Site-directed mutagenesis of proteins

Save this PDF as:
Size: px
Start display at page:

Download "Site-directed mutagenesis of proteins"

Transcription

1 IFM/Kemi Linköpings Universitet August 2013/LGM Labmanual Site-directed mutagenesis of proteins

2 Figur 1: Flow-chart of the site-directed mutagenesis lab exercise 2

3 Site-specific mutagenesis Introduction In vitro site-specific mutagenesis is an invaluable technique for e.g. study the correlation between protein structure and function or modification of vectors for cloning purposes. Over the last decade there has been developed a number of efficient and reliable techniques for creation location-specific mutations in DNA using synthetic oligonucletides. In this course we will use a technique called Quik-Change site-directed mutagenesis, a kit developed and commercialized by Stratagene. The main advantage of this method is that it does not require single stranded DNA (ss-dna), this results in elimation of subcloning steps in M13 based bacteriophages to obtain ss-dna. In addition, this method requires no specialized vectors or unique restriction sites and you can use basically any double stranded DNA plasmid. This method is based on the use of the enzyme Pfu Turbo DNA polymerase II. This is a heat-resistant DNA polymerase that replicates both DNA strands with great accuracy without displacing the mutant oligonucleotide. In this mutagenesis method a double-stranded plasmid with a gene (a gene coding for the protein Fatty acid binding protein, FABP) to be modified is used. Using two synthetic oligonucleotides ( primers ), each complementary to one of the DNA strands of the vector with mismatches corresponding to the desired mutation. The DNA strand are amplified during temperature cycles (PCR) (Figure 2). The extension of the DNA strands gives a nicked DNA after completion of the temperature cycle the sample is treated with the enzyme DpnI endonuclease. This enzyme is specific for methylated and hemi-methylated DNA and used to cleave the original DNA strand and select for the mutant containing newly synthesized DNA. Nearly all the DNA isolated from E. coli is methylated and therefore available for degradation with DpnI. 3

4 Figure 2. Schematic drawing of the Quik-change method. 4

5 Fatty acid binding protein (FABP) Background Fatty acid binding protein (FABP) is a cytosolic protein that transports various fatty acids. To study this protein, FABP was cloned from the Saharan desert ant,cataglyphis fortis and the protein can be expressed in E.coli. This protein consist of 134 amino acids with a His-tag construction of 20 amino acids to facilitate purification of the protein (See appendices for the construction of the clone) A common way of studying protein is the use of spectroscopic methods such as tryptophan fluorescence. One difficulty in the study of FABP from this species is that it lacks tryptophans to be used as spectroscopic probes. With the help of site-specific mutagenesis techniques, we will create variants of FABP that all contain a single tryptophan residue. In order to find suitable positions for the introduced tryptophan residues, a method called threading has been used where the three-dimensional structure from rat FABP (pdb code 1IFB) was used as a template. Figure 3 Aligned modeled structure of FABP from Desert ant (gray) and FABP from rat (green). Illustrated in red are the side chains to be mutated and the corresponding side chains in rat FBP (yellow) 5

6 Site-directed mutagenesis Material: Double stranded plasmid (approx. 10 ng) Mutagenesis primer (forward) Mutagenesis primer (reverse) Control plasmid, pwhitescript (4.5 kb, 10ng/µl) Control primer (forward) Control primer (reverse) 10 X Reaction buffer Pfu Turbo DNA polymerase DpnI Endonuclease dntp mix Sterile water Autoclaved PCR tubes Sample: In a PCR tube add: 1 µl (10ng) Double stranded plasmid (labeled FABP plasmid) 2.5 µl 10x Reaction buffer 1 µl Mutagenesis primer (forward) 1 µl Mutagenesis primer (reverse) 0.5 µl dntp mix 18.5 µl sterile water 0.5 µl Pfu turbo DNA polymerase (2.5 U/µl) Totalt volume: 25 µl Add all component to a PCR tube and finally add Pfu Turbo DNA polymerase. Mix by centrifugation a few seconds. 6

7 Control: (Only 1 control/lab session) In a PCR tube add: 1 µl (10ng) pwhitescript (Control plasmid) 2.5 µl 10x Reaction buffer 0.6 µl Control primer (forward) 0.6 µl Control primer (reverse) 0.5 µl dntp mix 18.5 µl sterile water 0.5 µl Pfu turbo DNA polymerase (2.5 U/µl) Totalt volume: 25 µl Add all component to a PCR tube and finally add Pfu Turbo DNA polymerase. Mix by centrifugation a few seconds. 1) Put the PCR tube(s) in a PCR machine and set following temperature cycle: 95 C (30 seconds), 55 C (1 minute) and 68 C (6 minutes) Repeat 16 times 2) When the PCR cycle is finished, SAVE 5 µl in a new eppendorff tube for later analysis on an agarose gel. 3) To the rest of the mixture add 0.5 µl DpnI endonuclease, mix by centrifugation a few seconds and incubate at 37 C for 1 hour. 4) The samples are now ready for transformation and the remaining of the samples will be stored in -20 C freezer in a new eppendorff tube properly labeled. Further readings: T.A. Brown Gene cloning and DNA analysis (6 th edition) p

8 Transformation of plasmid after site-directed mutagenesis Material: Agarplates with Ampicillin (Amp) or Kanamycin (Kan) resistance NZY+ Broth (or LB medium) IPTG Xgal Sample after site-specific mutagenesis (FABP variant) Control sample after site-specific mutagenesis Transformation control, puc18 Epicurian coli XL-1 blue supercompetent cells Procedure: 1) Thaw the super-competent Epicurian coli XL-1 blue cells portioned in 20 µl 2) To each 20 µl's portion of the super-competent cells are added 5 µl of the sample, or transformation control. 3) Mix gently with pipette tip and incubate on ice for 30 minutes. 4) "Heat shock" the cells by placing the tubes in heating block 45 seconds at 42 C, then place tubes on ice for 2 minutes. 5) Add 100 µl of preheated (42 C) NZY+ Broth culture medium (or LB medium) and incubate the transformation reaction 1 hour at 37 C. 6) Take all of the incubated mixture and spread on agar plate with Kanamycin resistance (FABP samples) or ampicillin resistance (transformation control) 7) The day after the transformation (approximately 16 hours). Count the number of colonies on the agar media. 8) All agar plates are stored in cold room wrapped in a parafilm. NOTE : Control sample plates are treated as follows: 1) Prepare the agar plate by adding 20 µl 10% (w/v) X-gal and 20 µl IPTG in a 100 µl NZY+ Broth culture and spread on the agar plate and let it dry for 30 minutes at 37 C 2) Follow the same procedure as for samples and transformation control. 8

9 Readings: T.A Brown Gene Cloning and DNA analysis, 6 th edition, page

10 Preparation of plasmids Material: 25 ml culture tubes LB medium Kanamycin (stock solution) Qiaprep spin column kit Autoclaved eppendorff tubes and pipette tips Sterile water Preparation of plasmid: For preparation of plasmids a kit from Qiagen (Qiaprep spin kit) will be used. This kit is based on binding of plasmid DNA to a silica gel matrix. The day before plasmid preparation an overnight culture of E.coli with the desired plasmid is prepared. E. coli are grown in culture tubes containing 10 ml culture medium in the presence of kanamycin. The culture are allowed to grow overnight at 37 C with shaking. 1) Every lab group fills two eppendorff tubes (approx.1.5 ml) with overnight culture of the plasmid you want to prepare. 2) Centrifuge in a table top centrifuge rpm for 5 min 3) Withdraw the supernatant with a Pasteur pipette. 4) Resuspend the pellet in a total of 250 µl of buffer P1(125 µl to each epp.tube) Resuspend the cells completely and pool the two tubes together. 5) Add 250 µl of buffer P2. Mix by inverting a few times, the cell suspension should clear up almost immediately. 6) Add 350 µl buffer N3 and mix immediately by inverting the tubes a few times. A precipitate (white clouds ) of denatured chromosomal DNA will be visible 7) Centrifuge at rpm for 10 minutes to pellet down the chromosomal DNA (plasmid DNA will be in the supernatant). 8) Transfer the supernatant into the Qiaprep spin column 9) Centrifuge at rpm for 1 minute 10

11 10) Discard the liquid from the plastic tube and add 750 µl Buffer PE to the column 11) Centrifuge rpm for 1 min and discard the buffer from the plastic tube and centrifuge the column to dryness for 1 minute at pm. 12) Transfer the column to a clean (sterile) eppendorff tube and add 50 µl sterile water to the column. 13) Centrifuge at rpm for 1 min. The Plasmid is now eluted from the column and should be stored in -20 freezer. 11

12 Agarose gelelectrophoresis Materials: Agarose 10 x TBE buffer Ethidium bromide bath (prepared by Lab assistant) DNA molecular weight ladder Plasmids after plasmid preparation Procedure: 1) In a 250 ml bottle is added g agarose and 10ml 10x TBE buffer and diluted with water to total volume of 100ml. 2) Heat the agarose gel in a microwave until it is completely disolved. Let the mixture cool for a while (about 60 o C) and pour the agarose gel in the agarose gel cassettes. Allow the gel to cool for at least 30 minutes. Electrophoretic separation of DNA 1) Mix 4 µl loading buffer with 5 µl DNA and 11 µl H2O. 2) Add 5 µl premixed molecular weight marker 3) Add agarose gel in electrophoresis apparatus and fill with 1X TBE buffer to cover gel. 4) Apply gently and slowly the samples in sample wells with a automatic pipette 5) Separate the DNA fragments by applying a voltage ~ 100 Volts. Remember that DNA is negatively charged. 6) When the blue marker has reached about 2 / 3 down the gel is interrupted electrophoresis and DNA fragments stained with ethidium bromide. Ethidium Bromide intercalate with DNA and can be seen when the gel is illuminated with nm light at a transluminator. Protect your eyes by using safety glasses and wear gloves when working with Ethidium Bromide. 7) Take a picture of the gel and estimate the amount of DNA you have received. Furher readings: T.A Brown Gene Cloning and DNA analysis, 6 th edition, page

13 Appendix DNA sequence of FABP from Desert ant 5 - ATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGC CATATGTCCATCAACGAGATTCTTGGAAAACGTTACAAGCTCTCTAGTAGCGAAAAT TTCGACGATTTTATGAAGGCACTCGGCGTAGGTATGGTGACGCGGAAAATGGGTGCT ACGGTCAGTCCCGTCGTCGAATTGACGGAGAAAGACGGAGTGTATACTCTAAAGACG ACTAGTACCTTCAAAAACACGGAAATAAAATTCAAACTTGGCGAAGAATTCGATGAA GACACCGTGGACGGTAGAAAAGTGAAGAGTGTCTGCACTCTGGAAGGTAATAAACTC ATACAGGTGCAGAAAGGTGATAAGAATACTACGATTGAAAGGGAATTCACACCTACA GAGATGGAAGCGATCATGAAAGTTGATGACATAGTTTGCACAAGAGTATATAAGATC CAGGAATAA-3 DNA and amino acid sequence of FABP from Desert ant 5 -atgggcagcagccatcatcatcatcatcacagcagcggcctggtgccgcgcggcagccat M G S S H H H H H H S S G L V P R G S H atgtccatcaacgagattcttggaaaacgttacaagctctctagtagcgaaaatttcgac M S I N E I L G K R Y K L S S S E N F D gattttatgaaggcactcggcgtaggtatggtgacgcggaaaatgggtgctacggtcagt D F M K A L G V G M V T R K M G A T V S cccgtcgtcgaattgacggagaaagacggagtgtatactctaaagacgactagtaccttc P V V E L T E K D G V Y T L K T T S T F aaaaacacggaaataaaattcaaacttggcgaagaattcgatgaagacaccgtggacggt K N T E I K F K L G E E F D E D T V D G agaaaagtgaagagtgtctgcactctggaaggtaataaactcatacaggtgcagaaaggt R K V K S V C T L E G N K L I Q V Q K G gataagaatactacgattgaaagggaattcacacctacagagatggaagcgatcatgaaa D K N T T I E R E F T P T E M E A I M K Gttgatgacatagtttgcacaagagtatataagatccaggaataa-3 V D D I V C T R V Y K I Q E - 13

14 Konstruction of pet28 vector 14

Linköpings Universitet. Site-directed mutagenesis of proteins

Linköpings Universitet. Site-directed mutagenesis of proteins IFM/Kemi August2011/LGM Linköpings Universitet Site-directed mutagenesis of proteins Competent E. coli cells Site-specific mutagenesis Analysis on agarose gel Transformation of plasmids in E. coli Preparation

More information

Application of Molecular Biology tools for cloning of a foreign gene

Application of Molecular Biology tools for cloning of a foreign gene IFM/Kemi Linköpings Universitet September 2013/LGM Labmanual Project course Application of Molecular Biology tools for cloning of a foreign gene Table of contents Introduction... 3 Amplification of a gene

More information

ITS Sequencing in Millepora. 10/09 Subcloning DNA Fragments into pbluescript Preparation of pbluescript Vector

ITS Sequencing in Millepora. 10/09 Subcloning DNA Fragments into pbluescript Preparation of pbluescript Vector Page 1 of 5 10/09 Subcloning DNA Fragments into pbluescript Preparation of pbluescript Vector 1. Digest 1 µg of pbluescript with Eco RI 2. Following digestion, add 0.1 volumes of 3M sodium acetate (ph

More information

Polymerase Chain Reaction

Polymerase Chain Reaction Polymerase Chain Reaction Amplify your insert or verify its presence 3H Taq platinum PCR mix primers Ultrapure Water PCR tubes PCR machine A. Insert amplification For insert amplification, use the Taq

More information

Molecular Techniques Third-year Biology

Molecular Techniques Third-year Biology PLANNING Genetics Lab practices Molecular Techniques. Genetics Lab practices protocol. 2015-16 PCR-DIRECTED MUTAGENESIS, MOLECULAR CLONING AND RESTRICTION ANALYSIS Sessions 1 & 2 (2x3 hours): PCR-directed

More information

Ready_to_use Fast Seamless Cloning Kit. User Manual

Ready_to_use Fast Seamless Cloning Kit. User Manual For general laboratory use. Not for use in diagnostic procedures. FOR IN VITRO USE ONLY. Ready_to_use Fast Seamless Cloning Kit User Manual 1 / 6 Tel: 021-58975266 Fax: 021-50800270 Email:tech@dogene.com

More information

Figure 1. Map of cloning vector pgem T-Easy (bacterial plasmid DNA)

Figure 1. Map of cloning vector pgem T-Easy (bacterial plasmid DNA) Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 6: Ligation & Bacterial Transformation (Bring your text and laptop to class if you wish to work on your assignment during

More information

Modifications to EXPERIMENTS 21 and 24: PCR and Molecular Cloning

Modifications to EXPERIMENTS 21 and 24: PCR and Molecular Cloning Modifications to EXPERIMENTS 21 and 24: PCR and Molecular Cloning This experiment was designed by Dylan Dodd, based on research completed in Dr. Isaac Cann s lab*, with modifications and editing of content

More information

NZYGene Synthesis kit

NZYGene Synthesis kit Kit components Component Concentration Amount NZYGene Synthesis kit Catalogue number: MB33901, 10 reactions GS DNA Polymerase 1U/ μl 30 μl Reaction Buffer for GS DNA Polymerase 10 150 μl dntp mix 2 mm

More information

Hetero-Stagger PCR Cloning Kit

Hetero-Stagger PCR Cloning Kit Product Name: Code No: Size: DynaExpress Hetero-Stagger PCR Cloning Kit DS150 20 reactions Kit Components: Box 1 (-20 ) phst-1 Vector, linearized Annealing Buffer Ligase Mixture phst Forward Sequence Primer

More information

GeNei TM Transformation Teaching Kit Manual

GeNei TM Transformation Teaching Kit Manual Teaching Kit Manual Cat No. New Cat No. KT07 107385 KT07A 106220 Revision No.: 00060505 CONTENTS Page No. Objective 3 Principle 3 Kit Description 6 Materials Provided 7 Procedure 9 Observation & Interpretation

More information

Biol/Chem 475 Spring 2007

Biol/Chem 475 Spring 2007 Biol/Chem 475 Spring 2007 Goal of lab: For most of the quarter, we will be exploring a gene family that was first discovered in fruitlfies and then found to be present in humans and worms and fish and

More information

PCR Cloning Protocol

PCR Cloning Protocol Modifications to EXPERIMENTS 21 and 24: PCR and Molecular Cloning This experiment was designed by Dylan Dodd, based on research completed in Dr. Isaac Cann s lab*, with modifications and editing of content

More information

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR

More information

Presto Mini Plasmid Kit

Presto Mini Plasmid Kit Instruction Manual Ver. 03.06.17 For Research Use Only Presto Mini Plasmid Kit PDH004 (4 Preparation Sample Kit) PDH100 (100 Preparation Kit) PDH300 (300 Preparation Kit) Advantages Sample: 1-7 ml of cultured

More information

HE Swift Cloning Kit

HE Swift Cloning Kit HE Swift Cloning Kit For high-efficient cloning of PCR products either blunt or sticky-end Kit Contents Contents VTT-BB05 phe Vector (35 ng/µl) 20 µl T4 DNA Ligase (3 U/µl) 20 µl 2 Reaction Buffer 100

More information

Cloning a Fluorescent Gene

Cloning a Fluorescent Gene Cloning a Fluorescent Gene Laboratory Protocols Handout v1.10 Table of Contents Lab 1: Pipettes and Pipetting... 2 Lab 2: Polymerase Chain Reaction... 5 Lab 3: Ligation... 7 Lab 4: Transformation... 9

More information

DNA miniprep by Alkaline Lysis (activity)

DNA miniprep by Alkaline Lysis (activity) DNA miniprep by Alkaline Lysis (activity) Contents 1 Alkaline Lysis 2 Exercise 1: Plasmid DNA Mini-Prep by Alkaline Lysis 3 Identification of Plasmid DNA 4 Exercise 2: Restriction Digestion Identification

More information

TaKaRa MiniBEST Plasmid Purification Kit Ver.4.0

TaKaRa MiniBEST Plasmid Purification Kit Ver.4.0 Cat. # 9760 For Research Use TaKaRa MiniBEST Plasmid Purification Kit Ver.4.0 Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Shipping and Storage... 4 IV. Preparation

More information

Construction of a Mutant pbr322 Using Site-Directed Mutagenesis to Investigate the Exclusion Effects of pbr322 During Co-transformation with puc19

Construction of a Mutant pbr322 Using Site-Directed Mutagenesis to Investigate the Exclusion Effects of pbr322 During Co-transformation with puc19 Construction of a Mutant pbr322 Using Site-Directed Mutagenesis to Investigate the Exclusion Effects of pbr322 During Co-transformation with puc19 IVANA KOMLJENOVIC Department of Microbiology and Immunology,

More information

Bio 121 LAB 11 INSTRUCTIONS - DNA II

Bio 121 LAB 11 INSTRUCTIONS - DNA II Bio 121 LAB 11 INSTRUCTIONS - DNA II In the first part of today's lab we will demonstrate that the DNA which we extracted last week can create heritable changes in the phenotype of bacterial cells. We

More information

InterLab Study: Plasmid amplification

InterLab Study: Plasmid amplification igem TU/e 2015 Biomedical Engineering Eindhoven University of Technology Room: Ceres 0.04 Den Dolech 2, 5612 AZ Eindhoven The Netherlands Tel. no. +31 50 247 55 59 2015.igem.org/Team:TU_Eindhoven InterLab

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Hy-Fy High Fidelity Mix (x2)

Hy-Fy High Fidelity Mix (x2) Hy-Fy High Fidelity Mix (x2) #EZ-2021 1ml, 100rxn of 20μl Contents: 2X High Fidelity Mix 1ml Nuclease-free water 1ml Store at -20 C Shelf life: 2 years Description Hy-Fy High Fidelity Mix (x2) is a premixed,

More information

Data Sheet Quick PCR Cloning Kit

Data Sheet Quick PCR Cloning Kit Data Sheet Quick PCR Cloning Kit 6044 Cornerstone Ct. West, Ste. E DESCRIPTION: The Quick PCR Cloning Kit is a simple and highly efficient method to insert any gene or DNA fragment into a vector, without

More information

Generation of Gene Targeting Vectors using Recombineering - Small scale (single tube) protocol

Generation of Gene Targeting Vectors using Recombineering - Small scale (single tube) protocol Generation of Gene Targeting Vectors using Recombineering - Small scale (single tube) protocol Reagent information All TSA bacterial liquid cultures are grown in: 1xTerrific Broth (TB) supplemented with

More information

Genomic Sequencing. Genomic Sequencing. Maj Gen (R) Suhaib Ahmed, HI (M)

Genomic Sequencing. Genomic Sequencing. Maj Gen (R) Suhaib Ahmed, HI (M) Maj Gen (R) Suhaib Ahmed, HI (M) The process of determining the sequence of an unknown DNA is called sequencing. There are many approaches for DNA sequencing. In the last couple of decades automated Sanger

More information

Hurricane Miniprep Kit PROTOCOL

Hurricane Miniprep Kit PROTOCOL Hurricane Miniprep Kit PROTOCOL Description: The Hurricane Miniprep Kit is designed for purification of up to 25 ug of high purity plasmid DNA from a starting volume of 2-5 ml of bacterial culture. The

More information

Gel/PCR Extraction Kit

Gel/PCR Extraction Kit Gel/PCR Extraction Kit Item No: EX-GP200 (200rxns) Content Content Binding Buffer BD Wash Buffer PE Elution Buffer (10 mm Tris-HCl, ph 8.5) Spin Columns EX-GP200 80 ml 20 mlx3 10 ml 200 each Description

More information

pgm-t Cloning Kit Cat. # : GVT202 Size : 20 Reactions Store at -20

pgm-t Cloning Kit Cat. # : GVT202 Size : 20 Reactions Store at -20 pgm-t Cloning Kit Cat. # : GVT202 Size : 20 Reactions Store at -20 1 Kit Contents Contents pgm-t Cloning Kit pgm-t Vector (50 ng/μl) 20 μl T4 DNA Ligase (3 U/μl) 20 μl 10X T4 DNA Ligation Buffer 30 μl

More information

I-Blue Midi Plasmid Kit. I-Blue Midi Plasmid Kit. (Endotoxin Free) IBI SCIENTIFIC. Instruction Manual Ver For Research Use Only.

I-Blue Midi Plasmid Kit. I-Blue Midi Plasmid Kit. (Endotoxin Free) IBI SCIENTIFIC. Instruction Manual Ver For Research Use Only. Instruction Manual Ver. 05.11.17 For Research Use Only I-Blue Midi Plasmid Kit & I-Blue Midi Plasmid Kit (Endotoxin Free) IB47180, IB47190 (2 Preparation Sample Kit) IB47181, IB47191 (25 Preparation Kit)

More information

Plasmid DNA Isolation Column Kit Instruction Manual Catalog No. SA-40012: 50 reactions SA-40011: 100 reactions

Plasmid DNA Isolation Column Kit Instruction Manual Catalog No. SA-40012: 50 reactions SA-40011: 100 reactions Plasmid DNA Isolation Column Kit Instruction Manual Catalog No. SA-40012: 50 reactions SA-40011: 100 reactions Maxim Biotech, Inc. 780 Dubuque Avenue, So. San Francisco, CA 94080, U.S.A. Tel: (800) 989-6296

More information

XactEdit Cas9 Nuclease with NLS User Manual

XactEdit Cas9 Nuclease with NLS User Manual XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of

More information

SuperiorScript III cdna Synthesis Kit Instruction Manual

SuperiorScript III cdna Synthesis Kit Instruction Manual SuperiorScript III cdna Synthesis Kit Instruction Manual Cat.# EZ405S, EZ405M SuperiorScript III cdna Synthesis Kit Table of Contents I. Description... 3 II. Kit... 4 III. Procedure... 5 IV. Control Experiment

More information

Nucleic acid-free silica-matrix: Regeneration of DNA binding columns

Nucleic acid-free silica-matrix: Regeneration of DNA binding columns MAXXBOND ready-to-use - Kit for the regeneration of DNA binding columns with pure silica matrices Product No. MB007 Nucleic acid-free silica-matrix: Regeneration of DNA binding columns efficient and easy

More information

Puro. Knockout Detection (KOD) Kit

Puro. Knockout Detection (KOD) Kit Puro Knockout Detection (KOD) Kit Cat. No. CC-03 18 Oct. 2016 Contents I. Kit Contents and Storage II. Product Overview III. Methods Experimental Outline Genomic DNA Preparation Obtain Hybrid DNA Digest

More information

GenBuilder TM Plus Cloning Kit User Manual

GenBuilder TM Plus Cloning Kit User Manual GenBuilder TM Plus Cloning Kit User Manual Cat. No. L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2

More information

Designing and creating your gene knockout Background The rada gene was identified as a gene, that when mutated, caused cells to become hypersensitive

Designing and creating your gene knockout Background The rada gene was identified as a gene, that when mutated, caused cells to become hypersensitive Designing and creating your gene knockout Background The rada gene was identified as a gene, that when mutated, caused cells to become hypersensitive to ionizing radiation. However, why these mutants are

More information

GenBuilder TM Plus Cloning Kit User Manual

GenBuilder TM Plus Cloning Kit User Manual GenBuilder TM Plus Cloning Kit User Manual Cat.no L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ.

More information

HiPer Transformation Teaching Kit

HiPer Transformation Teaching Kit HiPer Transformation Teaching Kit Product Code: HTBM017 Number of experiments that can be performed: 10 Duration of Experiment: 4 days Day 1- Preparation of media and revival of E. coli Host Day 2- Inoculation

More information

HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit

HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit Product Code: HTBM031 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 3.5 hours Agarose Gel Electrophoresis:

More information

Guide-it Indel Identification Kit User Manual

Guide-it Indel Identification Kit User Manual Clontech Laboratories, Inc. Guide-it Indel Identification Kit User Manual Cat. No. 631444 (120114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain View, CA 94043, USA

More information

Engineering D66N mutant using quick change site directed mutagenesis. Harkewal Singh 09/01/2010

Engineering D66N mutant using quick change site directed mutagenesis. Harkewal Singh 09/01/2010 Engineering D66N mutant using quick change site directed mutagenesis Harkewal Singh 09/01/2010 1 1- What is quick change site directed mutagenesis? 2- An overview of the kit contents. 3- A brief information

More information

HiPer Plasmid DNA Cloning Teaching Kit

HiPer Plasmid DNA Cloning Teaching Kit HiPer Plasmid DNA Cloning Teaching Kit Product Code: HTBM022 Number of experiments that can be performed: 5 Duration of Experiment: 4 days Day 1- Preparation of media and revival of E. coli Host Day2-

More information

Prepared by the Office of Biotechnology, Iowa State University DRAFT 4/03

Prepared by the Office of Biotechnology, Iowa State University DRAFT 4/03 RECOMBINANT DNA: DUAL ANTIBIOTIC-RESISTANCE GENES Prepared by the Office of Biotechnology, Iowa State University DRAFT 4/03 ** Portions of this protocol were adapted from DNA Science: A First Course in

More information

Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab

Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab With the Gateway cloning system, a PCR fragment is

More information

Purification and Characterization of a DNA Plasmid Part A CHEM 4581: Biochemistry Laboratory I Version: January 18, 2008

Purification and Characterization of a DNA Plasmid Part A CHEM 4581: Biochemistry Laboratory I Version: January 18, 2008 Purification and Characterization of a DNA Plasmid Part A CHEM 4581: Biochemistry Laboratory I Version: January 18, 2008 INTRODUCTION DNA Plasmids. A plasmid is a small double-stranded, circular DNA molecule

More information

Description...1 Components...1 Storage... 1 Technical Information...1 Protocol...2 Examples using the kit...4 Troubleshooting...

Description...1 Components...1 Storage... 1 Technical Information...1 Protocol...2 Examples using the kit...4 Troubleshooting... QuickClean II Gel Extraction Kit Cat. No. L00418 Technical Manual No. TM0594 Version: 03042011 I II III IV V VI VII VIII Description......1 Components.....1 Storage.... 1 Technical Information....1 Protocol.....2

More information

UltraClean 6 Minute Mini Plasmid Prep Kit

UltraClean 6 Minute Mini Plasmid Prep Kit UltraClean 6 Minute Mini Plasmid Prep Kit Catalog No. Quantity 12300-50 50 Preps 12300-100 100 Preps 12300-250 250 Preps Instruction Manual Introduction Use the UltraClean 6 Minute Mini Plasmid Prep Kit

More information

Restriction Analysis of Purified para-r

Restriction Analysis of Purified para-r Restriction Analysis of Purified para-r INTRODUCTION The restriction analysis will provide final proof that the cells transformed during Laboratory 6, cloned overnight in LB/amp and purified in Lab 10

More information

PCR Cloning Protocol. Day 1: Isolation of MG1655 genomic DNA (adapted from Current Protocols in Mol. Biol. (1997), Supplement 27.

PCR Cloning Protocol. Day 1: Isolation of MG1655 genomic DNA (adapted from Current Protocols in Mol. Biol. (1997), Supplement 27. Modifications to EXPERIMENTS 21 and 24: PCR and Molecular Cloning STUDENTS SHOULD USE A P-2 MICROPIPETTOR FOR ALL VOLUMES 2 µl. Day 1: Isolation of MG1655 genomic DNA (adapted from Current Protocols in

More information

Geneaid Maxi Plasmid Kit & Geneaid Maxi Plasmid Kit (Endotoxin Free)

Geneaid Maxi Plasmid Kit & Geneaid Maxi Plasmid Kit (Endotoxin Free) Geneaid Maxi Plasmid Kit & Geneaid Maxi Plasmid Kit (Endotoxin Free) PM002, PME02 (2 Preparation Sample Kit) PM010, PME10 (10 Preparation Kit) PM025, PME25 (25 Preparation Kit) Instruction Manual Ver.

More information

GenBuilder TM Cloning Kit User Manual

GenBuilder TM Cloning Kit User Manual GenBuilder TM Cloning Kit User Manual Cat.no L00701 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ. DNA

More information

CLONING INVERTED REPEATS IN HIGH THROUGHPUT

CLONING INVERTED REPEATS IN HIGH THROUGHPUT CLONING INVERTED REPEATS IN HIGH THROUGHPUT This protocol is calculated for cloning one 96 well plate 1. design primers: as standard we include a EcoRI restriction site on the 5 primer and XbaI on the

More information

BIO/CHEM 475 Molecular Biology Laboratory Spring 2007 Biol/Chem 475 Part 2 of Cloning Lab

BIO/CHEM 475 Molecular Biology Laboratory Spring 2007 Biol/Chem 475 Part 2 of Cloning Lab BIO/CHEM 475 Molecular Biology Laboratory Spring 2007 Biol/Chem 475 Part 2 of Cloning Lab Week 5 Analysis of pgem recombinant clones using PCR Clonecheck to determine size of insert; select clones for

More information

Bring a Molecular Cell Biology Laboratory into the Classroom of HKUST

Bring a Molecular Cell Biology Laboratory into the Classroom of HKUST Bring a Molecular Cell Biology Laboratory into the Classroom of HKUST Prof. Kathy Q. Luo and Prof. Donald C. Chang Dept. of Chemical Engineering, Bioengineering Graduate Program and Dept. of Biology HK

More information

HiPer Real-Time PCR Teaching Kit

HiPer Real-Time PCR Teaching Kit HiPer Real-Time PCR Teaching Kit Product Code: HTBM032 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1.5 hours Storage Instructions: The kit is stable for 12 months from

More information

THE UNIVERSITY OF NEWCASTLE- DISCIPLINE OF MEDICAL BIOCHEMISTRY. STANDARD OPERATING PROCEDURE PROCEDURE NO: GLP 084 MOD: 1st Issue Page: 1 of 11

THE UNIVERSITY OF NEWCASTLE- DISCIPLINE OF MEDICAL BIOCHEMISTRY. STANDARD OPERATING PROCEDURE PROCEDURE NO: GLP 084 MOD: 1st Issue Page: 1 of 11 Page: 1 of 11 1. Risk Assessment: This Risk Assessment is to be used as a general guide and as such, cannot accommodate all the varying factors that may be encountered when using this procedure. Therefore,

More information

KOD -Plus- Mutagenesis Kit

KOD -Plus- Mutagenesis Kit Instruction manual KOD -Plus- Mutagenesis Kit 0811 F0936K KOD -Plus- Mutagenesis Kit SMK-101 20 reactions Store at -20 C Contents [1] Introduction [2] Flow chart [3] Components [4] Notes [5] Protocol 1.

More information

2ml of 1M stock 10x TBE (1 Litre) Tris Base 107.8g 55g (harmful, wear mask) EDTA 7.4g

2ml of 1M stock 10x TBE (1 Litre) Tris Base 107.8g 55g (harmful, wear mask) EDTA 7.4g Phytoplasma Detection Protocol Buffers: Hybridisation buffer 100ml hybridisation buffer 2.92g Sodium chloride 4g Blocking reagent (add slowly while stirring) Mix at room temperature for 2 hours Can be

More information

EXPERIMENT 4 CLONING THE UPSTREAM REGION OF THE GENE OF INTEREST

EXPERIMENT 4 CLONING THE UPSTREAM REGION OF THE GENE OF INTEREST EXPERIMENT 4 CLONING THE UPSTREAM REGION OF THE GENE OF INTEREST Purpose: To determine the activity of the promoter of the gene of interest at the cellular and tissue levels in Arabidopsis plants via the

More information

Generation of Non-typeable Haemophilus influenzae Directed Gene Deletion Mutants Jeroen D. Langereis *

Generation of Non-typeable Haemophilus influenzae Directed Gene Deletion Mutants Jeroen D. Langereis * Generation of Non-typeable Haemophilus influenzae Directed Gene Deletion Mutants Jeroen D. Langereis * Laboratory of Pediatric Infectious Diseases, Department of Pediatrics and Laboratory of Medical Immunology,

More information

MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien

MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien Introduction MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien The field of molecular genetics has resulted in a number of practical applications that have been of tremendous

More information

Creating pentr vectors by BP reaction

Creating pentr vectors by BP reaction Creating pentr vectors by BP reaction Tanya Lepikhova and Rafael Martinez 15072011 Overview: 1. Design primers to add the attb sites to gene of interest 2. Perform PCR with a high fidelity DNA polymerase

More information

Transformation: Theory. Day 2: Transformation Relevant Book Sections

Transformation: Theory. Day 2: Transformation Relevant Book Sections Day 2: Transformation Relevant Book Sections We will follow the protocols provided in various industry-standard kits, instead of the protocols described in these chapters, but the chapters provide good

More information

Amgen Protocol: Introduction and a few comments:

Amgen Protocol: Introduction and a few comments: Amgen Protocol: Introduction and a few comments: The following is a shortened version of the Amgen Lab. This series of labs involves the creation of a recombinant plasmid, subsequent transformation of

More information

Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual

Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual Fusion Cloning technology Cold Fusion Cloning Kit Store the master mixture and positive controls at -20 C Store the competent cells at -80 C. (ver. 120909) A limited-use label license covers this product.

More information

Human DNA Alu Amplification by Polymerase Chain Reaction (PCR)* Laboratory Procedure

Human DNA Alu Amplification by Polymerase Chain Reaction (PCR)* Laboratory Procedure Human DNA Alu Amplification by Polymerase Chain Reaction (PCR)* Laboratory Procedure *Polymerase Chain Reaction is covered by patents owned by Hoffmann-La Roche, Inc. This experiment was adapted from Laboratory

More information

FROM EXPERIMENTS IN BACTERIAL GENETICS AND GENE TECHNIQUE

FROM EXPERIMENTS IN BACTERIAL GENETICS AND GENE TECHNIQUE Uppsala 2001-04-01 REPORT FROM EXPERIMENTS IN BACTERIAL GENETICS AND GENE TECHNIQUE Laboratory assistants: Maria Jönsson Amera Gibreel Students: Contents ASSIGNMENT:... 3 INTRODUCTION:... 3 MATERIAL AND

More information

pgm-t Cloning Kit For direct cloning of PCR products generated by Taq DNA polymerases For research use only Cat. # : GVT202 Size : 20 Reactions

pgm-t Cloning Kit For direct cloning of PCR products generated by Taq DNA polymerases For research use only Cat. # : GVT202 Size : 20 Reactions pgm-t Cloning Kit For direct cloning of PCR products generated by Taq DNA polymerases Cat. # : GVT202 Size : 20 Reactions Store at -20 For research use only 1 pgm-t Cloning Kit Cat. No.: GVT202 Kit Contents

More information

Exploring STEAM with Transformation

Exploring STEAM with Transformation Exploring STEAM with Transformation Thomas Cynkar Edvotek www.edvotek.com Follow @Edvotek EDVOTEK Biotech The Biotechnology Education Company Celebrating 30 years of science education! EDVOTEK Educatio

More information

DNA Visualizer Extraction Kit

DNA Visualizer Extraction Kit DNA Visualizer Extraction Kit Catalog Number D0006 50 reactions Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 General Information...

More information

Presto Soil DNA Extraction Kit

Presto Soil DNA Extraction Kit Instruction Manual Ver. 02.23.17 For Research Use Only Presto Soil DNA Extraction Kit Advantages SLD004 (4 Preparation Sample Kit) SLD050 (50 Preparation Kit) SLD100 (100 Preparation Kit) Sample: 250-500

More information

MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit

MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit Cat. No. MM070150 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA265E MMLV Reverse Transcriptase 1st-Strand cdna Synthesis

More information

Isolation of genomic DNA from buccal swabs - a brief protocol. Assessment of DNA concentration and purity

Isolation of genomic DNA from buccal swabs - a brief protocol. Assessment of DNA concentration and purity Molecular biology 1 DNA Isolation Isolation of genomic DNA from buccal swabs - a brief protocol MACHEREY-NAGEL isolation kit Protocol: 1. Gently rub and rotate swab along the inside of the cheek (both

More information

qpcr Kit, DNA-free Product components 100 rxn 250 rxn Product description

qpcr Kit, DNA-free Product components 100 rxn 250 rxn Product description qpcr Kit, DNA-free For the PCR detection and identification of bacterial and fungal DNA using custom primers Product code A8514 Product components 100 rxn 250 rxn A 2.5x mastermix (3 mm MgCl 2 final concentration)

More information

Large DNA Fragments Extraction Kit

Large DNA Fragments Extraction Kit Instruction Manual Ver. 04.25.17 For Research Use Only Large DNA Fragments Extraction Kit DFL004 (4 Preparation Sample Kit) DFL100 (100 Preparation Kit) DFL300 (300 Preparation Kit) Advantages Efficient:

More information

Product Information (1) General Information

Product Information (1) General Information Table of Contents Product Information 2 (1) General Information 2 (2) Features 3 (3) Kit Contents 3 (4) Storage and Expiration 3 Standard Protocol for Preparation of Competent Cells 4 Instant Protocol

More information

Use of Drosophila Melanogaster as a Model System in the Study of Human Sodium- Dependent Multivitamin Transporter. Michael Brinton BIOL 230W.

Use of Drosophila Melanogaster as a Model System in the Study of Human Sodium- Dependent Multivitamin Transporter. Michael Brinton BIOL 230W. Use of Drosophila Melanogaster as a Model System in the Study of Human Sodium- Dependent Multivitamin Transporter Michael Brinton BIOL 230W.001 28 October 2013 TA: Sashi Gollapudi Introduction Many human

More information

Labs 10 and 11: Bacterial Transformation and DNA Purification

Labs 10 and 11: Bacterial Transformation and DNA Purification Biology 107 General Biology Labs 10 and 11: Bacterial Transformation and DNA Purification Molecular biology often involves altering the genetic makeup of an organism in a directed way. In this lab exercise,

More information

Molecular Methods in Microbial Ecology

Molecular Methods in Microbial Ecology Molecular Methods in Microbial Ecology Kristin Gribble 508-289-7194 kgribble@mbl.edu Lillie 305 Tuesday 10/23/18 Introduction, Extraction of DNA from Winogradsky columns Run DNA products on gel Thursday

More information

Part I: Plasmid Construction

Part I: Plasmid Construction Part I: Plasmid Construction Q5 polymerase was used for PCR amplification of assembly fragments, while Pfu polymerase was used to perform PCR site-directed mutagenesis. Gel extraction or PCR purification

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

User s Guide Catalog number (8 reactions), (16 reactions), and (24 reactions)

User s Guide Catalog number (8 reactions), (16 reactions), and (24 reactions) EZ Mutation Site-Directed DNA Mutagenesis Kit For Small Plasmids User s Guide Catalog number 201304 (8 reactions), 201305 (16 reactions), and 201306 (24 reactions) For Research Use Only Not for Use in

More information

Genomic DNA Clean & Concentrator -25 Catalog Nos. D4064 & D4065

Genomic DNA Clean & Concentrator -25 Catalog Nos. D4064 & D4065 INSTRUCTION MANUAL Genomic DNA Clean & Concentrator -25 Catalog Nos. D4064 & D4065 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC),

More information

GenepHlow Gel Extraction Kit

GenepHlow Gel Extraction Kit Instruction Manual Ver. 02.10.17 For Research Use Only GenepHlow Gel Extraction Kit DFG004 (4 Preparation Sample Kit) DFG100 (100 Preparation Kit) DFG300 (300 Preparation Kit) Advantages Convenient: includes

More information

Labs 10 and 11: Bacterial Transformation and DNA Purification

Labs 10 and 11: Bacterial Transformation and DNA Purification Biology 107 General Biology Labs 10 and 11: Bacterial Transformation and DNA Purification Molecular biology often involves altering the genetic makeup of an organism in a directed way. In this lab exercise,

More information

INDEX INDEX 0 KIT COMPONENTS 1 STORAGE AND STABILITY 1 INTRODUCTION 1 IMPORTANT NOTES 2 EUROGOLD TOTAL RNA ISOLATION PROTOCOL 2 DNA CONTAMINATION 5

INDEX INDEX 0 KIT COMPONENTS 1 STORAGE AND STABILITY 1 INTRODUCTION 1 IMPORTANT NOTES 2 EUROGOLD TOTAL RNA ISOLATION PROTOCOL 2 DNA CONTAMINATION 5 INDEX INDEX 0 KIT COMPONENTS 1 STORAGE AND STABILITY 1 INTRODUCTION 1 IMPORTANT NOTES 2 EUROGOLD TOTAL RNA ISOLATION PROTOCOL 2 DNA CONTAMINATION 5 QUANTITATION AND STORAGE OF RNA 5 RNA QUALITY 5 TROUBLESHOOTING

More information

Session 7 Glycerol Stocks & Sequencing Clones

Session 7 Glycerol Stocks & Sequencing Clones Session 7 Glycerol Stocks & Sequencing Clones Learning Objective: In this lab you will prepare several of your clones for DNA sequencing and make glycerol stock cultures as a stable and uniform starting

More information

Polyskope 1.0 Multiplex Pathogen Detection Assay

Polyskope 1.0 Multiplex Pathogen Detection Assay Polyskope 1.0 Multiplex Pathogen Detection Assay User Guide Test for the real-time simultaneous PCR detection of E.coli O157 STEC, Salmonella spp. and Listeria monocytogenes in food and environmental samples

More information

Transpack Packaging Extract

Transpack Packaging Extract Transpack Packaging Extract For Lambda Transgenic Shuttle Vector Recovery INSTRUCTION MANUAL Catalog #200220 (400 packaging reactions), #200221 (100 packaging reactions), and #200223 (50 packaging reactions)

More information

E. 1 Isolation of smmo genes form M. capsulatus

E. 1 Isolation of smmo genes form M. capsulatus E. 1 Isolation of smmo genes form M. capsulatus Standard Protocols: QuikChange II Site-Directed Mutagenesis Kit In order to isolate all subunit encoding genes of the smmo from M. capsulatus colony PCR

More information

Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 8: DNA Restriction Digest (II) and DNA Sequencing (I)

Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 8: DNA Restriction Digest (II) and DNA Sequencing (I) Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 8: DNA Restriction Digest (II) and DNA Sequencing (I) We have made considerable progress in our analysis of the gene for

More information

Generation of gene knockout vectors for Dictyostelium discoideum

Generation of gene knockout vectors for Dictyostelium discoideum Generation of gene knockout vectors for Dictyostelium discoideum Instruction manual Last date of revision April 2012 2015 Version PR29-0001 PR29-0003 www.stargate.com This manual can be downloaded under

More information

XXII DNA cloning and sequencing. Outline

XXII DNA cloning and sequencing. Outline XXII DNA cloning and sequencing 1) Deriving DNA for cloning Outline 2) Vectors; forming recombinant DNA; cloning DNA; and screening for clones containing recombinant DNA [replica plating and autoradiography;

More information

Mutagenesis PCR I (Multiple Site Directed Mutagenesis)

Mutagenesis PCR I (Multiple Site Directed Mutagenesis) Mutagenesis Mutagenesis PCR I (Multiple Site Directed Mutagenesis) Mixture 25µl total reaction volume : 1. 2.5 µl of 10X Taq lligase buffer (need the NAD for Taq ligase) 2. 0.5 µl 100mM ATP 3. X µl (50-100

More information

Introduction. Kit components. 50 Preps GF-PC-050. Product Catalog No. 200 Preps GF-PC Preps GF-PC Preps SAMPLE

Introduction. Kit components. 50 Preps GF-PC-050. Product Catalog No. 200 Preps GF-PC Preps GF-PC Preps SAMPLE Introduction The GF-1 PCR Clean Up Kit is a system designed for rapid clean up of DNA bands ranging from 100bp to 20kb. The GF-1 PCR Clean Up Kit contains special buffers to provide the correct salt concentration

More information

USDA RiceCAP DNA extraction using DNeasy Plant Mini Kit.

USDA RiceCAP DNA extraction using DNeasy Plant Mini Kit. DNA extraction using DNeasy Plant Mini Kit. Preparatory work: 1. If using the kit for the first time, add ethanol to buffer AW and buffer AP3/E to obtain the working solutions. 2. Preheat a water bath

More information

PCR Polishing Kit INSTRUCTION MANUAL. Catalog # Revision A. For In Vitro Use Only

PCR Polishing Kit INSTRUCTION MANUAL. Catalog # Revision A. For In Vitro Use Only PCR Polishing Kit INSTRUCTION MANUAL Catalog #200409 Revision A For In Vitro Use Only 200409-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this product. No other warranties

More information