Supporting Information

Size: px

Start display at page:

Download "Supporting Information"

Juliana Shepherd
5 years ago
Views:

1 Supporting Information Real-time Quantitative PCR Measurements of Fecal Indicator Bacteria and Human-associated Source Tracking Markers in a Texas River following Hurricane Harvey Vikram Kapoor*, Indrani Gupta, A.B.M. Tanvir Pasha, and Duc Phan Department of Civil and Environmental Engineering, University of Texas at San Antonio, San Antonio, TX 78249, USA *Corresponding author vikram.kapoor@utsa.edu S-1

2 Description of sampling sites. Sites G1 and G2 were located on the segment of Guadalupe River north of Victoria, TX. Sites G3 and G4 were located upstream and downstream from a wastewater treatment plant (WWTP), respectively. Sites G5 and G6 were located on the Guadalupe River closest to the Texas coast, before and after the confluence of San Antonio River, respectively. Sites SA1 and SA2 located on the San Antonio River were used as control sites since they were in close proximity to Guadalupe River and were not severely impacted due to flooding. Sites G4 and G5 were classified as flooded catchment of the Guadalupe River, while sites G1, G2, G3 and G6 were located in the non-flooded segment of Guadalupe River. Sites SA1 and SA2 were located in the non-flooded segments of the San Antonio River. DNA extraction. DNA was extracted from filter samples using the DNeasy PowerLyzer PowerSoil Kit (Qiagen, Germantown, MD) according to the manufacturer s protocol. Extraction controls with autoclaved distilled water were used during filtration to monitor for potential extraneous DNA contamination. The concentration and purity of DNA was determined using NanoDrop OneC Spectrophotometer (Thermo Scientific, Wilmington, DE). Total DNA concentrations ranged from 2 to 30 ng/µl and DNA extract quality was confirmed by absorbance measurements at 260/280 nm, yielding ratios of DNA extracts were stored at 20 C for no longer than 3 months prior to qpcr analysis. qpcr assays. The occurrence and relative abundance of E. coli, enterococci, and humanspecific Bacteroidales (BacHum and HF183) was measured using previously described TaqMan qpcr assays (Table S1) and DNA extracts (2 µl) as the templates. Reaction mixtures (25 µl) contained 1 SsoAdvanced Universal Probes Supermix (Bio-Rad, Hercules, CA), 0.2 µm (final concentration) of each primer, and a 6-FAM (6-carboxyfluorescein)-labeled hydrolysis probe. All reaction mixtures were prepared in duplicate and qpcr assays were performed on CFX96 S-2

3 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, CA). The qpcr data were analyzed using Bio-Rad's CFX Manager Software (version 3.1). Three independent standard curves were generated for each qpcr assay by using serially diluted plasmid standards purchased from Integrated DNA Technologies (IDT, Skokie, IL) containing the sequences for each of the targeted genes. Each standard curve was generated from at least six 10-fold plasmid dilutions in triplicate. The percent amplification efficiencies were calculated by the instrument manufacturer's instructions (Bio-Rad). No-template controls (two per plate) were used to check for cross contamination, and 10-fold dilutions of each DNA extract were used to test for PCR inhibition. PCR products were also visualized using E-Gel 2% with SYBR Safe (Invitrogen, Green Island, NY) to confirm the size of amplification products. S-3

4 Figure S1. Guadalupe River at Victoria TX crested at 10 ft above flood stage on Aug 31, (Reproduced from ref. 1). S-4

5 Figure S2. NASA's IMERG rainfall analysis for Tropical Storm Harvey covers the period from Aug. 21 through Aug. 28, IMERG shows rainfall totals to 10 inches (red shading) from the coast near San Antonio Bay to in and around the Victoria area. Sites G4, G5 and G6 were located in the heavy rainfall area (solid line square) while sites G1, G2, G3 and SA1, SA2 were loacted in light rainfall areas (dashed line squares). Although site G6 was located in the heavy rainfall area, it was categorized as non-flooded site since it was diluted by the non-flooded San Antonio River. (Reproduced from ref. 2). S-5

6 Figure S3. Correlation between human-specific Bacteroidales and fecal indicators using qpcr (n = 32). The linear regression lines between human-specific Bacteroidales and conventional indicators are represented as a solid line for Entero1 and dashed line for E. coli. S-6

7 Table S1. Primers and probes used in this study. Assay Primer and probe sequences (5-3 ) Reference E. coli (EC23S857) General Enterococcus (Entero1) Human-specific Bacteroidales (BacHum) Human-specific Bacteroidales (HF183) F: GGTAGAGCACTGTTTtGGCA* R: TGTCTCCCGTGATAACtTTCTC* P: 6FAM-TCATCCCGACTTACCAACCCG-TAMRA ECST748F: AGAAATTCCAAACGAACTTG ENC854R: CAGTGCTCTACCTCCATCATT GPL813TQ: 6FAM-TGGTTCTCTCCGAAATAGCTTTAGGGCTA- TAMRA BacHum-160f: TGAGTTCACATGTCCGCATGA BacHum-241r: CGTTACCCCGCCTACTATCTAATG BacHum-193p: 6FAM-TCCGGTAGACGATGGGGATGCGTT- TAMRA HF183-1: ATCATGAGTTCACATGTCCG BthetR1: CGTAGGAGTTTGGACCGTGT BthetP1: 6FAM-CTGAGAGGAAGGTCCCCCACATTGGA- TAMRA Chern et al. 3 Ludwig & Schleifer 4 Kildare et al. 5 Haugland et al. 6 6FAM, 6-carboxyfluorescein, fluorescence reporter dye; TAMRA, 6-carboxytetramethylrhodamine, fluorescence quencher dye; *Lower case denotes deliberately mismatched base. S-7

8 References 1. U.S. Geological Survey. USGS Current Conditions for the Nation. (accessed October 1, 2017). 2. National Aeronautics and Space Administration. NASA Calculates Tropical Storm Harvey's Flooding Rainfall. (accessed October 1, 2017). 3. Chern, E. C.; Siefring, S.; Paar, J.; Doolittle, M.; Haugland, R. A. Comparison of quantitative PCR assays for Escherichia coli targeting ribosomal RNA and single copy genes. Lett. Appl. Microbiol. 2011, 52, Ludwig, W.; Schleifer, K. H. How quantitative is quantitative PCR with respect to cell counts?. Syst. Appl. Microbiol. 2000, 23, Kildare, B. J.; Leutenegger, C. M.; McSwain, B. S.; Bambic, D. G.; Rajal, V. B.; Wuertz, S. 16S rrna-based assays for quantitative detection of universal, human-, cow-, and dog-specific fecal Bacteroidales: a Bayesian approach. Water Res. 2007, 41, Haugland, R. A.; Varma, M.; Sivaganesan, M.; Kelty, C.; Peed, L.; Shanks, O. C. Evaluation of genetic markers from the 16S rrna gene V2 region for use in quantitative detection of selected Bacteroidales species and human fecal waste by qpcr. Syst. Appl. Microbiol. 2010, 33, S-8

Supplemental Materials. DNA preparation. Dehalogenimonas lykanthroporepellens strain BL-DC-9 T (=ATCC

Supplemental Materials. DNA preparation. Dehalogenimonas lykanthroporepellens strain BL-DC-9 T (=ATCC Supplemental Materials DNA preparation. Dehalogenimonas lykanthroporepellens strain BL-DC-9 T (=ATCC BAA-1523 = JCM 15061) was grown in defined basal medium amended with 0.5 mm 1,1,2- trichloroethane (1,1,2-TCA)