Identification of Meningococcal Serosubtypes by Polymerase Chain Reaction

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Identification of Meningococcal Serosubtypes by Polymerase Chain Reaction"

Transcription

1 JOURNAL OF CLINICAL MICROBIOLOGY, Nov. 1992, p /92/ $02.00/0 Copyright X 1992, American Society for Microbiology Vol. 30, No. 11 Identification of Meningococcal Serosubtypes by Polymerase Chain Reaction MARTIN C. J. MAIDEN, JANE A. BYGRAVES, JAMES McCARVIL, AND IAN M. FEAVERS* National Institute for Biological Standards and Control, South Mimms, Potters Bar, Hertfordshire, United Kingdom, EN6 3QG Received 30 April 1992/Accepted 14 August 1992 The polymerase chain reaction was used as the basis of a novel typing method for Neisseria meningitidis. Southern hybridization experiments demonstrated that it was possible to identify genes encoding different serological variants of the meningococcal class 1 outer membrane protein by probing with polymerase chain reaction products corresponding to known epitopes. A set of 14 defined variable regions was prepared in bacteriophage M13mpl9 by the cloning of polymerase chain reaction products. The phage were dot blotted onto membrane ifiters, which were used as targets for hybridization of radiolabeled amplified class 1 outer membrane protein genes. Thus, the presence of many different subtype-specific epitopes could be investigated in one experiment. This technique was evaluated with a set of serological reference strains, mainly of serogroup B organisms, and provided an alternative, rapid, and comprehensive typing system that was capable of distinguishing known serosubtypes and also of defining currently untypeable strains independently of sodium dodecyl sulfate-polyacrylamide gel electrophoresis or serological analysis. An additional advantage of this technique was that in the case of an unknown serosubtype (i.e., one that did not hybridize with any of the known samples), the DNA amplified from the original sample could be used to deternine the nucleotide sequence of the novel serosubtype and to clone the corresponding variable region into bacteriophage M13. It may be possible to develop this procedure for the diagnostic detection and typing of meningococci directly from clinical samples even when culture is not possible because of antibiotic treatment of an acute case. Neisseria meningitidis is a pathogen of worldwide significance (22). It is an antigenically complex organism with a range of molecular mechanisms for initiating antigenic changes in particular cell surface components. Many of these components exhibit phase variation (20) and thus are of little use in typing systems for epidemiological studies. The following surface components are used in typing systems, and their value in epidemiological analyses is well established (6): the polysaccharide capsular antigens define the serogroup (3, 8, 27), the class 2 and 3 outer membrane proteins (OMPs) define the serotype, and the variable epitopes of the class 1 OMP define the serosubtype (1, 10, 11, 16, 18) of a given isolate. The current serotyping and serosubtyping systems for meningococci are largely dependent on monoclonal antibodies (1, 14). Typing with these reagents requires multiple assays, and the complete range of antigenic variation is not covered. Serogroup A meningococci, which are largely responsible for pandemic outbreaks (2), are poorly defined by monoclonal antibodies, and a substantial proportion of isolates of serogroups B and C, the other major diseasecausing serogroups, are currently described as untypeable. Recent studies of the structures of the genes encoding the class 1, 2, and 3 major OMPs of meningococci and related proteins have provided much information on the structural bases for the antigenic variability of these proteins and have enabled models of their secondary structure to be predicted (5, 9, 10, 16, 26). In addition, the epitopes recognized by some of the monoclonal antibodies used for serosubtyping have been identified by the analysis of overlapping peptides (18). These epitopes are located in at least two of the variable * Corresponding author regions (VRs) (VR1 to VR3) (16) of the protein sequence, with the majority of the peptide sequence variation found in VR1 and VR2; in some cases, the VRs have been shown to contain continuous epitopes (16, 18). In the present work, an alternative DNA-based approach for the subtyping of meningococcal isolates has been developed and evaluated against a panel of predominantly serogroup B reference strains. The method was based on knowledge of the nucleotide sequences of antigenic variants of the class 1 OMP. The gene encoding the class 1 OMP gene was amplified by polymerase chain reaction (PCR), and the resulting product was labeled and hybridized to reference DNA samples immobilized in an ordered array on a membrane filter. The epitopes encoded by the target gene were revealed by autoradiography of this filter. MATERIALS AND METHODS Strain maintenance and DNA preparation. Strains of N. meningitidis were obtained from D. M. Jones, Withington Hospital, Manchester, United Kingdom; J. T. Poolman, Rijksinstituut voor Volksgezondheid en Milieuhygiene, Bilthoven, The Netherlands; and M. Achtman, Max-Planck Institut fur molekulare Genetik, Berlin, Germany. The NIBSC identification numbers, strain numbers, serogroups, serotypes, and subtypes are given in Table 1. These strains were maintained at -70 C in Mueller-Hinton broth plus freezing mix (glycerol, 10%; sodium citrate, 3 mm; ammonium sulfate, 1 mm; potassium phosphate, 100 mm; ph 6.6) and propagated on heated blood (chocolate) agar at 37 C in a 5% CO2 atmosphere for between 8 and 16 h. Growth from five chocolate agar plates was scraped into TE buffer (10 mm Tris-HCl, 1 mm EDTA, ph 8.0; 5 ml) to which TNE buffer (100 mm Tris-HCl, 100 mm NaCl, 10 mm EDTA, 1%

2 2836 MAIDEN ET AL. J. CLIN. MICROBIOL. TABLE 1. N. meningitidis strains used in this work Geographical location and NIBSC no. Strain no. Serogroup Serotypea Subtype yr of isolation or Sourcec reference" 2001 M1080 B 1 P1.1,7 25 PHLS 2002 M990 B 6 P PHLS 2003 B16.B6 B 2a P PHLS 2004 M982 B 9 P PHLS B 2b P PHLS E C NT P PHLS 2007 S3032 B 12 P1.12,16 25 PHLS 2008 H355 B 15 P PHLS 2054 G2093 B NT NT Coventry, UK (1986) PHLS 2058 J143 B 15 P1.16 Doncaster, UK (1988) PHLS B 15 P1.16 Stonehouse, UK PHLS B 15 P1.16 Stonehouse, UK PHLS 2128 K994 B 15 P1.7, B ND ND Rugby, UK (1989) 2147 L1837 B NT NT Nottingham, UK (1990) PHLS 2148 L1948 B NT NT Basildon, UK (1990) PHLS 2149 L1818 B NT NT Hereford, UK (1990) PHLS 2150 L1886 B NT NT Liverpool, UK (1990) PHLS P1.10 RIVM 2215 S P1.6,14 RIVM P1.4 RIVM 2151 B40 A NT P1.10 Morocco (1967) MPI a NT, nontypeable by serosubtyping monoclonal antibodies; ND, not done. b UK, United Kingdom. c PHLS, Public Health Laboratory Service, Withington Hospital, Manchester, United Kingdom; RIVM, Rijksinstituut voor Volksgezondheid en Milieuhygiene, Bilthoven, The Netherlands; MPI, Max-Planck Institut f(ir Molekulare Genetik, Berlin, Germany. Sarkosyl, ph 7.5; 5 ml) was added, proteinase K was added OMP gene (10, 19) in regions corresponding to the N- and to a final concentration of 100,ug/ml, and the mixture was C-terminal ends of the mature protein. Primers for amplifiincubated at 55 C for 2 h. Sequential extractions were then cation of the parts of the class 1 OMP (pora) gene corredone with equal volumes of phenol (saturated with TE sponding to each of the VRs of the class 1 protein sequence buffer), phenol-chloroform (1:1; saturated with TE buffer), were designed on the basis of the consensus sequence of and chloroform. Boiled RNase A (Sigma Chemical Co.) was Maiden et al. (16) and were designated primers 74 and 75 added, the extract was incubated for 2 h at room tempera- (VR1) and 83 and 84 (VR2). These primers were designed to ture, and sequential phenol-chloroform and chloroform ex- include recognition sites for the restriction endonuclease tractions and dialysis against two overnight changes of 0.1 x BgllI to facilitate cloning of the PCR products. T'E buffer were performed. The DNA concentration and purity were spectrophotometrically. PCR. PCR components were as follows: template (menin- Ouigedeterminedsprie Oligodeoxrbonucleotide primer sequences. Oli-. Oligodeoxyri-. gococcal chromosomal DNA, prepared as described above), 5 g~l 0m rshi H80 0m C;15m bonucleotides were synthesized on an Applied Biosystems 50 ng/l.d; 10 mm Tris-HCl, ph 8.0; 50 mm KCl; 1.5 mm 381A DNA synthesizer. The nucleotide sequences of the MgCl2; 0.1% gelatin; 200 p,m each datp, dctp, dgtp, and primers used are given in Table 2. Primers 8U, 21, and 22 dttp; the required primers at 2 p,m; and 0.5 U of Taq were complementary to the nucleotide sequence of the class polymerase (Cetus Corp.). The reaction mixtures were incu- 1 OMP gene and have previously been described (16). bated for 30 cycles in a PHC-2 programmable heat block Primers 27 and 28 were in equivalent locations of the class 2 (Techne Instruments Ltd.) for 2 min at 94 C, 2 min at 60 C, TABLE 2. Nucleotide sequences of primers Primer Type of OMP gene target Direction' Nucleotide sequence 8U Class 1 F TCCGTACGCTACGATTCTCC 21 Class 1 F CTGTACGGCGAAATCAAAGCCGGCGT 22 Class 1 R TTAGAATTTGTGGCGCAAACCGAC 27 Class 2 or 3 F TTGTACGGTACAATTAAAGCAGGCGT 28 Class 2 or 3 R TTAGAATTTGTGACGCAGACCAAC 74 Class 1 VR1 F GAGGAAGGCAGGAACTCATCCAGCTGCAATTG 75 Class 1 VR1 R GAAATCGCTGATTTTAOATGTCCTGATGCGGCT 83 Class 1 VR2 F CCGGCCCAAAACAGCTACCGCCTATACGCCGGCT 84 Class 1 VR2 R GGCATAATACACATCA4ATGGCTTGTCGACAACAGC 122L Class 1 R GGCGAGATTCAAGCCGCC a F and R, forward and reverse orientations, respectively, of the primer in relation to the direction of transcription of the gene.

3 VOL. 30, 1992 and 3 min at 72 C. After 30 cycles, the reaction mixtures were incubated for a further 3 min at 72 C. Restriction digestion, agarose gel electrophoresis, and DNA transfer. The products of PCRs and M13mpl9 vector were digested with restriction endonucleases essentially as described by Maniatis et al. (17) with restriction endonucleases and buffers supplied by New England BioLabs. Samples of DNA were separated on agarose gels (between 0.7 and 2%, depending on the expected fragment size) in 40 mm Trisacetate-1 mm EDTA (ph 8.0) at 50 to 100 ma. For Southern hybridization, agarose gels were blotted with a Vacugene vacuum blotting unit (Pharmacia-LKB) onto nylon membrane filters (GeneScreen; DuPont). The filters were fixed by irradiation with UV light of 254-nm wavelength for 4 min. Nylon membranes were also used for dot blot experiments. Each DNA sample (500 ng; diluted in 100,ul of 2x SSC [lx SSC is 0.15 M NaCl plus M sodium citrate]) was placed in a well of a dot blot manifold (BioRad) and drawn onto the membrane filter with a vacuum of 40 cm of H20. Each well was washed twice with 2x SSC. The filter was removed and fixed by UV-light irradiation as described above. Preparation of radiolabeled probe DNA. Probes of the specific variable sequences used in Southern hybridizations were produced by end filling the PCR products obtained by using primers 74 and 75 (VR1) or primers 83 and 84 (VR2) with DNA polymerase (Klenow fragment; Boehringer Corp.) and [a-32p]datp as label. For the dot blot experiments, radiolabeled VR1 and VR2 DNAs were prepared by precipitation of the relevant PCR products with polyethylene glycol 8000 (37 C, 15 min) and sedimentation in a microfuge for 10 min to remove PCR primers. The purified class 1 gene fragments were primer extended with primers 21 and 8U (16), with [a-32p]datp incorporated into the extension mixture. Both types of radiolabeled probe were purified from unincorporated radioactive nucleotide on Sepharose G50 spun columns as described by Maniatis et al. (17). DNA-DNA hybridization. Prior to hybridization, the filters were soaked in 4x SET buffer (17) for 1 h at 42 C. Prehybridization was for 1 h in 4x SET buffer plus 0.1% sodium pyrophosphate, 50% formamide, 0.2 mg of heparin per ml, and 2% sodium dodecyl sulfate (SDS) at the hybridization temperature. For hybridization, radiolabeled probe was heated to 100 C for 2 min, added to 2 ml of prehybridization mixture, and incubated with rotation overnight at between 42 and 60 C, depending on the experiment, in a hybridization oven (Appligene). The filters were washed twice in 4x SET buffer with 0.1% SDS at room temperature, rewashed at 65 C in O.lx SET buffer with 0.1% SDS, and autoradiographed at -70 C with an intensifying screen on Hyperfilm (Amersham International). Cloning and nucleotide sequencing of VRs. To prepare VR-encoding DNA clones, appropriate PCR products were made (using primers 74 and 75 for VR1 and primers 83 and 84 for VR2; Table 2). The amplified products were digested with the restriction endonuclease BglII and purified by agarose gel electrophoresis, and the DNA fragments were cloned into the BamHI site of the bacteriophage M13mpl9 vector. The nucleotide sequences of these clones were determined with modified bacteriophage T7 DNA polymerase (24), Sequenase kits, and the M13 universal primer (United States Biochemical Corp.) used in accordance with the manufacturers' instructions. The M13 clones used contained recombinant DNA in the same orientation, the antisense strand. Thus, in a hybridization, the single-stranded MENINGOCOCCAL SEROTYPING BY PCR 2837 Sample - Meningococcal DNA, Cells PCR Amplification of class 1 OMP gene Radiolabel by primer extension Hybridise to filter with standard VRs Wash, expose Result VR1VR2 FIG. 1. Scheme for the typing of meningococcal strains by PCR. The nucleotide sequence encoding the mature class 1 OMP gene is amplified, with appropriate primers, from meningococcal samples (DNA or cells) by PCR. Primer extension is carried out on the amplified gene with primers specific for VR1 and VR2 in the presence of radioactive ATP to produce VR-specific radiolabeled probes. These probes are hybridized to standard DNA samples blotted onto nylon membranes. The membranes are washed, and the VRs present in the samples are determined by autoradiography. M13 phage DNAs would hybridize to the sense (coding) strand of the gene. The nucleotide sequences encoding novel VRs were determined by a direct nucleotide sequencing method (7). The region of the pora gene encoding the mature class 1 OMP was amplified by PCR with primers 21 and 22 as described previously (16), and the part of the gene encoding the major VRs was sequenced from primers 21, 8U, and 122L (Table 2). DNA dot blot subtyping scheme. DNA-based subtyping is shown in Fig. 1. A reference collection of VR clones was prepared in M13mpl9 (29). This collection contained all the unique VR sequences from reference strains NIBSC2001 through NIBSC2008 and from NIBSC2151 and represented most of the known epitopes and some VRs for which no monoclonal antibody had been defined. The single-stranded forms of the clones were bound to nylon filters by using a dot blot manifold with the VR1 clones in one column and the VR2 clones in another. Filters were probed with the PCRamplified labeled class 1 OMP gene from the untyped meningococcal isolate and washed, and the results were visualized by autoradiography of the filter. RESULTS Discrimination of VRs by Southern hybridization. The OMP genes were amplified from four strains (NIBSC2001,

4 2838 MAIDEN ET AL. C s I I3 4 '. 3.4 S S It 2'-' 3 4 S i.) 2s i S TABLE 3. J. CLIN. MICROBIOL. M13 clones of DNA encoding VRs of various class 1 OMPs M13 M13 ClOne clone VR ~~~~~Strain (NIBSCno.) no.epte EPitOPe 1/A (2005) P1.5 1/B 1 M1080 (2001) P1.7 1/C 1 S3032 (2007) P1.12 1/D 1 H355 (2008) 1/E 1 M982 (2004) 1/F 1 35E (2006) 1/G 1 M990 (2002) 2/A 2 35E (2006) P1.1 2/B (2005) P1.2 2/C 2 M982 (2004) P1.9 2/D 2 B40 (2151) P1.10 2/E 2 H355 (2008) P1.15 2/F 2 S3032 (2007) P1.16 2/G 2 M990 (2002) FIG. 2. Southern hybridization discriminates between genes encoding antigenic variants of the class 1 OMP. (A) Agarose gel analyses of PCR-amplified class 1 and class 2 or 3 OMP genes from strains NIBSC2001 (P1.1,7; lane 1), NIBSC2006 (P1.1; lane 2), NIBSC2007 (P1.12,16; lane 3), and NIBSC2128 (P1.7,16; lane 4). (B) Southern hybridization analysis of gel similar to that in panel A probed with PCR-amplified VR1 from the class 1 OMP gene of strain NIBSC2001 (P1.7 epitope). (C) Like panel B but probed with VR2 of strain 2001 (P1.1 epitope). (D) Like panel B but probed with VR2 of strain 2007 (P1.16 epitope). Lanes S, molecular size markers. P1.7,1; NIBSC2006, P1.1; NIBSC2007, P1.12,16; and NIBSC2128, P1.7,16; Table 1) with primers 27 and 28 at low stringency. Each of these strains had a different combination of VRs, some of which encoded subtypeable epitopes. Amplification with these primers at low stringency ensured that both the class 1 and the class 2 or 3 OMP genes (depending on the strain) were amplified (10). The reaction products were separated by agarose gel electrophoresis and visualized by ethidium bromide (Fig. 2A). Three similar gels were blotted onto nylon membranes, and each of the membranes was probed with radiolabeled DNA corresponding to a specific VR. The bands corresponding to the class 1 OMP gene from strains NIBSC2001 and NIBSC2128 hybridized only to the VR1 probe PCR amplified from NIBSC2001 (Fig. 2B), whereas the VR2 probe amplified from this strain hybridized to class 1 genes from strains NIBSC2001 and NIBSC2006 (Fig. 2C). The VR2 probe amplified from NIBSC2007 hybridized specifically to the class 1 genes of strains NIBSC2007 and NIBSC2128 (Fig. 2D). There was no cross-hybridization with the class 2 or 3 OMP genes. Cloning and sequence analysis of VRs. A list of the VRs present in each of the 14 bacteriophage M13 clones is given in Table 3. The nucleotide sequences of these clones confirmed previously published data (16). The VR2 from strain 2151 (P1.10) had not previously been described and was confirmed by the direct sequence analysis of the class 1 OMP gene from this strain (see Table 5). Identification of VRs by dot blot analysis. The dot blot procedure was optimized for the identification of each of the VRs present in the reference strains (NIBSC2001 through NIBSC2008). Hybridization was carried out at a range of temperatures (data not shown). A greater degree of discrimination was obtained by varying the hybridization instead of the washing stringencies. Although each VR behaved differently, there was in general a high level of nonspecific signal when a hybridization temperature of 42 C was used, whereas at 60 C, there was an unacceptable loss of signal and specificity. A temperature of 50 C was chosen because it gave the best specificity and sensitivity across the range of strains. The results of the procedure for each of the reference strains are shown in Fig. 3. These results were obtained after 4 h of autoradiography; the specificity of the result was unchanged after overnight exposure. Analysis of untypeable strains. To evaluate the dot blot subtyping procedure further, a number of clinically isolated strains were typed by the new dot blot method (Table 4). In all but three of these isolates, in which only one VR was identified, both VRs were recognized by the dot blot method. Eight of these strains had previously been analyzed A (* I) L. I. G FIG. 3. Subtyping of eight serological refcrence strains by dot blot analysis. A series of reference DNAs with specific VR1 and VR2 nucleotide sequences cloned into M13mp19 phage (Table 3) were dot blotted onto GeneScreen membranes arranged in two columns and seven rows. Probes consisting of PCR-amplified class 1 and class 2 or 3 genes from each of strains NIBSC2001 through NIBSC2008 (Table 1) were prepared as described in Materials and Methods and hybridized to the membranes (50% formamide, 0.6 M NaCl) at an annealing temperature of 50 C. PCR-amplified OMP genes from the following strains were used as probes: (A) NIBSC2001 (P1.1,7); (B) NIBSC2002 (P1.6); (C) NIBSC2003 (P1.2); (D) NIBSC2004 (P1.9); (E) NIBSC2005 (P1.2); (F) NIBSC2006 (P1.1); (G) NIBSC2007 (P1.12,16); (H) NIBSC2008 (P1.15).

5 VOL. 30, 1992 TABLE 4. Subtyping of strains by dot blot analysis M13 clone NIBSC hybridizeda Epitope deduced Subtype determined strain from dot blot serologically" VR1 VR /D 2/E P1.-,15 NT /B 2/F P1.7,16 P /B 2/F P1.7,16 P /B 2/F P1.7,16 P /D 2/E P1.-,15 ND /B NH P1.7,- NT /A 2/D P1.5,10 NT /B NH P1.7,- NT /D NH P1.-,- NT a NH, no hybridization. bserosubtyped at the Meningococcal Reference Laboratory, Withington Hospital, Manchester, United Kingdom. ND, not determined; NT, not subtypeable by this method. for serosubtype by using monoclonal antibodies (strain NIBSC2131 had not been serosubtyped). Strains NIBSC 2058, NIBSC2063, and NIBSC2072 were known to have the P1.16 subtype, and the remaining strains were nontypeable by monoclonal antibodies. In five of the isolates, dot blot analysis revealed the presence of the nucleotide sequence encoding a P1.7 epitope that had not been detected by the monoclonal antibody subtyping reagents. Identification of novel subtype-specific nucleotide sequences. To extend the range of the dot blotting procedure, several previously undefined VRs were subjected to direct nucleotide sequence analysis. These sequences and their corresponding amino acid sequences are listed in Table 5. The P1.10 epitope cloned from strain 2151 was sequenced both from the M13 clone 2/D (Table 3) and directly from the PCR product. VR1 of strain NIBSC2214 differed by only one base from the P1.5 sequence in clone 1/A (Table 3), while VR2 in this strain was identical to the P1.10 sequence in clone 2/D. VR1 of strain NIBSC2216 encoded the P1.7 epitope, and the nucleotide sequence encoding the P1.4 epitope was determined by sequencing VR2 from the class 1 OMP gene in this strain. Both VR1 and VR2 of strain NIBSC2215 were novel. MENINGOCOCCAL SEROTYPING BY PCR 2839 DISCUSSION Previous work has shown that by using a pair of primers for the class 1 OMP gene, one of which was specific for a VR, PCR could be used to distinguish the subtype of a meningococcal strain (16, 23). This approach, however, was not suitable for routine application for two reasons: separate PCR amplifications with many different sets of primers were necessary, and high annealing temperatures that varied from one VR to another were required for discriminating between primers with similar sequences. The DNA dot blot technique was developed as a more-appropriate method for the routine subtyping of clinically important meningococcal isolates. Southern hybridization experiments demonstrated that VR-specific probes could be used to identify the epitopes encoded by serologically different strains (Fig. 2). Although this approach was potentially an alternative to subtyping meningococci, it suffered the disadvantage that each strain to be subtyped required repeated blotting with an extensive collection of VR-specific DNA probes (Fig. 1). The dot blot procedure overcame this problem by probing a reference collection of cloned VRs bound to a nylon filter in an ordered array, with the labeled class 1 OMP gene amplified by PCR from the untyped isolate. A single PCR was required for each isolate tested, and a maximum of three universal primers were needed to subtype any meningococcus. This technique was shown to be robust when tested with both serological reference strains and clinical isolates. The results were normally obtained after 4 h of autoradiography, and the specificity remained unchanged after overnight exposure. Analysis of strains that had proved difficult or impossible to subtype by the use of monoclonal antibodies (Table 4) showed that the dot blot analysis was more reliable, detecting at least one and usually both VRs in each strain examined. In addition, the dot blot procedure detected VRs, such as VR1 in strains NIBSC2054 and NIBSC2131, against which no corresponding monoclonal antibody has been isolated. A further advantage of this system is that newly defined VRs for which monoclonal reagents are not available can be readily cloned and incorporated onto the dot blot membrane directly from the PCR. The method also circumvents problems that arise from protein structure or the effects of other cell surface components. For example, in TABLE 5. Previously unpublished nucleotide sequences of VRs determined in this study NIBSC VW Sequence Epitope strain(s) A Q A A N G G A S G Q V K V GCA CAA GCC GCT AAC GGT GGA GCG AGC GGT CAG GTA AAA GTT P1.7 P L P N I Q P Q CCG CTC CCA AAT ATT CAA CCT CAG Q P S R T Q G Q T S N Q V K CAA CCC TCA AGA ACT CAA GGT CAA ACG AGC AAT CAG GTA AAA A Q A A N G G A S G Q V K V T K V GOCA CAA GCC GOCT AAC GGT GGA GCG AGC GGT CAG GTA AAA GTT ACT AAA GTT P1.7 T L A N V A N T N I G V P ACC CTT GOCT AAT GGT GOCT AAT ACA ATT ATC GGC GTT CCOG H F V Q N K Q N Q R P T L V P CAT TTT GTT CAG AAT AAG CAA AAT CAG CGG CCT ACT CTC GTT CCG P1.10 Y V D E K K ML V H A TAT GTG GAT GAG AAG AAA ATG GTT CAT GCG H V V V N N K V A T H V P CAT GTT GTT GTG AAT AAC AAG GTT GOCT ACT CAC GTT CCG P1.4 a The VR1 and VR2 nucleotide sequences are located from positions 34 to 89 and 502 to 548, respectively, in the published consensus sequence of pora.

6 2840 MAIDEN ET AL. five of the strains listed in Table 4, the dot blot analysis detected the nucleotide sequence encoding P1.7 epitope variants that were not identified by the monoclonal antibodies. The failure to detect this epitope by serological means may be related to the deletion of three codons (lysine-valinethreonine) that are repeated at the promoter-distal end of the VR1 and that encode some P1.7 epitopes. Besides confirming the primary structure of P1.10, nucleotide sequence analysis of the PCR products of the class 1 OMP genes from three additional serotyping reference strains (NIBSC2214, NIBSC2215, and NIBSC2216) identified four previously uncharacterized VRs; two were located in VR1, and two were located in VR2. All the VRs of strain NIBSC2215, including the less frequently variable VR3, were novel, making it impossible to assign the P1.6 and P1.14 epitopes unambiguously to a particular continuous epitope. A comparison of this sequence with the previously published P1.6 class 1 OMP gene from strain NIBSC2002 (16) suggested that P1.6 may be a discontinuous epitope with more than one cell surface loop of the OMP contributing to its structure. Since the dot blot analysis was unable to detect VR2 from strains NIBSC2147, NIBSC2149, and NIBSC2150, these undefined VRs were cloned into M13 mpl9 and sequenced directly by PCR for inclusion in the panel of reference DNAs. The nucleotide sequences of the cloned VR2 DNAs from strains NIBSC2147 and NIBSC2149 were identical to each other and to VR2 from strain NIBSC2216, indicating that these strains are of the P1.4 subtype (Tables 4 and 5). The serosubtyping of meningococci with monoclonal antibodies against VRs of the class 1 OMP is a valuable epidemiological tool (14, 21). In the case of serogroup A organisms, such serosubtyping can be used as an indicator of clonal subtype (6). The use of DNA-DNA hybridization in the dot blotting procedure to detect nucleotide sequences encoding the antigenically variable domains of this protein provides a simple, reliable, and cheap alternative to the use of monoclonal antibodies. Advantages of this system are that more VRs are detected than by the currently available monoclonal antibodies, new VRs are readily cloned and added to the system, standard DNA samples can be produced and distributed quickly and cheaply, and the membranes can be stripped and reused. Since meningococcal DNA can be PCR amplified directly from cerebrospinal fluid (15), a possible development of this approach is a method for diagnosis and typing in one step, which would make possible (i) the identification and typing of meningococci causing infection in patients undergoing antibiotic treatment and (ii) the investigation of stored serum and cerebrospinal fluid samples. The nucleotide sequences of a number of class 2 and 3 OMP genes encoding various serotyping antigens have been determined (4, 5, 10, 19, 28). These OMPs have a structure similar to that of the class 1 OMP (10, 26), with distinct VRs contributing to the serotype epitopes. The dot blot procedure described here could be extended to include nucleotide sequences from the serotyping antigens, thus permitting both meningococcal serotype and subtype to be determined in a single DNA-DNA hybridization experiment. ACKNOWLEDGMENTS We thank D. M. Jones and A. Fox of the PHLS, Withington Hospital, Manchester; J. T. Poolman of RIVM, Bilthoven, The Netherlands; and M. Achtman, Max-Planck-Institut fur molekulare Genetik, Berlin, Germany, for providing strains and interesting discussions. J. CLIN. MICROBIOL. This work was supported in part with a grant from the British Society for the Study of Infection. J.M. is funded by the National Meningitis Trust. REFERENCES 1. Abdillahi, H., and J. T. Poolman Whole-cell ELISA for typing Neissena meningitidis with monoclonal antibodies. FEMS Microbiol. 48: Achtman, M Molecular epidemiology of epidemic bacterial meningitis. Rev. Med. Microbiol. 1: Branham, S. E Serological relationships among meningococci. Bacteriol. Rev. 17: Butcher, S., M. Sarvas, and K. Runeberg Nyman Class-3 porin protein of Neisseria meningitidis: cloning and structure of the gene. Gene 105: Butcher, S. J., P. J. Omar, M. Sarvas, and K. Runeberg-Nyman Sequence comparisons of the class 1 genes from Neisseria meningitidis strains and a folding model of the class 1 protein, p In M. Achtman et al. (ed.), Neisseria Walter de Gruyter, Berlin. 6. Crowe, B. A., H. Abdillahi, J. T. Poolman, and M. Achtman Correlation of serological typing and clonal typing methods for Neisseria meningitidis serogroup A. J. Med. Microbiol. 26: Embley, T. M The linear PCR reaction: a simple and robust method for sequencing amplified rrna genes. Lett. Appl. Microbiol. 13: Evans, J. R., M. S. Artenstein, and D. M. Hunter Prevalence of meningococcal serogroups and description of three new groups. Am. J. Epidemiol. 87: Feavers, I. M., A. B. Heath, J. A. Bygraves, and M. C. J. Maiden Role of horizontal genetical exchange in the antigenic variation of the class 1 outer membrane protein of Neisseria meningitidis. Mol. Microbiol. 6: Feavers, I. M., J. Suker, A. J. McKenna, A. B. Heath, and M. C. J. Maiden Molecular analysis of the serotyping antigens of Neisseria meningitidis. Infect. Immun. 60: Frasch, C. E Development of meningococcal serotyping, p In N. A. Vedros (ed.), Evolution of meningococcal disease, 2nd ed. CRC Press, Inc., Boca Raton, Fla. 12. Frasch, C. E Vaccines for prevention of meningococcal disease. Clin. Microbiol. Rev. 2(Suppl.):S134-S Frasch, C. E., and S. Chapman Classification of Neissenia meningitidis group B into distinct serotypes. Infect. Immun. 5: Frasch, C. E., W. D. Zollinger, and J. T. Poolman Serotype antigens of Neisseria meningitidis and a proposed scheme for designation of serotypes. Rev. Infect. Dis. 7: Kristiansen, B.-E., E. Ask, A. Jenkins, C. Fremer, P. Radstrom, and 0. Skol Rapid diagnosis of meningococcal meningitis by polymerase chain reaction. Lancet 337: Maiden, M. C. J., J. Suker, A. J. McKenna, J. A. Bygraves, and I. M. Feavers Comparison of the class 1 outer membrane proteins of eight serological reference strains of Neisseria meningitidis. Mol. Microbiol. 5: Maniatis, T., E. F. Fritsch, and J. Sambroolk Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 18. McGuinness, B., A. K. Barlow, I. N. Clarke, J. E. Farley, A. Anilionis, J. T. Poolman, and J. E. Heckels Deduced amino acid sequences of class 1 protein PorA from three strains of Neissenia meningitidis. J. Exp. Med. 171: Murakami, K., E. C. Gotschlich, and M. E. Seiff Cloning and characterization of the structural gene for the class 2 protein of Neissena meningitidis. Infect. Immun. 57: Poolman, J. T., C. T. P. Hopman, and H. C. Zanen Problems in the definition of meningococcal serotypes. FEMS Microbiol. Lett. 13: Poolman, J. T., I. Lind, K. Jonsdottir, L. 0. Froholm, D. M. Jones, and H. C. Zanen Meningococcal serotypes and serogroup B disease in north-west Europe. Lancet ii:

7 VOL. 30, Schwartz, B., P. S. Moore, and C. V. Broome Global epidemiology of meningococcal disease. Clin. Microbiol. Rev. 2(Suppl.):S118-S Suker, J., A. J. McKenna, J. A. Bygraves, M. C. J. Maiden, and I. M. Feavers The use of PCR to study the class 1 outer membrane protein of Neisseria meningitidis, p In M. Achtman, P. Kohl, C. Marchal, G. Morelli, A. Seiler, and B. Theisen (ed.), Neisseria Walter de Gruyter, Berlin. 24. Tabor, S., and C. C. Richardson DNA sequence analysis with a modified bacteriophage T7 DNA polymerase. Proc. Natl. Acad. Sci. USA 84: Tsai, C.-M., C. E. Frasch, and L. F. Mocca Five structural classes of major outer membrane proteins in Neisseria meningitidis. J. Bacteriol. 146: MENINGOCOCCAL SEROTYPING BY PCR van der Ley, P., J. E. Heckels, M. Vir i, P. Hoogerhout, and J. T. Poolman Topology of outer membrane proteins in pathogenic Neisseria species. Infect. Immun. 59: Vedros, N. A Development of meningococcal serogroups, p In N. A. Vedros (ed.), Evolution of meningococcal disease, 2nd ed. CRC Press, Inc., Boca Raton, Fla. 28. Wolf, K., and A. Stern The class 3 outer membrane protein (PorB) of Neisseria meningitidis: gene sequence and homology to the gonococcal porin PIA. FEMS Microbiol. Lett. 83: Yanisch-Perron, C., J. Vieira, and J. Messing Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mpl8 and puc19 vectors. Gene 33:

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane

More information

Supplementary Information

Supplementary Information Supplementary Information A general solution for opening double-stranded DNA for isothermal amplification Gangyi Chen, Juan Dong, Yi Yuan, Na Li, Xin Huang, Xin Cui* and Zhuo Tang* Supplementary Materials

More information

Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC

Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC Supplementary Appendixes Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC ACG TAG CTC CGG CTG GA-3 for vimentin, /5AmMC6/TCC CTC GCG CGT GGC TTC CGC

More information

strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular

strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular Additional file 2 Identification of AOX1 in P. pastoris GS115 with a Mut s phenotype Results and Discussion The HBsAg producing strain was originally identified as a Mut s (methanol utilization slow) strain

More information

Supporting Information. Trifluoroacetophenone-Linked Nucleotides and DNA for Studying of DNA-protein Interactions by 19 F NMR Spectroscopy

Supporting Information. Trifluoroacetophenone-Linked Nucleotides and DNA for Studying of DNA-protein Interactions by 19 F NMR Spectroscopy Supporting Information Trifluoroacetophenone-Linked Nucleotides and DNA for Studying of DNA-protein Interactions by 19 F NMR Spectroscopy Agata Olszewska, Radek Pohl and Michal Hocek # * Institute of Organic

More information

Positively Charged Membrane

Positively Charged Membrane BIOBOND NYLON MEMBRANES ProductInformation Technical Bulletin No. MB-570 June 1999 Size Quantity Positively Charged Membrane Neutral Membrane 30 cm x 3.5 m 1 roll N4781 N1031 30 cm x 12 m 1 roll N4906

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/10/494/eaan6284/dc1 Supplementary Materials for Activation of master virulence regulator PhoP in acidic ph requires the Salmonella-specific protein UgtL Jeongjoon

More information

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) Laboratory for Environmental Pathogens Research Department of Environmental Sciences University of Toledo Polymerase Chain Reaction (PCR) Background information The polymerase chain reaction (PCR) is an

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

Genomics and Gene Recognition Genes and Blue Genes

Genomics and Gene Recognition Genes and Blue Genes Genomics and Gene Recognition Genes and Blue Genes November 1, 2004 Prokaryotic Gene Structure prokaryotes are simplest free-living organisms studying prokaryotes can give us a sense what is the minimum

More information

G+C content. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores.

G+C content. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores. 1 Introduction 2 Chromosomes Topology & Counts 3 Genome size 4 Replichores and gene orientation 5 Chirochores 6 7 Codon usage 121 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures Introduction

More information

Table S1. Bacterial strains (Related to Results and Experimental Procedures)

Table S1. Bacterial strains (Related to Results and Experimental Procedures) Table S1. Bacterial strains (Related to Results and Experimental Procedures) Strain number Relevant genotype Source or reference 1045 AB1157 Graham Walker (Donnelly and Walker, 1989) 2458 3084 (MG1655)

More information

SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer

SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer TEACHER S GUIDE SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer SYNOPSIS This activity uses the metaphor of decoding a secret message for the Protein Synthesis process. Students teach themselves

More information

Supplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana

Supplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana Cell, Volume 138 Supplemental Data mir156-regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana Jia-Wei Wang, Benjamin Czech, and Detlef Weigel Table S1. Interaction

More information

Electronic Supplementary Information Sensitive detection of polynucleotide kinase using rolling circle amplification-induced chemiluminescence

Electronic Supplementary Information Sensitive detection of polynucleotide kinase using rolling circle amplification-induced chemiluminescence Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Sensitive detection of polynucleotide kinase

More information

II 0.95 DM2 (RPP1) DM3 (At3g61540) b

II 0.95 DM2 (RPP1) DM3 (At3g61540) b Table S2. F 2 Segregation Ratios at 16 C, Related to Figure 2 Cross n c Phenotype Model e 2 Locus A Locus B Normal F 1 -like Enhanced d Uk-1/Uk-3 149 64 36 49 DM2 (RPP1) DM1 (SSI4) a Bla-1/Hh-0 F 3 111

More information

Lecture 11: Gene Prediction

Lecture 11: Gene Prediction Lecture 11: Gene Prediction Study Chapter 6.11-6.14 1 Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome Where are

More information

Recombinant DNA Technology

Recombinant DNA Technology History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

XactEdit Cas9 Nuclease with NLS User Manual

XactEdit Cas9 Nuclease with NLS User Manual XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of

More information

ChIP-chip protocol adapted for the mod-encode project

ChIP-chip protocol adapted for the mod-encode project ChIP-chip protocol adapted for the mod-encode project Version 1.2 : August 2007 Nicolas Nègre, Xiaochun Ni, Sergey Lavrov, Giacomo Cavalli and Kevin P. White University of Chicago, Department of Human

More information

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR

More information

Sexing Bovine Preimplantation Embryos by PCR

Sexing Bovine Preimplantation Embryos by PCR Sexing Bovine Preimplantation Embryos by PCR Katherine E.M. Hendricks 1, Leydson F. Martins 2, Justin M. Fear 1 and Peter J. Hansen 1 1 Dept. of Animal Sciences, University of Florida and Department of

More information

Wet Lab Tutorial: Genelet Circuits

Wet Lab Tutorial: Genelet Circuits Wet Lab Tutorial: Genelet Circuits DNA 17 This tutorial will introduce the in vitro transcriptional circuits toolkit. The tutorial will focus on the design, synthesis, and experimental testing of a synthetic

More information

Supporting Information

Supporting Information Supporting Information Wiley-VCH 2006 69451 Weinheim, Germany Rolling-circle Amplification of a DNA Nanojunction Chenxiang Lin, Mingyi Xie, Julian J.L. Chen, Yan Liu and Hao Yan A. RCA replication of the

More information

DNA 5 End-Labeling System INSTRUCTIONS FOR USE OF PRODUCT U2010.

DNA 5 End-Labeling System INSTRUCTIONS FOR USE OF PRODUCT U2010. Technical Bulletin DNA 5 End-Labeling System INSTRUCTIONS FOR USE OF PRODUCT U2010. PRINTED IN USA. Revised 12/12 DNA 5 End-Labeling System All technical literature is available on the Internet at: www.promega.com/protocols/

More information

Amplified Analysis of DNA by the Autonomous Assembly of Polymers Consisting of DNAzyme Wires

Amplified Analysis of DNA by the Autonomous Assembly of Polymers Consisting of DNAzyme Wires Supporting information for the paper: Amplified Analysis of DNA by the Autonomous Assembly of Polymers Consisting of DNAzyme Wires Fuan Wang, Johann Elbaz, Ron Orbach, Nimrod Magen and Itamar Willner*

More information

MOLECULAR CLONING AND SEQUENCING OF FISH MPR 46

MOLECULAR CLONING AND SEQUENCING OF FISH MPR 46 MOLECULAR CLONING AND SEQUENCING OF FISH MPR 46 INTRODUCTION The mammalian MPR 46 (human, mouse, bovine) sequences show extensive homologies. Among the non-mammalian vertebrates, only a partial sequence

More information

Molecular Techniques Third-year Biology

Molecular Techniques Third-year Biology PLANNING Genetics Lab practices Molecular Techniques. Genetics Lab practices protocol. 2015-16 PCR-DIRECTED MUTAGENESIS, MOLECULAR CLONING AND RESTRICTION ANALYSIS Sessions 1 & 2 (2x3 hours): PCR-directed

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Information Ultrasensitive and Selective DNA Detection Based on Nicking Endonuclease Assisted Signal Amplification and Its Application in Cancer Cells Detection Sai Bi, Jilei Zhang,

More information

2.5. Equipment and materials supplied by user Template preparation by cloning into plexsy_invitro-2 vector 4. 6.

2.5. Equipment and materials supplied by user Template preparation by cloning into plexsy_invitro-2 vector 4. 6. Manual 15 Reactions LEXSY in vitro Translation Cell-free protein expression kit based on Leishmania tarentolae contains the vector plexsy_invitro-2 Cat. No. EGE-2002-15 FOR RESEARCH USE ONLY. NOT INTENDED

More information

SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes

SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes WHITE PAPER SuperScript IV Reverse Transcriptase SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes Abstract Reverse transcriptases (RTs) from avian myeloblastosis virus

More information

A high efficient electrochemiluminescence resonance energy. transfer system in one nanostructure: its application for

A high efficient electrochemiluminescence resonance energy. transfer system in one nanostructure: its application for Supporting Information for A high efficient electrochemiluminescence resonance energy transfer system in one nanostructure: its application for ultrasensitive detection of microrna in cancer cells Zhaoyang

More information

WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits

WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits Code N221-KIT N220-KIT Description WesternMAX Chemiluminescent AP Kit, Anti-Mouse Includes: Alkaline Phosphatase (AP) Conjugated Anti-Mouse

More information

Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers

Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers DNA Research 9, 163 171 (2002) Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers Shinobu Nasu, Junko Suzuki, Rieko

More information

Reviewed: Davis, Oseroff

Reviewed: Davis, Oseroff Microarray Core UCSF Comprehensive Cancer Center Standard Operating Procedure Title: Preparation of Spotting Solutions from BAC DNA SOP No.: MC010 Version: 1 Date: 11-04-03 Page No.: 1 of 14 Authors: Albertson,

More information

Genetic Engineering & Recombinant DNA

Genetic Engineering & Recombinant DNA Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied

More information

Cloning and Expression of a Haloacid Dehalogenase Enzyme. By: Skyler Van Senior Research Advisor: Dr. Anne Roberts

Cloning and Expression of a Haloacid Dehalogenase Enzyme. By: Skyler Van Senior Research Advisor: Dr. Anne Roberts Cloning and Expression of a Haloacid Dehalogenase Enzyme By: Skyler Van Senior Research Advisor: Dr. Anne Roberts utline The gene being cloned is JHP1130 from Helicobacter pylori (H. pylori) JHP1130 is

More information

NEBNext Multiplex Oligos for Illumina (Index Primers Set 3)

NEBNext Multiplex Oligos for Illumina (Index Primers Set 3) LIBRARY PREPARATION NEBNext Multiplex Oligos for (Index Primers Set 3) Instruction Manual NEB #E7710S/L 24/96 reactions This product is intended for research purposes only. This product is not intended

More information

Sensitivity vs Specificity

Sensitivity vs Specificity Viral Detection Animal Inoculation Culturing the Virus Definitive Length of time Serology Detecting antibodies to the infectious agent Detecting Viral Proteins Western Blot ELISA Detecting the Viral Genome

More information

In-Fusion Advantage PCR Cloning Kit

In-Fusion Advantage PCR Cloning Kit User Manual In-Fusion Advantage PCR Cloning Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.

More information

NEBNext Multiplex Oligos for Illumina (Index Primers Set 4)

NEBNext Multiplex Oligos for Illumina (Index Primers Set 4) LIBRARY PREPARATION NEBNext Multiplex Oligos for (Index Primers Set 4) Instruction Manual NEB #E7730S/L 24/96 reactions Version 2.0 12/16 be INSPIRED drive DISCOVERY stay GENUINE This product is intended

More information

MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien

MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien Introduction MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien The field of molecular genetics has resulted in a number of practical applications that have been of tremendous

More information

Codon Bias with PRISM. 2IM24/25, Fall 2007

Codon Bias with PRISM. 2IM24/25, Fall 2007 Codon Bias with PRISM 2IM24/25, Fall 2007 from RNA to protein mrna vs. trna aminoacid trna anticodon mrna codon codon-anticodon matching Watson-Crick base pairing A U and C G binding first two nucleotide

More information

FMF NIRCA PROTOCOL STEP 1.

FMF NIRCA PROTOCOL STEP 1. FMF NIRCA PROTOCOL STEP 1. After you have isolated patient s DNA and DNA from a healthy donor (wild type), you perform a nested PCR. The primers used to amplify exon 2 and exon 10 of the mefv gene are

More information

Vectors for Gene Cloning: Plasmids and Bacteriophages

Vectors for Gene Cloning: Plasmids and Bacteriophages Vectors for Gene Cloning: Plasmids and Bacteriophages DNA molecule must be able to replicate within the host cell to be able to act as a vector for gene cloning, so that numerous copies of the recombinant

More information

1. Add 7 µg genomic DNA (35 µl of 200 ng/µl) to a labeled 1.5 ml microcentrifuge tube. Bring total volume to 35 µl with sterile distilled H 2 O.

1. Add 7 µg genomic DNA (35 µl of 200 ng/µl) to a labeled 1.5 ml microcentrifuge tube. Bring total volume to 35 µl with sterile distilled H 2 O. Southern blot test for the Fragile X syndrome Digestion of genomic DNA 1. Add 7 µg genomic DNA (35 µl of 200 ng/µl) to a labeled 1.5 ml microcentrifuge tube. Bring total volume to 35 µl with sterile distilled

More information

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics

More information

Supplemental Information. Target-Mediated Protection of Endogenous. MicroRNAs in C. elegans. Inventory of Supplementary Information

Supplemental Information. Target-Mediated Protection of Endogenous. MicroRNAs in C. elegans. Inventory of Supplementary Information Developmental Cell, Volume 20 Supplemental Information Target-Mediated Protection of Endogenous MicroRNAs in C. elegans Saibal Chatterjee, Monika Fasler, Ingo Büssing, and Helge Großhans Inventory of Supplementary

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Product Name : Simple mirna Detection Kit

Product Name : Simple mirna Detection Kit Product Name : Simple mirna Detection Kit Code No. : DS700 This product is for research use only Kit Contents This kit provides sufficient reagents to perform 20 reactions for detecting microrna. Components

More information

Purification and Characterization of a DNA Plasmid Part A CHEM 4581: Biochemistry Laboratory I Version: January 18, 2008

Purification and Characterization of a DNA Plasmid Part A CHEM 4581: Biochemistry Laboratory I Version: January 18, 2008 Purification and Characterization of a DNA Plasmid Part A CHEM 4581: Biochemistry Laboratory I Version: January 18, 2008 INTRODUCTION DNA Plasmids. A plasmid is a small double-stranded, circular DNA molecule

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Blanken MO, Rovers MM, Molenaar JM, et al. Respiratory syncytial

More information

Synthetic Biology for

Synthetic Biology for Synthetic Biology for Plasmids and DNA Digestion Plasmids Plasmids are small DNA molecules that are separate from chromosomal DNA They are most commonly found as double stranded, circular DNA Typical plasmids

More information

Diagnosis and Quantification of Strawberry Vein Banding Virus Using Molecular Approaches

Diagnosis and Quantification of Strawberry Vein Banding Virus Using Molecular Approaches Diagnosis and Quantification of Strawberry Vein Banding Virus Using Molecular Approaches Ali Mahmoudpour Department of Plant Pathology, University of California, Davis, CA, 95616, USA Current Address:

More information

Roche Molecular Biochemicals Technical Note No. LC 10/2000

Roche Molecular Biochemicals Technical Note No. LC 10/2000 Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce

More information

PROTEIN SYNTHESIS Study Guide

PROTEIN SYNTHESIS Study Guide PART A. Read the following: PROTEIN SYNTHESIS Study Guide Protein synthesis is the process used by the body to make proteins. The first step of protein synthesis is called Transcription. It occurs in the

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

3 Designing Primers for Site-Directed Mutagenesis

3 Designing Primers for Site-Directed Mutagenesis 3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed

More information

CHAPTER 9 DNA Technologies

CHAPTER 9 DNA Technologies CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes

More information

Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer. Application Note. Odilo Mueller. Abstract

Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer. Application Note. Odilo Mueller. Abstract Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer Application Note Odilo Mueller Abstract This application note describes how the Agilent Technologies 2100 bioanalyzer can be used

More information

MOK. Media Optimization Kit

MOK. Media Optimization Kit MOK Media Optimization Kit The Media Optimization Kit determines the best medium formulation for maximizing accumulation of recombinant proteins expressed in E. coli, utilizing a series of Athena s superior

More information

Pinpoint Slide DNA Isolation System Catalog No. D3001

Pinpoint Slide DNA Isolation System Catalog No. D3001 INSTRUCTIONS Pinpoint Slide DNA Isolation System Catalog No. D3001 Highlights Easily isolates genomic DNA in any targeted microscopic tissue area on a slide. The simple procedure combines Pinpoint tissue

More information

II First Strand cdna Synthesis Kit

II First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR ProtoScript II First Strand cdna Synthesis Kit Instruction Manual NEB #E6560S/L 30/150 reactions Version 1.5 12/17 be INSPIRED drive DISCOVERY stay GENUINE This product is intended

More information

Lecture 18. PCR Technology. Growing PCR Industry

Lecture 18. PCR Technology. Growing PCR Industry Lecture 18 PCR Technology Growing PCR Industry Basic PCR, Cloning of PCR product, RT-PCR, RACE, Quantitative PCR, Multiplex PCR, Hot start PCR, Touchdown PCR,PCR sequencing.. How PCR started The DNA duplex

More information

Biotin 3' End DNA Labeling Kit

Biotin 3' End DNA Labeling Kit INSTRUCTIONS Biotin 3' End DNA Labeling Kit 3747 N. Meridian Road P.O. Box 117 Rockford, IL 61105 89818 1290.4 Number Description 89818 Biotin 3' End DNA Labeling Kit, sufficient reagents to perform 20

More information

Human IL-10 ELISA MAX Set Deluxe

Human IL-10 ELISA MAX Set Deluxe Human IL-10 ELISA MAX Set Deluxe Cat. No. 430604 (5 plates) 430605 (10 plates) 430606 (20 plates) ELISA Set for Accurate Cytokine Quantification from Cell Culture Supernatant, Serum, Plasma or Other Body

More information

Olerup SSP KIR Genotyping

Olerup SSP KIR Genotyping KIR Genotyping Product Insert Page 1 of 16 Olerup SSP KIR Genotyping Product number: Lot number: 98V Expiry date: 2016-December-01 Number of tests: 12 Number of wells per test: 23 + 1 Storage - pre-aliquoted

More information

Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab

Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab With the Gateway cloning system, a PCR fragment is

More information

KOD -Plus- Mutagenesis Kit

KOD -Plus- Mutagenesis Kit Instruction manual KOD -Plus- Mutagenesis Kit 0811 F0936K KOD -Plus- Mutagenesis Kit SMK-101 20 reactions Store at -20 C Contents [1] Introduction [2] Flow chart [3] Components [4] Notes [5] Protocol 1.

More information

Illuminator Chemiluminescent Detection System

Illuminator Chemiluminescent Detection System Illuminator Chemiluminescent Detection System INSTRUCTION MANUAL Catalog #300360 (Illuminator Chemiluminescent Detection System), and #300362 (Illuminator Chemiluminescent Detection System with Prime-It

More information

STUDIES ON THE FUSION OF LIGNINOLYTIC ENZYME cdnas AND THEIR EXPRESSION

STUDIES ON THE FUSION OF LIGNINOLYTIC ENZYME cdnas AND THEIR EXPRESSION STUDIES ON THE FUSION OF LIGNINOLYTIC ENZYME cdnas AND THEIR EXPRESSION Jun Xie, a* Lei Feng, a Ning Xu, a Guohui Zhu, a Jun Yang, a Xiaoli Xu, a and Shiyu Fu b* Manganese peroxidase (MnP) and lignin peroxidase

More information

Guide-it Indel Identification Kit User Manual

Guide-it Indel Identification Kit User Manual Clontech Laboratories, Inc. Guide-it Indel Identification Kit User Manual Cat. No. 631444 (120114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain View, CA 94043, USA

More information

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation 1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous

More information

DNA Purification for Case Transgene Pronuclear Injection Updated 2/26/08 RM

DNA Purification for Case Transgene Pronuclear Injection Updated 2/26/08 RM DNA Purification for Case Transgene Pronuclear Injection Updated 2/26/08 RM Materials: Stratagene StrataPrep DNA Gel Extraction Kit (Catalog #400766 or #400768) http://www.stratagene.com/products/displayproduct.aspx?pid=448

More information

Protein Synthesis: Transcription and Translation

Protein Synthesis: Transcription and Translation Review Protein Synthesis: Transcription and Translation Central Dogma of Molecular Biology Protein synthesis requires two steps: transcription and translation. DNA contains codes Three bases in DNA code

More information

Two methods for the genetic di erentiation of Lactococcus lactis ssp. lactis and cremoris based on di erences in the 16S rrna gene sequence

Two methods for the genetic di erentiation of Lactococcus lactis ssp. lactis and cremoris based on di erences in the 16S rrna gene sequence FEMS Microbiology Letters 166 (1998) 15^20 Two methods for the genetic di erentiation of Lactococcus lactis ssp. lactis and cremoris based on di erences in the 16S rrna gene sequence Lawrence J.H. Ward

More information

ProtoScript. First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR. Instruction Manual. NEB #E6300S/L 30/150 reactions Version 2.

ProtoScript. First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR. Instruction Manual. NEB #E6300S/L 30/150 reactions Version 2. DNA AMPLIFICATION & PCR ProtoScript First Strand cdna Synthesis Kit Instruction Manual NEB #E6300S/L 30/150 reactions Version 2.2 11/16 be INSPIRED drive DISCOVERY stay GENUINE This product is intended

More information

Supplemental Data. Lin28 Mediates the Terminal Uridylation. of let-7 Precursor MicroRNA. Molecular Cell, Volume 32

Supplemental Data. Lin28 Mediates the Terminal Uridylation. of let-7 Precursor MicroRNA. Molecular Cell, Volume 32 Molecular Cell, Volume 32 Supplemental Data Lin28 Mediates the Terminal Uridylation of let-7 Precursor MicroRNA Inha Heo, Chirlmin Joo, Jun Cho, Minju Ha, Jinju Han, and V. Narry Kim Figure S1. Endogenous

More information

Application of DNA machine in amplified DNA detection

Application of DNA machine in amplified DNA detection Electronic Supplementary Information Application of DNA machine in amplified DNA detection Hailong Li, Jiangtao Ren, Yaqing Liu,* and Erkang Wang* State Key Lab of Electroanalytical Chemistry, Changchun

More information

Genetic Fingerprinting

Genetic Fingerprinting Genetic Fingerprinting Introduction DA fingerprinting In the R & D sector: -involved mostly in helping to identify inherited disorders. In forensics: -identification of possible suspects involved in offences.

More information

NEBNext Magnesium RNA Fragmentation Module

NEBNext Magnesium RNA Fragmentation Module SAMPLE PREPARATION NEBNext Magnesium RNA Fragmentation Module Instruction Manual NEB #E6150S 200 reactions NEBNext Magnesium RNA Fragmentation Module Table of Contents: Description....2 Applications....2

More information

PureSpin DNA Clean Up Kit

PureSpin DNA Clean Up Kit PureSpin DNA Clean Up Kit Micro Columns INSTRUCTION MANUAL KIT COMPONENTS For Research Use Only PureSpin DNA Clean Up Kit, Micro Columns w/out Caps (Kit Size) OD2080 (50 Preps.) OD2080-2 (200 Preps.) Storage

More information

Biomolecules: lecture 6

Biomolecules: lecture 6 Biomolecules: lecture 6 - to learn the basics on how DNA serves to make RNA = transcription - to learn how the genetic code instructs protein synthesis - to learn the basics on how proteins are synthesized

More information

INTRODUCTION TO THE MOLECULAR GENETICS OF THE COLOR MUTATIONS IN ROCK POCKET MICE

INTRODUCTION TO THE MOLECULAR GENETICS OF THE COLOR MUTATIONS IN ROCK POCKET MICE The Making of the The Fittest: Making of the Fittest Natural Selection Natural and Adaptation Selection and Adaptation Educator Materials TEACHER MATERIALS INTRODUCTION TO THE MOLECULAR GENETICS OF THE

More information

porablot nitrocellulose membranes

porablot nitrocellulose membranes Table of Contents 1. Introduction 2 2. Southern (DNA) and Northern (RNA) Hybridizations 2 2.1 Gel Preparation 2 2.2 Membrane Preparation 2 2.3 Capillary Transfer 2 2.4 Alternative Transfer Systems 3 2.5

More information

The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity

The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity Promega Notes Magazine Number 62, 1997, p. 02 The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity By Christine Andrews and Scott Lesley Promega

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

This article reprinted from: Dooley, M. M Restriction endonuclease digestion of a plasmid.

This article reprinted from: Dooley, M. M Restriction endonuclease digestion of a plasmid. This article reprinted from: Dooley, M. M. 2008. Restriction endonuclease digestion of a plasmid. Pages 389-392, in Tested Studies for Laboratory Teaching, Volume 29 (K.L. Clase, Editor). Proceedings of

More information

DNA Replication. DNA Replication. Meselson & Stahl Experiment. Contents

DNA Replication. DNA Replication. Meselson & Stahl Experiment. Contents DNA Replication Contents 1 DNA Replication 1.1 Meselson & Stahl Experiment 1.2 Replication Machinery 2 Polymerase Chain Reaction (PCR) 3 External Resources: DNA Replication Meselson & Stahl Experiment

More information

TECHNICAL BULLETIN. GenElute mrna Miniprep Kit. Catalog MRN 10 MRN 70

TECHNICAL BULLETIN. GenElute mrna Miniprep Kit. Catalog MRN 10 MRN 70 GenElute mrna Miniprep Kit Catalog Numbers MRN 10, MRN 70 TECHNICAL BULLETIN Product Description The GenElute mrna Miniprep Kit provides a simple and convenient way to purify polyadenylated mrna from previously

More information

1. COMPONENTS. PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) 2. STORAGE 3. DESCRIPTION

1. COMPONENTS. PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) 2. STORAGE 3. DESCRIPTION 1 2 1 PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) TABLE OF CONTENTS 1. COMPONENTS... 2 2. STORAGE... 2 3. DESCRIPTION... 2 4. PROTOCOL FOR FAST PCR... 3 4.1. General Considerations...

More information

The Production of a Recombinant Biotechnology Product. Chapter 8

The Production of a Recombinant Biotechnology Product. Chapter 8 The Production of a Recombinant Biotechnology Product Chapter 8 Objectives Give a basic overview of genetic engineering. Describe the processes involved in isolating a piece DNA of interest Mass producing

More information

Cloning and Sequence Analysis of the 22-kDa Antigen Genes of Orientia tsutsugamushi Strains Kato, TA763, AFSC 7, , TH1814, and MAK 119

Cloning and Sequence Analysis of the 22-kDa Antigen Genes of Orientia tsutsugamushi Strains Kato, TA763, AFSC 7, , TH1814, and MAK 119 Cloning and Sequence Analysis of the 22-kDa Antigen Genes of Orientia tsutsugamushi Strains Kato, TA763, AFSC 7, 18-032460, TH1814, and MAK 119 HONG GE, a MIN TONG, a ANDREW LI, b RAJAN MEHTA, b AND WEI-MEI

More information

Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further. (Promega) and DpnI (New England Biolabs, Beverly, MA).

Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further. (Promega) and DpnI (New England Biolabs, Beverly, MA). 175 Appendix III Chapter 4 Methods General. Unless otherwise noted, reagents were purchased from the commercial suppliers Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further

More information

Supplemental Data. Distinct Pathways for snorna and mrna Termination

Supplemental Data. Distinct Pathways for snorna and mrna Termination Molecular Cell, Volume 24 Supplemental Data Distinct Pathways for snorna and mrna Termination Minkyu Kim, Lidia Vasiljeva, Oliver J. Rando, Alexander Zhelkovsky, Claire Moore, and Stephen Buratowski A

More information

Genetics Lecture 21 Recombinant DNA

Genetics Lecture 21 Recombinant DNA Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of

More information

Supplemental Data. Short Article. Transcriptional Regulation of Adipogenesis by KLF4. Kıvanç Birsoy, Zhu Chen, and Jeffrey Friedman

Supplemental Data. Short Article. Transcriptional Regulation of Adipogenesis by KLF4. Kıvanç Birsoy, Zhu Chen, and Jeffrey Friedman Cell Metabolism, Volume 7 Supplemental Data Short Article Transcriptional Regulation of Adipogenesis by KLF4 Kıvanç Birsoy, Zhu Chen, and Jeffrey Friedman Supplemental Experimental Procedures Plasmids

More information

MightyAmp DNA Polymerase Ver.3

MightyAmp DNA Polymerase Ver.3 Cat. # R076A For Research Use MightyAmp DNA Polymerase Ver.3 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. General PCR Reaction Mix... 3 V. Primer Design...

More information

Event-specific Method for the Quantification of Soybean Line A Using Real-time PCR. Protocol

Event-specific Method for the Quantification of Soybean Line A Using Real-time PCR. Protocol Event-specific Method for the Quantification of Soybean Line A2704-12 Using Real-time PCR Protocol 14 May 2007 Directorate General-Joint Research Centre Institute for Health and Consumer Protection Biotechnology

More information