulation by homologous recombination in Drosophila Xiaolin Bi and Yikang S. Rong Date received (in revised form): 9th May 2003 Xiaolin Bi is a post doctoral research fellow at the Laboratory of Molecular Cell Biology, National Cancer Institute, National Institutes of Health, Bethesda, Maryland, USA. Yikang S. Rong is the principal

More information

Genome editing. Knock-ins

Genome editing. Knock-ins Genome editing Knock-ins Experiment design? Should we even do it? In mouse or rat, the HR-mediated knock-in of homologous fragments derived from a donor vector functions well. However, HR-dependent knock-in

More information

Introduction and History of Genome Modification. Adam Clore, PhD Director, Synthetic Biology Design

Introduction and History of Genome Modification. Adam Clore, PhD Director, Synthetic Biology Design Introduction and History of Genome Modification Adam Clore, PhD Director, Synthetic Biology Design Early Non-site Directed Genome Modification Homologous recombination in yeast TARGET GENE 5 Arm URA3 3

More information

Return to Web Version

Return to Web Version Page 1 of 7 Page 1 of 7 Return to Web Version ZFN Technology Biowire Volume 10 Article 1 Have your genomic work cut out for you The genomes of several organisms, including humans, have been sequenced,

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

Experimental genetics - 2 Partha Roy

Experimental genetics - 2 Partha Roy Partha Roy Experimental genetics - 2 Making genetically altered animal 1) Gene knock-out k from: a) the entire animal b) selected cell-type/ tissue c) selected cell-type/tissue at certain time 2) Transgenic

More information

MCB 102 University of California, Berkeley August 11 13, Problem Set 8

MCB 102 University of California, Berkeley August 11 13, Problem Set 8 MCB 102 University of California, Berkeley August 11 13, 2009 Isabelle Philipp Handout Problem Set 8 The answer key will be posted by Tuesday August 11. Try to solve the problem sets always first without

More information

Genome Engineering with ZFNs, TALENs and CRISPR/Cas9

Genome Engineering with ZFNs, TALENs and CRISPR/Cas9 Genome Engineering with ZFNs, TALENs and CRISPR/Cas9 Designer Endonucleases ZFNs (zinc finger nucleases), TALENs (transcription activator-like effector nucleases) and CRISPR/Cas9 (clustered regularly interspaced

More information

2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology

2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes

More information

CH 8: Recombinant DNA Technology

CH 8: Recombinant DNA Technology CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes

More information

Chapter 10 (Part II) Gene Isolation and Manipulation

Chapter 10 (Part II) Gene Isolation and Manipulation Biology 234 J. G. Doheny Chapter 10 (Part II) Gene Isolation and Manipulation Practice Questions: Answer the following questions with one or two sentences. 1. What does PCR stand for? 2. What does the

More information

Problem Set 8. Answer Key

Problem Set 8. Answer Key MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no

More information

New Plant Breeding Technologies

New Plant Breeding Technologies New Plant Breeding Technologies Ricarda A. Steinbrecher, PhD EcoNexus / ENSSER Berlin, 07 May 2015 r.steinbrecher@econexus.info distributed by EuropaBio What are the NPBTs? *RNAi *Epigenetic alterations

More information

CRISPR/Cas9 Genome Editing: Transfection Methods

CRISPR/Cas9 Genome Editing: Transfection Methods CRISPR/ Genome Editing: Transfection Methods For over 20 years Mirus Bio has developed and manufactured high performance transfection products and technologies. That expertise is now being applied to the

More information

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome. Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid

More information

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death

More information

Molecular Biology Midterm Exam 2

Molecular Biology Midterm Exam 2 Molecular Biology Midterm Exam 2 1. The experiments by Frank Stahl and Matthew Messelson demonstrated that DNA strands separate during DNA replication. They showed that DNA replication is what kind of

More information

Enzyme that uses RNA as a template to synthesize a complementary DNA

Enzyme that uses RNA as a template to synthesize a complementary DNA Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have

More information

Chapter 10 Genetic Engineering: A Revolution in Molecular Biology

Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical

More information

Molecular Biology Techniques Supporting IBBE

Molecular Biology Techniques Supporting IBBE Molecular Biology Techniques Supporting IBBE Jared Cartwright Protein Production Lab Head Contact Details: email jared.cartwright@york.ac.uk Phone 01904 328797 Presentation Aims Gene synthesis Cloning

More information

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8 Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically

More information

Genetic Engineering & Recombinant DNA

Genetic Engineering & Recombinant DNA Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied

More information

TRANSGENIC ANIMALS. -transient transfection of cells -stable transfection of cells. - Two methods to produce transgenic animals:

TRANSGENIC ANIMALS. -transient transfection of cells -stable transfection of cells. - Two methods to produce transgenic animals: TRANSGENIC ANIMALS -transient transfection of cells -stable transfection of cells - Two methods to produce transgenic animals: 1- DNA microinjection - random insertion 2- embryonic stem cell-mediated gene

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Easi CRISPR for conditional and insertional alleles

Easi CRISPR for conditional and insertional alleles Easi CRISPR for conditional and insertional alleles C.B Gurumurthy, University Of Nebraska Medical Center Omaha, NE cgurumurthy@unmc.edu Types of Genome edits Gene disruption/inactivation Types of Genome

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature09937 a Name Position Primersets 1a 1b 2 3 4 b2 Phenotype Genotype b Primerset 1a D T C R I E 10000 8000 6000 5000 4000 3000 2500 2000 1500 1000 800 Donor (D)

More information

Bi 8 Lecture 5. Ellen Rothenberg 19 January 2016

Bi 8 Lecture 5. Ellen Rothenberg 19 January 2016 Bi 8 Lecture 5 MORE ON HOW WE KNOW WHAT WE KNOW and intro to the protein code Ellen Rothenberg 19 January 2016 SIZE AND PURIFICATION BY SYNTHESIS: BASIS OF EARLY SEQUENCING complex mixture of aborted DNA

More information

CHAPTERS 16 & 17: DNA Technology

CHAPTERS 16 & 17: DNA Technology CHAPTERS 16 & 17: DNA Technology 1. What is the function of restriction enzymes in bacteria? 2. How do bacteria protect their DNA from the effects of the restriction enzymes? 3. How do biologists make

More information

Amplicons, Heteroduplexes and Enzymes - Proper Processing Elevates Detection of CRISPR Gene Editing Events

Amplicons, Heteroduplexes and Enzymes - Proper Processing Elevates Detection of CRISPR Gene Editing Events Amplicons, Heteroduplexes and Enzymes - Proper Processing Elevates Detection of CRISPR Gene Editing Events Steve Siembieda, MS MBA VP Commercialization ABRF Conference February 2015 What Is CRISPR? Clustered

More information

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination

More information

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology. PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

Construct Design and Cloning Guide for Cas9-triggered homologous recombination

Construct Design and Cloning Guide for Cas9-triggered homologous recombination Construct Design and Cloning Guide for Cas9-triggered homologous recombination Written by Dan Dickinson (ddickins@live.unc.edu) and last updated December 2013. Reference: Dickinson DJ, Ward JD, Reiner

More information

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying

More information

Regulation of enzyme synthesis

Regulation of enzyme synthesis Regulation of enzyme synthesis The lac operon is an example of an inducible operon - it is normally off, but when a molecule called an inducer is present, the operon turns on. The trp operon is an example

More information

Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection

Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection Written by Dan Dickinson (daniel.dickinson@austin.utexas.edu) and last updated January 2018. A version

More information

Guide-it sgrna In Vitro Transcription and Screening Systems User Manual

Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Clontech Laboratories, Inc. Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 631438, 631439 & 631440 (042114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra

More information

Applicazioni biotecnologiche

Applicazioni biotecnologiche Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence

More information

* + * RecA * + + for RecA-dependent strand + + MIT Department of Biology 7.28, Spring Molecular Biology

* + * RecA * + + for RecA-dependent strand + + MIT Department of Biology 7.28, Spring Molecular Biology MIT Department of Biology 7.28, Spring 2005 - Molecular Biology 1) Question 1. 1A. You are studying the function of in vitro along with a lab partner. You run several reactions to examine the requirements

More information

Test Bank for Molecular Cell Biology 7th Edition by Lodish

Test Bank for Molecular Cell Biology 7th Edition by Lodish Test Bank for Molecular Cell Biology 7th Edition by Lodish Link download full: http://testbankair.com/download/test-bank-formolecular-cell-biology-7th-edition-by-lodish/ Chapter 5 Molecular Genetic Techniques

More information

Genome Editing with Programmable Nucleases. Jin-Soo Kim Department of Chemistry Seoul National University

Genome Editing with Programmable Nucleases. Jin-Soo Kim Department of Chemistry Seoul National University Genome Editing with Programmable Nucleases Jin-Soo Kim Department of Chemistry Seoul National University 1 Method of the Year 2011: Engineered Nucleases RNA-guided Cas9 Endonuclease 3 FokI and the First

More information

B. Incorrect! Ligation is also a necessary step for cloning.

B. Incorrect! Ligation is also a necessary step for cloning. Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease

More information

Chapter 15 Gene Technologies and Human Applications

Chapter 15 Gene Technologies and Human Applications Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect

More information

13-2 Manipulating DNA Slide 1 of 32

13-2 Manipulating DNA Slide 1 of 32 1 of 32 The Tools of Molecular Biology The Tools of Molecular Biology How do scientists make changes to DNA? Scientists use their knowledge of the structure of DNA and its chemical properties to study

More information

Biology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library

Biology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Reverse transcriptase Allostery: cdna library Transformation Part II Short Answer 1. Describe the reasons for

More information

Biology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write.

Biology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write. Name KEY Section Biology 201 (Genetics) Exam #3 120 points 20 November 2006 Read the question carefully before answering. Think before you write. You will have up to 50 minutes to take this exam. After

More information

Bootcamp: Molecular Biology Techniques and Interpretation

Bootcamp: Molecular Biology Techniques and Interpretation Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing

More information

Genetics and Biotechnology. Section 1. Applied Genetics

Genetics and Biotechnology. Section 1. Applied Genetics Section 1 Applied Genetics Selective Breeding! The process by which desired traits of certain plants and animals are selected and passed on to their future generations is called selective breeding. Section

More information

Studying the Human Genome. Lesson Overview. Lesson Overview Studying the Human Genome

Studying the Human Genome. Lesson Overview. Lesson Overview Studying the Human Genome Lesson Overview 14.3 Studying the Human Genome THINK ABOUT IT Just a few decades ago, computers were gigantic machines found only in laboratories and universities. Today, many of us carry small, powerful

More information

Supplementary Figure 1. Diagram for CATCHA construct. Nature Biotechnology doi: /nbt.3444

Supplementary Figure 1. Diagram for CATCHA construct. Nature Biotechnology doi: /nbt.3444 Supplementary Figure 1 Diagram for CATCHA construct. Supplementary Figure 2 Representative view of ebony (left) and non-ebony (right) F2 flies from experiments described in Fig. 1c. F0 #1 F0 #2 F0 #3 F0

More information

Biosc10 schedule reminders

Biosc10 schedule reminders Biosc10 schedule reminders Review of molecular biology basics DNA Is each person s DNA the same, or unique? What does DNA look like? What are the three parts of each DNA nucleotide Which DNA bases pair,

More information

Chapter 14 Regulation of Transcription

Chapter 14 Regulation of Transcription Chapter 14 Regulation of Transcription Cis-acting sequences Distance-independent cis-acting elements Dissecting regulatory elements Transcription factors Overview transcriptional regulation Transcription

More information

Applications of Cas9 nickases for genome engineering

Applications of Cas9 nickases for genome engineering application note genome editing Applications of Cas9 nickases for genome engineering Shuqi Yan, Mollie Schubert, Maureen Young, Brian Wang Integrated DNA Technologies, 17 Commercial Park, Coralville, IA,

More information

3 Designing Primers for Site-Directed Mutagenesis

3 Designing Primers for Site-Directed Mutagenesis 3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed

More information

Combining Techniques to Answer Molecular Questions

Combining Techniques to Answer Molecular Questions Combining Techniques to Answer Molecular Questions UNIT FM02 How to cite this article: Curr. Protoc. Essential Lab. Tech. 9:FM02.1-FM02.5. doi: 10.1002/9780470089941.etfm02s9 INTRODUCTION This manual is

More information

CRISPR: hot, hot, hot

CRISPR: hot, hot, hot CRISPR: hot, hot, hot 166 CRISPR is the latest technique for genome engineering and is generating tons of excitement due to its versatility, high specificity, and ease of use. CRISPR stands for clustered

More information

Genome research in eukaryotes

Genome research in eukaryotes Functional Genomics Genome and EST sequencing can tell us how many POTENTIAL genes are present in the genome Proteomics can tell us about proteins and their interactions The goal of functional genomics

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Supplementary Methods Supplementary Discussion Supplementary Figure 1 Calculated frequencies of embryo cells bearing bi-allelic alterations. Targeted indel mutations induced by

More information

Before starting, write your name on the top of each page Make sure you have all pages

Before starting, write your name on the top of each page Make sure you have all pages Biology 105: Introduction to Genetics Name Student ID Before starting, write your name on the top of each page Make sure you have all pages You can use the back-side of the pages for scratch, but we will

More information

Guide-it sgrna In Vitro Transcription and Screening Systems User Manual

Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 632638, 632639, 632635, 632636, 632637 (040618) 1290 Terra Bella Avenue, Mountain View, CA 94043, USA U.S. Technical Support:

More information

Programmable Sequence-Specific Transcriptional Regulation of Mammalian Genome Using Designer TAL Effectors

Programmable Sequence-Specific Transcriptional Regulation of Mammalian Genome Using Designer TAL Effectors Supplementary Information Programmable Sequence-Specific Transcriptional Regulation of Mammalian Genome Using Designer TAL Effectors Feng Zhang 1,2,3,5,7 *,±, Le Cong 2,3,4 *, Simona Lodato 5,6, Sriram

More information

A) (5 points) As the starting step isolate genomic DNA from

A) (5 points) As the starting step isolate genomic DNA from GS Final Exam Spring 00 NAME. bub ts is a recessive temperature sensitive mutation in yeast. At º C bub ts cells grow normally, but at º C they die. Use the information below to clone the wild-type BUB

More information

Golden Gate TALEN assembly

Golden Gate TALEN assembly Golden Gate TALEN assembly This is an expanded and slightly modified TAL assembly protocol published in the original form in Cermak, et al., 2011 (http://dx.doi.org/10.1093/nar/gkr218) Modifications to

More information

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY. !! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which

More information

Biotechnology. Review labs 1-5! Ch 17: Genomes. Ch 18: Recombinant DNA and Biotechnology. DNA technology and its applications

Biotechnology. Review labs 1-5! Ch 17: Genomes. Ch 18: Recombinant DNA and Biotechnology. DNA technology and its applications Biotechnology DNA technology and its applications Biotechnology and Molecular Biology Concepts: Polymerase chain reaction (PCR) Plasmids and restriction digests Recombinant protein production UV spectrophotometry

More information

Analysis of gene function

Analysis of gene function Genome 371, 22 February 2010, Lecture 12 Analysis of gene function Gene knockouts PHASE TWO: INTERPRETATION I THINK I FOUND A CORNER PIECE. 3 BILLION PIECES Analysis of a disease gene Gene knockout or

More information

7.012 Problem Set 5. Question 1

7.012 Problem Set 5. Question 1 Name Section 7.012 Problem Set 5 Question 1 While studying the problem of infertility, you attempt to isolate a hypothetical rabbit gene that accounts for the prolific reproduction of rabbits. After much

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION High-efficiency TALEN-based gene editing produces disease-resistance rice Ting Li 1, Bo Liu 1, Martin H. Spalding 1, Donald P. Weeks 2, Bing Yang 1 * 1 Department of Genetics,

More information

Chapter 6 - Molecular Genetic Techniques

Chapter 6 - Molecular Genetic Techniques Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting

More information

The RRPA knock-in allele was generated by homologous recombination in TC1 ES cells.

The RRPA knock-in allele was generated by homologous recombination in TC1 ES cells. Supplemental Materials Materials & Methods Generation of RRPA and RAPA Knock-in Mice The RRPA knock-in allele was generated by homologous recombination in TC1 ES cells. Targeted ES clones in which the

More information

BurrH: a new modular DNA binding protein for genome engineering

BurrH: a new modular DNA binding protein for genome engineering Supplementary information for: BurrH: a new modular protein for genome engineering Alexandre Juillerat, Claudia Bertonati, Gwendoline Dubois, Valérie Guyot, Séverine Thomas, Julien Valton, Marine Beurdeley,

More information

Lecture 8: Transgenic Model Systems and RNAi

Lecture 8: Transgenic Model Systems and RNAi Lecture 8: Transgenic Model Systems and RNAi I. Model systems 1. Caenorhabditis elegans Caenorhabditis elegans is a microscopic (~1 mm) nematode (roundworm) that normally lives in soil. It has become one

More information

Molecular Biology (BIOL 4320) Exam #1 March 12, 2002

Molecular Biology (BIOL 4320) Exam #1 March 12, 2002 Molecular Biology (BIOL 4320) Exam #1 March 12, 2002 Name KEY SS# This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses after the question number.

More information

Barley as a model for cereal engineering and genome editing. Wendy Harwood

Barley as a model for cereal engineering and genome editing. Wendy Harwood Barley as a model for cereal engineering and genome editing Wendy Harwood MonoGram 29 th April 2015 www.bract.org BRACT Transformation Platform Over-expression of single genes RNAi based silencing Promoter

More information

Recitation CHAPTER 9 DNA Technologies

Recitation CHAPTER 9 DNA Technologies Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown

More information

Lesson Overview. Studying the Human Genome. Lesson Overview Studying the Human Genome

Lesson Overview. Studying the Human Genome. Lesson Overview Studying the Human Genome Lesson Overview 14.3 Studying the Human Genome THINK ABOUT IT Just a few decades ago, computers were gigantic machines found only in laboratories and universities. Today, many of us carry small, powerful

More information

Bart Williams, PhD Van Andel Research Center

Bart Williams, PhD Van Andel Research Center A History of Genome Editing in the Laboratory Implications for Translational Applications Bart Williams, PhD Van Andel Research Center Introduction by Matthew Denenberg, MD DeVos Childrens Hospital Disclosures:

More information

CRISPR/Cas9 From Yoghurt to Designer Babies. Source: nextbigfuture.com

CRISPR/Cas9 From Yoghurt to Designer Babies. Source: nextbigfuture.com CRISPR/Cas9 From Yoghurt to Designer Babies Source: nextbigfuture.com OBJECTIVES 1. Relate the functioning of bacterial CRISPR/Cas systems to acquired immunity 2. Describe how CRISPR/Cas9 cuts DNA 3. Explain

More information

GENE(S) Carried by transposon

GENE(S) Carried by transposon ANSWER KEY Microbial Genetics BIO 510/610 Fall Quarter 2009 Final Exam 1.) Some Insertion Sequences transpose through a Replicative mechanism of transposition. Other Insertion Sequences utilize a Cut and

More information

BSCI410-Liu/Spring 06 Exam #1 Feb. 23, 06

BSCI410-Liu/Spring 06 Exam #1 Feb. 23, 06 Your Name: Your UID# 1. (20 points) Match following mutations with corresponding mutagens (X-RAY, Ds transposon excision, UV, EMS, Proflavin) a) Thymidine dimmers b) Breakage of DNA backbone c) Frameshift

More information

Mos1 insertion. MosTIC protocol-11/2006. repair template - Mos1 transposase expression - Mos1 excision - DSB formation. homolog arm.

Mos1 insertion. MosTIC protocol-11/2006. repair template - Mos1 transposase expression - Mos1 excision - DSB formation. homolog arm. MosTIC (Mos1 excision induced Transgene Instructed gene Conversion) Valérie Robert (vrobert@biologie.ens.fr) and Jean-Louis Bessereau (jlbesse@biologie.ens.fr) (November 2006) Introduction: MosTIC (Robert

More information

Bi Lecture 3 Loss-of-function (Ch. 4A) Monday, April 8, 13

Bi Lecture 3 Loss-of-function (Ch. 4A) Monday, April 8, 13 Bi190-2013 Lecture 3 Loss-of-function (Ch. 4A) Infer Gene activity from type of allele Loss-of-Function alleles are Gold Standard If organism deficient in gene A fails to accomplish process B, then gene

More information

Mission (Im)possible: Plasmid Mapping Student Materials

Mission (Im)possible: Plasmid Mapping Student Materials Mission (Im)possible: Plasmid Mapping Student Materials Introduction... 2 Pre-Lab Questions... 6 Lab Protocol... 7 Data Collection Worksheet... 11 Post-Lab Questions and Analysis... 12 Last updated: August

More information

Molecular Genetics FINAL page 1 of 7 Thursday, Dec. 14, 2006 Your name:

Molecular Genetics FINAL page 1 of 7 Thursday, Dec. 14, 2006 Your name: Molecular Genetics FNAL page 1 of 7 1. (5 points) Here is the sequence of the template strand of a DNA fragment: GAAGTACGACGAGTTCGACCTTCTCGCGAGCGCA Which of the following would be the complementary, nontemplate,

More information

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau 7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial

More information

New Plant Breeding Techniques Group 1 Targeted Mutagenesis

New Plant Breeding Techniques Group 1 Targeted Mutagenesis WORKSHOP COMPERATIVE SITUATION OF NEW PLANT BREEDING TECHNIQUES 12-13 SEPTEMBER 2011 SEVILLE, SPAIN New Plant Breeding Techniques Group 1 Targeted Mutagenesis Maria Lusser Joint Research Centre, European

More information

Golden Gate TALEN assembly

Golden Gate TALEN assembly Golden Gate TALEN assembly This is an expanded and slightly modified TAL assembly protocol published in the original form in Cermak, et al., 2011 (http://dx.doi.org/10.1093/nar/gkr218) Modifications to

More information

B. Sc. III SEMESTER V BTT- 501: MOLECULAR BIOLOGY (CORE)

B. Sc. III SEMESTER V BTT- 501: MOLECULAR BIOLOGY (CORE) B. Sc. III SEMESTER V BTT- 501: MOLECULAR BIOLOGY (CORE) Unit I: Genome Structure:Watson and Crick model of DNA; Genome organization with specific reference to prokaryotic and eukaryotic genomes; Genome

More information

XactEdit Cas9 Nuclease with NLS User Manual

XactEdit Cas9 Nuclease with NLS User Manual XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of

More information

Authors: Vivek Sharma and Ram Kunwar

Authors: Vivek Sharma and Ram Kunwar Molecular markers types and applications A genetic marker is a gene or known DNA sequence on a chromosome that can be used to identify individuals or species. Why we need Molecular Markers There will be

More information

Problem Set 4

Problem Set 4 2006 7.012 Problem Set 4 Due before 5 PM on FRIDAY, October 27, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. You are studying a specific gene in yeast,

More information

CRISPR/Cas9 Gene Editing Tools

CRISPR/Cas9 Gene Editing Tools CRISPR/Cas9 Gene Editing Tools - Guide-it Products for Successful CRISPR/Cas9 Gene Editing - Why choose Guide-it products? Optimized methods designed for speed and ease of use Complete kits that don t

More information

Chapter 13: Biotechnology

Chapter 13: Biotechnology Chapter Review 1. Explain why the brewing of beer is considered to be biotechnology. The United Nations defines biotechnology as any technological application that uses biological system, living organism,

More information

Fundamentals of Genetics. 4. Name the 7 characteristics, giving both dominant and recessive forms of the pea plants, in Mendel s experiments.

Fundamentals of Genetics. 4. Name the 7 characteristics, giving both dominant and recessive forms of the pea plants, in Mendel s experiments. Fundamentals of Genetics 1. What scientist is responsible for our study of heredity? 2. Define heredity. 3. What plant did Mendel use for his hereditary experiments? 4. Name the 7 characteristics, giving

More information

Understanding the Cellular Mechanism of the Excess Microsporocytes I (EMSI) Gene. Andrew ElBardissi, The Pennsylvania State University

Understanding the Cellular Mechanism of the Excess Microsporocytes I (EMSI) Gene. Andrew ElBardissi, The Pennsylvania State University Understanding the Cellular Mechanism of the Excess Microsporocytes I (EMSI) Gene Andrew ElBardissi, The Pennsylvania State University Abstract: Hong Ma, The Pennsylvania State University The Excess Microsporocytes

More information

Site directed mutagenesis, Insertional and Deletion Mutagenesis. Mitesh Shrestha

Site directed mutagenesis, Insertional and Deletion Mutagenesis. Mitesh Shrestha Site directed mutagenesis, Insertional and Deletion Mutagenesis Mitesh Shrestha Mutagenesis Mutagenesis (the creation or formation of a mutation) can be used as a powerful genetic tool. By inducing mutations

More information

Chapter 5 Genetic Analysis in Cell Biology. (textbook: Molecular Cell Biology 6 ed, Lodish section: )

Chapter 5 Genetic Analysis in Cell Biology. (textbook: Molecular Cell Biology 6 ed, Lodish section: ) Chapter 5 Genetic Analysis in Cell Biology (textbook: Molecular Cell Biology 6 ed, Lodish section: 5.1+5.4-5.5) Understanding gene function: relating function, location, and structure of gene products

More information

CRISPR/Cas9 Gene Editing Tools

CRISPR/Cas9 Gene Editing Tools CRISPR/Cas9 Gene Editing Tools - Separations Simply Spectacular INDELS Identify indels Determine if one or both copies of your gene have indels The Guide-it Genotype Confirmation Kit: Simple detection

More information

Recombinant DNA. Lesson Overview. Lesson Overview Recombinant DNA

Recombinant DNA. Lesson Overview. Lesson Overview Recombinant DNA Lesson Overview 15.2 Finding Genes In 1987, Douglas Prasher, a biologist at Woods Hole Oceanographic Institute in Massachusetts, wanted to find a specific gene in a jellyfish that codes for a molecule

More information