cgmp/iso CLIA Experience Unsurpassed Quality

Transcription

1 Cert. No cgmp/iso CLIA Experience Unsurpassed Quality Polyphasic Microbial Identification & DNA Fingerprinting Microbial Contamination Tracking & Trending

2

3 Microbial Identification and DNA Fingerprinting of Microorganisms Recovered as Potential Sterility Test Positives Jaspreet Sidhu, Ph.D. Molecular Epidemiology, Inc

4 Overview Regulatory, Guidance and Economic Issues Microbial Identification in the Pharmaceutical Industry Methodologies and Tools for Microbial Identification Case Studies linking Microbial ID, DNA Fingerprinting to demonstrate specific needs for Polyphasic Approach to Microbial Identification Root Cause Investigation Analysis

5 Microbial ID in the Pharmaceutical Industry The identification of microbes recovered from the pharmaceutical (manufacturing) environment is of critical concern Regulatory requirement Process requirement Implications for product safety and efficacy

6 Concerns regarding Mis-identified identified Microbe Product Recall Economic Loss Regulatory Issues Patient Safety Public Relations

7 Microbial Identification and DNA Fingerprinting: The Regulatory Perspective

8 At minimum the program should require genus (or, where appropriate, species) identification of microorganisms in ancillary environments at frequent intervals to establish a valid, current database of contaminants present in the facility during processing (and to demonstrate that cleaning and sanitization procedures continue to be effective) FDA Guidance for Industry -September 2004 Sterile Drug Products Produced by Aseptic Processing Current Good Manufacturing Practice

9 Recent Ph. Eur. Recommendations While routine microbiological/biochemical identification techniques can demonstrate that 2 isolates are not identical, these methods may not be sufficiently sensitive or reliable enough to provide unequivocal evidence that 2 isolates are from the same source. More sensitive tests, for example molecular typing with RNA/DNA homology, may be necessary to determine that micro-organisms organisms are clonally related and have a common origin Ph Eur Guidelines for using the test for sterility

10 Microbial Identification and DNA Fingerprinting: Pharmaceutical Perspective

11 Pharmaceutical Companies require their own policy on level of identification required

12 Level of Microbial Characterization and ID Gram Stain and cell morphology: EM in ISO 7/8, excipient derived isolatets,, finished product, below alert level EM ID to Genus: EM in ISO 5/6 with number below alert level ID to Species: EM in ISO 5 areas; alert and/or action level isolates from all excipient, finished product, EM and water monitoring Strain Typing: Significant product failures, e.g. media fill, sterility test and microbial limit test. Significant adverse trends in EM and water monitoring

13 Categories of Microbiology ID Test Systems Growth-based Viability-based based Artifact or components based-e.g e.g.. Fatty Acid and MALDI TOF MS Micro ID Nucleic acid Methods

14 Categories of Microbiology ID Systems: Industry Standards API and Vitek 1/2 BioLog MIDI-FAME MicroSeq

15 Comparison of Phenotypic and Genotypic Genotypic DNA sequence based Stable Found in all organisms Independent of environmental factors Independent of protein expression *Footnote-case studies Phenotypic Protein/enzyme based Expression variability Absent in some organisms Environment and growth dependent Lack of functional expression

16 How far has microbial ID evolved. Classification of bacteria based on: Cellular morphology Staining reactions (Gram, spore etc. ) Physiological requirements e.g. oxygen, ph, salt tolerance etc. Biochemical (substrate utilization, metabolic profiles) Bergey s Manual of Determinative Bacteriology Ed. 9 - now an in depth phylogenetic understanding of bacterial taxonomy: Bergey s Manual of Systematic Bacteriology, Ed. 2

17 Microbial Taxonomy: New names for old bacteria What was once a Pseudomonas is now: Ralstonia pickettii Burkholderia cepacia Stenotrophomonas maltophilia Nitromonas Comomonas Genus Bacillus has been re-classified into new Genera Adapted from Dr. Guilfoyle-FDA, PDA/FDA Sep 2005 Database, database, database..

18 Genotypic ID-Benefits Genotypic methods have been shown to be more accurate and precise than traditional biochemical and phenotypic techniques. These methods are especially valuable for investigations into failures (e.g., sterility test; media fill contamination). However, appropriate biochemical and phenotypic methods can be used for routine identification of isolates FDA Guidance for Industry - September 2004 Sterile Drug Products Produced by Aseptic Processing Current Good Manufacturing Practice This reflects general acceptance that changes in Microbial Taxonomy have been made as a result of advances in Phylogenetics and therefore genetic speciation is now considered the Gold Standard

19 Level of Microbial Characterization and ID Gram Stain and cell morphology: EM in ISO 7/8, excipient derived isolatets,, finished product, below alert level EM ID to Genus: EM in ISO 5/6 with number below alert level ID to Species: EM in ISO 5 areas; alert and/or action level isolates from all excipient, finished product, EM and water monitoring Strain Typing: Significant product failures, e.g. media fill, sterility test and microbial limit test. Significant adverse trends in EM and water monitoring

20 To Identify or not and at what level? Identify using purely phenotypic methodology Identify all isolates per genotypic methodology Identify some isolates using both phenotypic and genotypic- polyphasic polyphasic approach Identify all isolates and DNA fingerprint to determine commonality or source of contamination since the guidance recommendation is to do precisely this

21 Genotypic Methods DNA Sequencing-ID (16S/23S/28S highly conserved across organisms but also divergent amongst species) Pulsed Field Gel Electrophoresis of whole chromosomal DNA Southern blotting and Restriction Fragment Length Polymorphism (RFLP) PCR-based locus-specific specific RFLP Random Amplified Polymorphic DNA Rep-PCR Amplified Fragment Length Polymorphism

22 Level of Polyphasic ID Genetic ID alone Genetic ID plus minimal Phenotypic Specialized-Genetic ID plus customized Phenotypic Professional/Expert ID Taxonomic Assignment/Reassignment-extensive extensive research based

23 So we know the ID Now What?

24 Microbial Contaminant Mapping Goal is to link effective Microbial Identification with Microbial Tracking and Trending Complete picture of potential contamination sources by matching genetic fingerprints to process flow throughout production (area, operators, raw materials, supply chain and inventory), packaging and post-market Using a risk based approach to problem solving before problem escalates and production is impacted or worse still, actual finished product is discarded

25 Genetic Subtyping Unique marker(s) to differentiate similar isolates or group the same clones together Biotype or Biogroup: : biochemical or physiological profiles Serology: somatic & flagellar Toxin production: sub groupings Genetic fingerprint : ribotyping,, PFGE, Southern Blot

26 Concepts of Microbial Source Tracking/ Forensic Epidemiology? Tracing or Tracking unique clones to demonstrate linkage: Typing or Subtyping Demonstrate physical linkage to environmental site or source Demonstrate temporal linkage Demonstrate lack of association

27 Addressing Polyphasic Approach Using a Polyphasic approach that combines Phenotypic and Genetic ID (rrna( Gene Sequence) together with DNA Fingerprinting (Genetic Subtyping) Reduce the burden of mis-identification as well as incomplete ID Complete the analysis of finding source of potential contamination

28 Aerobic/Anaerobic Pure Isolate Gram Stain

29 Pure Isolate Phenotypic Testing DNA Sequencing Lysis Basic Biochemical Test Gram Stain Spore Motility Antibiotics PCR PCR sequencing (biochemical taxonomic ID) Electropherogram

30 Salmonella typhimurium (Electropherogram)

31 EM Sample (Mixed Electropherogram)

32 Polyphasic Identification Data analysis Database match ID (assignment) Phenotypic Corroboration ID confirmation

33 The Requirement for Polyphasic Microbial Identification and Strain Characterization of Escherichia coli (E. coli) ATCC 8739

34 Escherichia coli (E. coli) ATCC 8739

35 16S rrna Sequence: Escherichia coli (E. coli) ATCC 8739 GGCTTTTCTGCGGGTACGTCATGAGCAAAGGTATAACTTTACTCCCTTCC TCCCCGCTGAAAGTACTTTACAACCCGAAGGCCTTCTTCATACACGCGGC ATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCACTGCTGCCT CCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGGCTGGTCATCCTC TCAGACCAGCTAGGGATCGTCGCCTAGGTGAGCCGTTACCCCACCTACTA GCTAATCCCATCTGGGCACATCCGATGGCAAGAGGCCCGAAGGTCCCCCT CTTTGGTCTTGCGACGTTATGCGGTATTAGCTACCGTTTCCAGTAGTTAT CCCCCTCCATCAGGCAGTTTCCCAGACATTACTCACCCGTCCGCCACTCG TCAGCAAAGAAGCAAGCTGCTTCCTGTTACCGTTCGACTTGCATGTGTTA GGCCTGCCGCCAGCGTTCAATCTGAGCAGGATCAAAACTCAAA

36 16S based ID is only possible to Family Level

37 Genetic Similarity Comparison of select Enterobacteriaceae

38 Potential brand new organism as member of family MEI 2008

39 Polyphasic ID for MEI ATCC 8739 Source: ATCC DNA sequencing alone is very insufficient- Vitek based supplemental Analysis supports species level ID

40 DNA sequencing alone is very insufficient- Vitek based supplemental Analysis supports species level ID

41

42 DNA sequencing alone is very insufficient

43 B. cereus

44 B. Cereus Plate

45 Polyphasic approach is critical to provide differentiation between very closely related species of B. cereus group

46

47 DNA sequencing alone is very insufficient- supplemental Mycology analysis supports species level ID

48 DNA sequencing alone is very insufficient- supplemental Mycology analysis supports species level ID MEI 2008

49 Limitations of Commercial Databases- Differences between phenotypic and genotypic

50 Why Microbiological expertise is essential

51 This isolate presented as suspect Bordetella sp. via Vitek

52 Why Microbiological expertise is essential

53 Why Microbiological expertise is essential- the following Case study shows that even when a phenotypic and genotypic system match up, microbiological expertise is still necessary to differentiate between closely related species and avoid pathogen misidentification (genotypic alone presents an issue here)

54 DNA sequencing alone is very insufficient- supplemental phenotypic analysis still needed to support species level ID

55 Dendrogram analysis demonstrates the phylogenetic similarity and dissimilarity associated with these closely related organisms

56

57 This isolate presented as suspect Burkholderia pseudomallei via API and Vitek; in fact a Genus Novus

58 So we know the ID Now What?

59 Concepts of Microbial Source Tracking/ Forensic Epidemiology? Tracing or Tracking unique clones to demonstrate linkage: Typing or Subtyping Demonstrate physical linkage to environmental site or source Demonstrate temporal linkage Demonstrate lack of association

60 Optimization of analysis for Gram Pos organism with five distinct restriction endonucleases

61 Level of Microbial Characterization and ID Gram Stain and cell morphology: EM in ISO 7/8, excipient derived isolatets,, finished product, below alert level EM ID to Genus: EM in ISO 5/6 with number below alert level ID to Species: EM in ISO 5 areas; alert and/or action level isolates from all excipient, finished product, EM and water monitoring Strain Typing: Significant product failures, e.g. media fill, sterility test and microbial limit test. Significant adverse trends in EM and water monitoring Remember!! Genotypic methods have been shown to be more accurate and precise e than traditional biochemical and phenotypic techniques. These methods s are especially valuable for investigations into failures (e.g., sterility test; media fill contamination). However, appropriate biochemical and phenotypic methods can be used for routine identification of isolates FDA Guidance for Industry - September 2004 Sterile Drug Products Produced by Aseptic Processing Current Good Manufacturing Practice

62 Just how useful is Genetic Approach

63 Genetically (16S rrna) indistinguishable organisms

64

65 Cultural Diversity-the EM is very unique

66 Failure Invest Failure Investigation-Microaerophilic/anaerobe recovered

67 Sterility Failure Investigation-Microaerophilic/anaerobe recovered: the culprit is closer than you think * *

68 Sterility Failure Investigation-PM isolates

69 Failure Investigation-EM/PM isolates

70 Sterility Failure Investigation-EM/PM is the source * *

71 Sterility Failure Investigation-EM/PM is the source Smoking gun Positive

72 Sterility Failure Investigation-EM/PM Isolate

73 Sterility Failure Investigationcontaminant recovered during testing Smoking gun Positive EM from Manufacturer Smoking gun Positive EM from Manufacturer

74 Hunting for Peripheral Sources

75

76 Bacillus cereus investigation

77 Post-Sanitization A B C D E F G H Bacillus Cereus Bacillus Cereus Bacillus Cereus Bacillus Cereus Bacillus Cereus Bacillus Cereus Bacillus Cereus Bacillus Cereus

78 Level of Microbial Characterization and ID Gram Stain and cell morphology: EM in ISO 7/8, excipient derived isolatets,, finished product, below alert level EM ID to Genus: EM in ISO 5/6 with number below alert level ID to Species: EM in ISO 5 areas; alert and/or action level isolates from all excipient, finished product, EM and water monitoring Strain Typing: Significant product failures, e.g. media fill, sterility test and microbial limit test. Significant adverse trends in EM and water monitoring

79 Genetic ID put this unequivocally as a potential Thermophile - More thorough evaluation demonstrates the anomaly is due to exclusive reliance on monophasic DNA sequence analysis alone

80 EM Isolate Microbial was DOA ID and Report as such yielded False positive MEI# Gram Stain- DNA based ID

81 Genetic ID of typical EM associated Bacillus circulans demonstrates no true thermophilic linkage E

82 Comparison of typical EM strains vs Suspect thermophiles: Source was not sterilization or manufacturing related

83 Level of Microbial Characterization and ID Gram Stain and cell morphology: EM in ISO 7/8, excipient derived isolatets,, finished product, below alert level EM ID to Genus: EM in ISO 5/6 with number below alert level ID to Species: EM in ISO 5 areas; alert and/or action level isolates from all excipient, finished product, EM and water monitoring Strain Typing: Significant product failures, e.g. media fill, sterility test and microbial limit test. Significant adverse trends in EM and water monitoring

84 Conclusions Polyphasic ID: Case for due diligence in ascribing the correct ID. DNA sequencing coupled with a myriad of phenotypic analysis- automation is very useful DNA Fingerprinting: Determining source of potential sterility positive. Allows for root cause analysis of peripheral processes e.g. media prep; sterilization (BIs( BIs), personnel; other materials as well as EM/PM from manufacturing, fill, and finally the actual sterility test

85