Site-directed mutagenesis of proteins

Transcription

1 IFM/Kemi Linköpings Universitet August 2013/LGM Labmanual Site-directed mutagenesis of proteins

2 Figur 1: Flow-chart of the site-directed mutagenesis lab exercise 2

3 Site-specific mutagenesis Introduction In vitro site-specific mutagenesis is an invaluable technique for e.g. study the correlation between protein structure and function or modification of vectors for cloning purposes. Over the last decade there has been developed a number of efficient and reliable techniques for creation location-specific mutations in DNA using synthetic oligonucletides. In this course we will use a technique called Quik-Change site-directed mutagenesis, a kit developed and commercialized by Stratagene. The main advantage of this method is that it does not require single stranded DNA (ss-dna), this results in elimation of subcloning steps in M13 based bacteriophages to obtain ss-dna. In addition, this method requires no specialized vectors or unique restriction sites and you can use basically any double stranded DNA plasmid. This method is based on the use of the enzyme Pfu Turbo DNA polymerase II. This is a heat-resistant DNA polymerase that replicates both DNA strands with great accuracy without displacing the mutant oligonucleotide. In this mutagenesis method a double-stranded plasmid with a gene (a gene coding for the protein Fatty acid binding protein, FABP) to be modified is used. Using two synthetic oligonucleotides ( primers ), each complementary to one of the DNA strands of the vector with mismatches corresponding to the desired mutation. The DNA strand are amplified during temperature cycles (PCR) (Figure 2). The extension of the DNA strands gives a nicked DNA after completion of the temperature cycle the sample is treated with the enzyme DpnI endonuclease. This enzyme is specific for methylated and hemi-methylated DNA and used to cleave the original DNA strand and select for the mutant containing newly synthesized DNA. Nearly all the DNA isolated from E. coli is methylated and therefore available for degradation with DpnI. 3

4 Figure 2. Schematic drawing of the Quik-change method. 4

5 Fatty acid binding protein (FABP) Background Fatty acid binding protein (FABP) is a cytosolic protein that transports various fatty acids. To study this protein, FABP was cloned from the Saharan desert ant,cataglyphis fortis and the protein can be expressed in E.coli. This protein consist of 134 amino acids with a His-tag construction of 20 amino acids to facilitate purification of the protein (See appendices for the construction of the clone) A common way of studying protein is the use of spectroscopic methods such as tryptophan fluorescence. One difficulty in the study of FABP from this species is that it lacks tryptophans to be used as spectroscopic probes. With the help of site-specific mutagenesis techniques, we will create variants of FABP that all contain a single tryptophan residue. In order to find suitable positions for the introduced tryptophan residues, a method called threading has been used where the three-dimensional structure from rat FABP (pdb code 1IFB) was used as a template. Figure 3 Aligned modeled structure of FABP from Desert ant (gray) and FABP from rat (green). Illustrated in red are the side chains to be mutated and the corresponding side chains in rat FBP (yellow) 5

6 Site-directed mutagenesis Material: Double stranded plasmid (approx. 10 ng) Mutagenesis primer (forward) Mutagenesis primer (reverse) Control plasmid, pwhitescript (4.5 kb, 10ng/µl) Control primer (forward) Control primer (reverse) 10 X Reaction buffer Pfu Turbo DNA polymerase DpnI Endonuclease dntp mix Sterile water Autoclaved PCR tubes Sample: In a PCR tube add: 1 µl (10ng) Double stranded plasmid (labeled FABP plasmid) 2.5 µl 10x Reaction buffer 1 µl Mutagenesis primer (forward) 1 µl Mutagenesis primer (reverse) 0.5 µl dntp mix 18.5 µl sterile water 0.5 µl Pfu turbo DNA polymerase (2.5 U/µl) Totalt volume: 25 µl Add all component to a PCR tube and finally add Pfu Turbo DNA polymerase. Mix by centrifugation a few seconds. 6

7 Control: (Only 1 control/lab session) In a PCR tube add: 1 µl (10ng) pwhitescript (Control plasmid) 2.5 µl 10x Reaction buffer 0.6 µl Control primer (forward) 0.6 µl Control primer (reverse) 0.5 µl dntp mix 18.5 µl sterile water 0.5 µl Pfu turbo DNA polymerase (2.5 U/µl) Totalt volume: 25 µl Add all component to a PCR tube and finally add Pfu Turbo DNA polymerase. Mix by centrifugation a few seconds. 1) Put the PCR tube(s) in a PCR machine and set following temperature cycle: 95 C (30 seconds), 55 C (1 minute) and 68 C (6 minutes) Repeat 16 times 2) When the PCR cycle is finished, SAVE 5 µl in a new eppendorff tube for later analysis on an agarose gel. 3) To the rest of the mixture add 0.5 µl DpnI endonuclease, mix by centrifugation a few seconds and incubate at 37 C for 1 hour. 4) The samples are now ready for transformation and the remaining of the samples will be stored in -20 C freezer in a new eppendorff tube properly labeled. Further readings: T.A. Brown Gene cloning and DNA analysis (6 th edition) p

8 Transformation of plasmid after site-directed mutagenesis Material: Agarplates with Ampicillin (Amp) or Kanamycin (Kan) resistance NZY+ Broth (or LB medium) IPTG Xgal Sample after site-specific mutagenesis (FABP variant) Control sample after site-specific mutagenesis Transformation control, puc18 Epicurian coli XL-1 blue supercompetent cells Procedure: 1) Thaw the super-competent Epicurian coli XL-1 blue cells portioned in 20 µl 2) To each 20 µl's portion of the super-competent cells are added 5 µl of the sample, or transformation control. 3) Mix gently with pipette tip and incubate on ice for 30 minutes. 4) "Heat shock" the cells by placing the tubes in heating block 45 seconds at 42 C, then place tubes on ice for 2 minutes. 5) Add 100 µl of preheated (42 C) NZY+ Broth culture medium (or LB medium) and incubate the transformation reaction 1 hour at 37 C. 6) Take all of the incubated mixture and spread on agar plate with Kanamycin resistance (FABP samples) or ampicillin resistance (transformation control) 7) The day after the transformation (approximately 16 hours). Count the number of colonies on the agar media. 8) All agar plates are stored in cold room wrapped in a parafilm. NOTE : Control sample plates are treated as follows: 1) Prepare the agar plate by adding 20 µl 10% (w/v) X-gal and 20 µl IPTG in a 100 µl NZY+ Broth culture and spread on the agar plate and let it dry for 30 minutes at 37 C 2) Follow the same procedure as for samples and transformation control. 8

9 Readings: T.A Brown Gene Cloning and DNA analysis, 6 th edition, page

10 Preparation of plasmids Material: 25 ml culture tubes LB medium Kanamycin (stock solution) Qiaprep spin column kit Autoclaved eppendorff tubes and pipette tips Sterile water Preparation of plasmid: For preparation of plasmids a kit from Qiagen (Qiaprep spin kit) will be used. This kit is based on binding of plasmid DNA to a silica gel matrix. The day before plasmid preparation an overnight culture of E.coli with the desired plasmid is prepared. E. coli are grown in culture tubes containing 10 ml culture medium in the presence of kanamycin. The culture are allowed to grow overnight at 37 C with shaking. 1) Every lab group fills two eppendorff tubes (approx.1.5 ml) with overnight culture of the plasmid you want to prepare. 2) Centrifuge in a table top centrifuge rpm for 5 min 3) Withdraw the supernatant with a Pasteur pipette. 4) Resuspend the pellet in a total of 250 µl of buffer P1(125 µl to each epp.tube) Resuspend the cells completely and pool the two tubes together. 5) Add 250 µl of buffer P2. Mix by inverting a few times, the cell suspension should clear up almost immediately. 6) Add 350 µl buffer N3 and mix immediately by inverting the tubes a few times. A precipitate (white clouds ) of denatured chromosomal DNA will be visible 7) Centrifuge at rpm for 10 minutes to pellet down the chromosomal DNA (plasmid DNA will be in the supernatant). 8) Transfer the supernatant into the Qiaprep spin column 9) Centrifuge at rpm for 1 minute 10

11 10) Discard the liquid from the plastic tube and add 750 µl Buffer PE to the column 11) Centrifuge rpm for 1 min and discard the buffer from the plastic tube and centrifuge the column to dryness for 1 minute at pm. 12) Transfer the column to a clean (sterile) eppendorff tube and add 50 µl sterile water to the column. 13) Centrifuge at rpm for 1 min. The Plasmid is now eluted from the column and should be stored in -20 freezer. 11

12 Agarose gelelectrophoresis Materials: Agarose 10 x TBE buffer Ethidium bromide bath (prepared by Lab assistant) DNA molecular weight ladder Plasmids after plasmid preparation Procedure: 1) In a 250 ml bottle is added g agarose and 10ml 10x TBE buffer and diluted with water to total volume of 100ml. 2) Heat the agarose gel in a microwave until it is completely disolved. Let the mixture cool for a while (about 60 o C) and pour the agarose gel in the agarose gel cassettes. Allow the gel to cool for at least 30 minutes. Electrophoretic separation of DNA 1) Mix 4 µl loading buffer with 5 µl DNA and 11 µl H2O. 2) Add 5 µl premixed molecular weight marker 3) Add agarose gel in electrophoresis apparatus and fill with 1X TBE buffer to cover gel. 4) Apply gently and slowly the samples in sample wells with a automatic pipette 5) Separate the DNA fragments by applying a voltage ~ 100 Volts. Remember that DNA is negatively charged. 6) When the blue marker has reached about 2 / 3 down the gel is interrupted electrophoresis and DNA fragments stained with ethidium bromide. Ethidium Bromide intercalate with DNA and can be seen when the gel is illuminated with nm light at a transluminator. Protect your eyes by using safety glasses and wear gloves when working with Ethidium Bromide. 7) Take a picture of the gel and estimate the amount of DNA you have received. Furher readings: T.A Brown Gene Cloning and DNA analysis, 6 th edition, page

13 Appendix DNA sequence of FABP from Desert ant 5 - ATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGC CATATGTCCATCAACGAGATTCTTGGAAAACGTTACAAGCTCTCTAGTAGCGAAAAT TTCGACGATTTTATGAAGGCACTCGGCGTAGGTATGGTGACGCGGAAAATGGGTGCT ACGGTCAGTCCCGTCGTCGAATTGACGGAGAAAGACGGAGTGTATACTCTAAAGACG ACTAGTACCTTCAAAAACACGGAAATAAAATTCAAACTTGGCGAAGAATTCGATGAA GACACCGTGGACGGTAGAAAAGTGAAGAGTGTCTGCACTCTGGAAGGTAATAAACTC ATACAGGTGCAGAAAGGTGATAAGAATACTACGATTGAAAGGGAATTCACACCTACA GAGATGGAAGCGATCATGAAAGTTGATGACATAGTTTGCACAAGAGTATATAAGATC CAGGAATAA-3 DNA and amino acid sequence of FABP from Desert ant 5 -atgggcagcagccatcatcatcatcatcacagcagcggcctggtgccgcgcggcagccat M G S S H H H H H H S S G L V P R G S H atgtccatcaacgagattcttggaaaacgttacaagctctctagtagcgaaaatttcgac M S I N E I L G K R Y K L S S S E N F D gattttatgaaggcactcggcgtaggtatggtgacgcggaaaatgggtgctacggtcagt D F M K A L G V G M V T R K M G A T V S cccgtcgtcgaattgacggagaaagacggagtgtatactctaaagacgactagtaccttc P V V E L T E K D G V Y T L K T T S T F aaaaacacggaaataaaattcaaacttggcgaagaattcgatgaagacaccgtggacggt K N T E I K F K L G E E F D E D T V D G agaaaagtgaagagtgtctgcactctggaaggtaataaactcatacaggtgcagaaaggt R K V K S V C T L E G N K L I Q V Q K G gataagaatactacgattgaaagggaattcacacctacagagatggaagcgatcatgaaa D K N T T I E R E F T P T E M E A I M K Gttgatgacatagtttgcacaagagtatataagatccaggaataa-3 V D D I V C T R V Y K I Q E - 13

14 Konstruction of pet28 vector 14