ELE4120 Bioinformatics. Tutorial 5

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "ELE4120 Bioinformatics. Tutorial 5"

Transcription

1 ELE4120 Bioinformatics Tutorial 5 1

2 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2

3 Databases A common situation for alignment is to search through a database to retrieve the similar sequences. Common Databases: GenBank at the National Center for Biological Information(NCBI) RefSeq at NCBI TPA at NCBI UniProt 3

4 NCBI ( Established in 1988 as a National resource for molecular biology information, NCBI creates public databases, conducts research in computational biology, develops software tools for analyzing genome data, and disseminates biomedical information - all for the better understanding of molecular processes affecting human health and diseases. 4

5 5

6 ------What is GenBank: 1.1 GenBank ( GenBank is the NIH genetic sequence database, with more than 20 millions sequences for now. 6

7 The complete release notes for the current version of GenBank are available on the NCBI ftp site. A new release is made every two months. GenBank is part of the International Nucleotide Sequence Database Collaboration, which comprises the DNA DataBank of Japan (DDBJ), the European Molecular Biology Laboratory (EMBL), and GenBank at NCBI. These three organizations exchange data on a daily basis Submissions to GenBank The WWW-based submission tool, called BankIt, for convenient and quick submission of sequence data. Sequin, NCBI's stand-alone submission software for 7

8 MAC, PC, and UNIX platforms, is available by FTP. When using Sequin, the output files for direct submission should be sent to GenBank by electronic mail Access to GenBank ( GenBank is available for searching at NCBI via several methods. Text and Similarity Searching Information about Access to GenBank 8

9 9

10 1.2 The Reference Sequence (RefSeq) ( Refseq collection aims to provide a comprehensive, integrated, non-redundant set of sequences, including genomic DNA, transcript (RNA), and protein products. RefSeq is a baseline for medical, functional, and diversity studies; they provide a stable reference for genome annotation, gene identification and characterization, mutation and polymorphism analysis, expression studies, and comparative analyses. 10

11 11

12 12

13 1.3 Third Party Annotation Sequence Database ( TPA: A database designed to capture experimental or inferential results that support submitter-provided annotation for sequence data that the submitter did not directly determine but derived from GenBank primary data. TPA records are divided into two categories: TPA:experimental: Annotation of sequence data is supported by peer-reviewed wet-lab experimental evidence. TPA:inferential: Annotation of sequence data by inference (where the source 13

14 molecule or its product(s) have not been the subject of direct experimentation). 14

15 1.4 UniProt UniProt (Universal Protein Resource) is the world's most comprehensive catalog of information on proteins. It is a central repository of protein sequence and function created by joining the information contained in Swiss-Prot, TrEMBL, and PIR. UniProt has three parts, each optimized for different uses. The UniProt Knowledgebase (UniProtKB) is the central access point for extensive curated protein information, including function, classification, and cross-reference. The UniProt Reference Clusters (UniRef) databases combine closely related sequences into a single record to speed searches. The UniProt Archive (UniParc) is a comprehensive repository, reflecting the history of all protein sequences. 15

16 16

17 17

18 2. Database Searches GenBank database with more than 20 millions sequences at NCBI Compare a new found gene with similar sequences in database might give us an idea about the new found gene 18

19 Searching sequences that align well with our sequence by calculating its alignment with each sequence in database needs long execution time Many database search algorithm are used instead of alignment scores BLAST, FASTA Fast Not guaranteed to be best match, but with high probability that the return sequences are well aligned with our query sequence 19

20 BLAST algorithm Basic Local Alignment Search Tool Original BLAST searches a sequence from the database for maximal ungapped local alignments For protein or nucleotide sequences Many members of the BLAST family E.g. BLASTP, BLASTN, BLASTX 20

21 21

Types of Databases - By Scope

Types of Databases - By Scope Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of

More information

Protein Bioinformatics Part I: Access to information

Protein Bioinformatics Part I: Access to information Protein Bioinformatics Part I: Access to information 260.655 April 6, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Outline [1] Proteins at NCBI RefSeq accession numbers Cn3D to visualize structures

More information

Computational Biology and Bioinformatics

Computational Biology and Bioinformatics Computational Biology and Bioinformatics Computational biology Development of algorithms to solve problems in biology Bioinformatics Application of computational biology to the analysis and management

More information

Sequence Databases and database scanning

Sequence Databases and database scanning Sequence Databases and database scanning Marjolein Thunnissen Lund, 2012 Types of databases: Primary sequence databases (proteins and nucleic acids). Composite protein sequence databases. Secondary databases.

More information

Gene-centered resources at NCBI

Gene-centered resources at NCBI COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving

More information

NCBI web resources I: databases and Entrez

NCBI web resources I: databases and Entrez NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table

More information

Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks

Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional

More information

I nternet Resources for Bioinformatics Data and Tools

I nternet Resources for Bioinformatics Data and Tools ~i;;;;;;;'s :.. ~,;;%.: ;!,;s163 ~. s :s163:: ~s ;'.:'. 3;3 ~,: S;I:;~.3;3'/////, IS~I'//. i: ~s '/, Z I;~;I; :;;; :;I~Z;I~,;'//.;;;;;I'/,;:, :;:;/,;'L;;;~;'~;~,::,:, Z'LZ:..;;',;';4...;,;',~/,~:...;/,;:'.::.

More information

Product Applications for the Sequence Analysis Collection

Product Applications for the Sequence Analysis Collection Product Applications for the Sequence Analysis Collection Pipeline Pilot Contents Introduction... 1 Pipeline Pilot and Bioinformatics... 2 Sequence Searching with Profile HMM...2 Integrating Data in a

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What

More information

Protein Sequence Analysis. BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl)

Protein Sequence Analysis. BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl) Protein Sequence Analysis BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl) Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical

More information

Overview of Health Informatics. ITI BMI-Dept

Overview of Health Informatics. ITI BMI-Dept Overview of Health Informatics ITI BMI-Dept Fellowship Week 5 Overview of Health Informatics ITI, BMI-Dept Day 10 7/5/2010 2 Agenda 1-Bioinformatics Definitions 2-System Biology 3-Bioinformatics vs Computational

More information

Bioinformatics for Proteomics. Ann Loraine

Bioinformatics for Proteomics. Ann Loraine Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data

More information

Basic Bioinformatics: Homology, Sequence Alignment,

Basic Bioinformatics: Homology, Sequence Alignment, Basic Bioinformatics: Homology, Sequence Alignment, and BLAST William S. Sanders Institute for Genomics, Biocomputing, and Biotechnology (IGBB) High Performance Computing Collaboratory (HPC 2 ) Mississippi

More information

Last Update: 12/31/2017. Recommended Background Tutorial: An Introduction to NCBI BLAST

Last Update: 12/31/2017. Recommended Background Tutorial: An Introduction to NCBI BLAST BLAST Exercise: Detecting and Interpreting Genetic Homology Adapted by T. Cordonnier, C. Shaffer, W. Leung and SCR Elgin from Detecting and Interpreting Genetic Homology by Dr. J. Buhler Recommended Background

More information

Sequence Databases. Chapter 2. caister.com/bioinformaticsbooks. Paul Rangel. Sequence Databases

Sequence Databases. Chapter 2. caister.com/bioinformaticsbooks. Paul Rangel. Sequence Databases Chapter 2 Paul Rangel Abstract DNA and Protein sequence databases are the cornerstone of bioinformatics research. DNA databases such as GenBank and EMBL accept genome data from sequencing projects around

More information

Agenda. Web Databases for Drosophila. Gene annotation workflow. GEP Drosophila annotation projects 01/01/2018. Annotation adding labels to a sequence

Agenda. Web Databases for Drosophila. Gene annotation workflow. GEP Drosophila annotation projects 01/01/2018. Annotation adding labels to a sequence Agenda GEP annotation project overview Web Databases for Drosophila An introduction to web tools, databases and NCBI BLAST Web databases for Drosophila annotation UCSC Genome Browser NCBI / BLAST FlyBase

More information

Sequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University

Sequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Usage scenarios for sequence based function annotation Function prediction of newly cloned

More information

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015 Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck

More information

Outline. Evolution. Adaptive convergence. Common similarity problems. Chapter 7: Similarity searches on sequence databases

Outline. Evolution. Adaptive convergence. Common similarity problems. Chapter 7: Similarity searches on sequence databases Chapter 7: Similarity searches on sequence databases All science is either physics or stamp collection. Ernest Rutherford Outline Why is similarity important BLAST Protein and DNA Interpreting BLAST Individualizing

More information

Bioinformatics to chemistry to therapy: Some case studies deriving information from the literature

Bioinformatics to chemistry to therapy: Some case studies deriving information from the literature Bioinformatics to chemistry to therapy: Some case studies deriving information from the literature. Donald Walter August 22, 2007 The Typical Drug Development Paradigm Gary Thomas, Medicinal Chemistry:

More information

COMPUTER RESOURCES II:

COMPUTER RESOURCES II: COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer

More information

Why learn sequence database searching? Searching Molecular Databases with BLAST

Why learn sequence database searching? Searching Molecular Databases with BLAST Why learn sequence database searching? Searching Molecular Databases with BLAST What have I cloned? Is this really!my gene"? Basic Local Alignment Search Tool How BLAST works Interpreting search results

More information

ONLINE BIOINFORMATICS RESOURCES

ONLINE BIOINFORMATICS RESOURCES Dedan Githae Email: d.githae@cgiar.org BecA-ILRI Hub; Nairobi, Kenya 16 May, 2014 ONLINE BIOINFORMATICS RESOURCES Introduction to Molecular Biology and Bioinformatics (IMBB) 2014 The larger picture.. Lower

More information

Files for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz]

Files for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz] BLAST Exercise: Detecting and Interpreting Genetic Homology Adapted by W. Leung and SCR Elgin from Detecting and Interpreting Genetic Homology by Dr. J. Buhler Prequisites: None Resources: The BLAST web

More information

Engineering Genetic Circuits

Engineering Genetic Circuits Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art

More information

B I O I N F O R M A T I C S

B I O I N F O R M A T I C S B I O I N F O R M A T I C S Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be SUPPLEMENTARY CHAPTER: DATA BASES AND MINING 1 What

More information

Bioinformatics, in general, deals with the following important biological data:

Bioinformatics, in general, deals with the following important biological data: Pocket K No. 23 Bioinformatics for Plant Biotechnology Introduction As of July 30, 2006, scientists around the world are pursuing a total of 2,126 genome projects. There are 405 published complete genomes,

More information

Access to Information from Molecular Biology and Genome Research

Access to Information from Molecular Biology and Genome Research Future Needs for Research Infrastructures in Biomedical Sciences Access to Information from Molecular Biology and Genome Research DG Research: Brussels March 2005 User Community for this information is

More information

Korilog. high-performance sequence similarity search tool & integration with KNIME platform. Patrick Durand, PhD, CEO. BIOINFORMATICS Solutions

Korilog. high-performance sequence similarity search tool & integration with KNIME platform. Patrick Durand, PhD, CEO. BIOINFORMATICS Solutions KLAST high-performance sequence similarity search tool & integration with KNIME platform Patrick Durand, PhD, CEO Sequence analysis big challenge DNA sequence... Context 1. Modern sequencers produce huge

More information

An Introduction to Bioinformatics for Biological Sciences Students

An Introduction to Bioinformatics for Biological Sciences Students An Introduction to Bioinformatics for Biological Sciences Students Department of Microbiology and Immunology, McGill University Version 2.5 (For the BIOC-300 lab), March 2006 2 AN INTRODUCTION TO BIOINFORMATICS

More information

Getting to the Roots FOR PHARMA & LIFE SCIENCES WHITEPAPER

Getting to the Roots FOR PHARMA & LIFE SCIENCES WHITEPAPER FOR PHARMA & LIFE SCIENCES WHITEPAPER Getting to the Roots IMPROVING RUBBER TREE CROP PRODUCTION THROUGH MARKER-ASSISTED SELECTION OF TARGETED GENOME TYPES. Improving rubber tree crop production through

More information

The String Alignment Problem. Comparative Sequence Sizes. The String Alignment Problem. The String Alignment Problem.

The String Alignment Problem. Comparative Sequence Sizes. The String Alignment Problem. The String Alignment Problem. Dec-82 Oct-84 Aug-86 Jun-88 Apr-90 Feb-92 Nov-93 Sep-95 Jul-97 May-99 Mar-01 Jan-03 Nov-04 Sep-06 Jul-08 May-10 Mar-12 Growth of GenBank 160,000,000,000 180,000,000 Introduction to Bioinformatics Iosif

More information

Introduction to Bioinformatics for Medical Research. Gideon Greenspan TA: Oleg Rokhlenko. Lecture 1

Introduction to Bioinformatics for Medical Research. Gideon Greenspan TA: Oleg Rokhlenko. Lecture 1 Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il TA: Oleg Rokhlenko Lecture 1 Introduction to Bioinformatics Introduction to Bioinformatics What is Bioinformatics?

More information

Comparative Bioinformatics. BSCI348S Fall 2003 Midterm 1

Comparative Bioinformatics. BSCI348S Fall 2003 Midterm 1 BSCI348S Fall 2003 Midterm 1 Multiple Choice: select the single best answer to the question or completion of the phrase. (5 points each) 1. The field of bioinformatics a. uses biomimetic algorithms to

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics 260.602.01 September 1, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Teaching assistants Hugh Cahill (hugh@jhu.edu) Jennifer Turney (jturney@jhsph.edu) Meg Zupancic

More information

PRESENTING SEQUENCES 5 GAATGCGGCTTAGACTGGTACGATGGAAC 3 3 CTTACGCCGAATCTGACCATGCTACCTTG 5

PRESENTING SEQUENCES 5 GAATGCGGCTTAGACTGGTACGATGGAAC 3 3 CTTACGCCGAATCTGACCATGCTACCTTG 5 Molecular Biology-2017 1 PRESENTING SEQUENCES As you know, sequences may either be double stranded or single stranded and have a polarity described as 5 and 3. The 5 end always contains a free phosphate

More information

Introduction to Sequencher. Tom Randall Center for Bioinformatics

Introduction to Sequencher. Tom Randall Center for Bioinformatics Introduction to Sequencher Tom Randall Center for Bioinformatics tarandal@email.unc.edu Introduction Importing, viewing and manipulating chromatographs Trimming chromatographs Assembly into contigs Editing

More information

GenBank. Dennis A. Benson*, Mark S. Boguski, David J. Lipman, James Ostell and B. F. Francis Ouellette

GenBank. Dennis A. Benson*, Mark S. Boguski, David J. Lipman, James Ostell and B. F. Francis Ouellette 1998 Oxford University Press Nucleic Acids Research, 1998, Vol. 26, No. 1 1 7 GenBank Dennis A. Benson*, Mark S. Boguski, David J. Lipman, James Ostell and B. F. Francis Ouellette National Center for Biotechnology

More information

Big picture and history

Big picture and history Big picture and history (and Computational Biology) CS-5700 / BIO-5323 Outline 1 2 3 4 Outline 1 2 3 4 First to be databased were proteins The development of protein- s (Sanger and Tuppy 1951) led to the

More information

Why Use BLAST? David Form - August 15,

Why Use BLAST? David Form - August 15, Wolbachia Workshop 2017 Bioinformatics BLAST Basic Local Alignment Search Tool Finding Model Organisms for Study of Disease Can yeast be used as a model organism to study cystic fibrosis? BLAST Why Use

More information

FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE

FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE BIOMOLECULES COURSE: COMPUTER PRACTICAL 1 Author of the exercise: Prof. Lloyd Ruddock Edited by Dr. Leila Tajedin 2017-2018 Assistant: Leila Tajedin (leila.tajedin@oulu.fi)

More information

BIOINFORMATICS IN BIOCHEMISTRY

BIOINFORMATICS IN BIOCHEMISTRY BIOINFORMATICS IN BIOCHEMISTRY Bioinformatics a field at the interface of molecular biology, computer science, and mathematics Bioinformatics focuses on the analysis of molecular sequences (DNA, RNA, and

More information

SAMPLE LITERATURE Please refer to included weblink for correct version.

SAMPLE LITERATURE Please refer to included weblink for correct version. Edvo-Kit #340 DNA Informatics Experiment Objective: In this experiment, students will explore the popular bioninformatics tool BLAST. First they will read sequences from autoradiographs of automated gel

More information

Translating Biological Data Sets Into Linked Data

Translating Biological Data Sets Into Linked Data Translating Biological Data Sets Into Linked Data Mark Tomko Simmons College, Boston MA The Broad Institute of MIT and Harvard, Cambridge MA September 28, 2011 Overview Why study biological data? UniProt

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics IMBB 2017 RAB, Kigali - Rwanda May 02 13, 2017 Joyce Nzioki Plan for the Week Introduction to Bioinformatics Raw sanger sequence data Introduction to CLC Bio Quality Control

More information

Entrez Gene: gene-centered information at NCBI

Entrez Gene: gene-centered information at NCBI D54 D58 Nucleic Acids Research, 2005, Vol. 33, Database issue doi:10.1093/nar/gki031 Entrez Gene: gene-centered information at NCBI Donna Maglott*, Jim Ostell, Kim D. Pruitt and Tatiana Tatusova National

More information

Biotechnology Explorer

Biotechnology Explorer Biotechnology Explorer C. elegans Behavior Kit Bioinformatics Supplement explorer.bio-rad.com Catalog #166-5120EDU This kit contains temperature-sensitive reagents. Open immediately and see individual

More information

Introduction to Molecular Biology Databases

Introduction to Molecular Biology Databases Introduction to Molecular Biology Databases Laboratorio de Bioinformática Centro de Astrobiología INTA-CSIC Centro de Astrobiología PRESENT BIOLOGY RESEARCH Data sources Genome sequencing projects: genome

More information

BLAST. compared with database sequences Sequences with many matches to high- scoring words are used for final alignments

BLAST. compared with database sequences Sequences with many matches to high- scoring words are used for final alignments BLAST 100 times faster than dynamic programming. Good for database searches. Derive a list of words of length w from query (e.g., 3 for protein, 11 for DNA) High-scoring words are compared with database

More information

Sequencing the Human Genome

Sequencing the Human Genome The Biotechnology 339 EDVO-Kit # Sequencing the Human Genome Experiment Objective: In this experiment, DNA sequences obtained from automated sequencers will be submitted to Data bank searches using the

More information

Chimp Sequence Annotation: Region 2_3

Chimp Sequence Annotation: Region 2_3 Chimp Sequence Annotation: Region 2_3 Jeff Howenstein March 30, 2007 BIO434W Genomics 1 Introduction We received region 2_3 of the ChimpChunk sequence, and the first step we performed was to run RepeatMasker

More information

NiceProt View of Swiss-Prot: P18907

NiceProt View of Swiss-Prot: P18907 Hosted by NCSC US ExPASy Home page Site Map Search ExPASy Contact us Swiss-Prot Mirror sites: Australia Bolivia Canada China Korea Switzerland Taiwan Search Swiss-Prot/TrEMBL for horse alpha Go Clear NiceProt

More information

From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow

From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with

More information

BIO 152 Principles of Biology III: Molecules & Cells Acquiring information from NCBI (PubMed/Bookshelf/OMIM)

BIO 152 Principles of Biology III: Molecules & Cells Acquiring information from NCBI (PubMed/Bookshelf/OMIM) BIO 152 Principles of Biology III: Molecules & Cells Acquiring information from NCBI (PubMed/Bookshelf/OMIM) Note: This material is adapted from Web-based Bioinformatics Tutorials: Exploring Genomes by

More information

Bioinformatic tools for metagenomic data analysis

Bioinformatic tools for metagenomic data analysis Bioinformatic tools for metagenomic data analysis MEGAN - blast-based tool for exploring taxonomic content MG-RAST (SEED, FIG) - rapid annotation of metagenomic data, phylogenetic classification and metabolic

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

Hands-On Four Investigating Inherited Diseases

Hands-On Four Investigating Inherited Diseases Hands-On Four Investigating Inherited Diseases The purpose of these exercises is to introduce bioinformatics databases and tools. We investigate an important human gene and see how mutations give rise

More information

1. Proteomics database contents Protein sequence databases

1. Proteomics database contents Protein sequence databases 1. Proteomics contents Protein sequence s Salvador Martínez de Bartolomé smartinez@proteored.org Bioinformatics support ProteoRed Proteomics Facility, National Center for Biotechnology, Madrid Menu Introduction

More information

NATIONAL OPEN UNIVERSITY OF NIGERIA SCHOOL OF ARTS AND SOCIAL SCIENCES COURSE CODE: BIO 316 COURSE TITLE: INTRODUCTION TO BIOINFORMATICS

NATIONAL OPEN UNIVERSITY OF NIGERIA SCHOOL OF ARTS AND SOCIAL SCIENCES COURSE CODE: BIO 316 COURSE TITLE: INTRODUCTION TO BIOINFORMATICS NATIONAL OPEN UNIVERSITY OF NIGERIA SCHOOL OF ARTS AND SOCIAL SCIENCES COURSE CODE: BIO 316 COURSE TITLE: INTRODUCTION TO BIOINFORMATICS 1 Course Code : BIO 316 Course Title : Introduction to Bioinformatics

More information

Outline. Annotation of Drosophila Primer. Gene structure nomenclature. Muller element nomenclature. GEP Drosophila annotation projects 01/04/2018

Outline. Annotation of Drosophila Primer. Gene structure nomenclature. Muller element nomenclature. GEP Drosophila annotation projects 01/04/2018 Outline Overview of the GEP annotation projects Annotation of Drosophila Primer January 2018 GEP annotation workflow Practice applying the GEP annotation strategy Wilson Leung and Chris Shaffer AAACAACAATCATAAATAGAGGAAGTTTTCGGAATATACGATAAGTGAAATATCGTTCT

More information

APPENDIX. Appendix. Table of Contents. Ethics Background. Creating Discussion Ground Rules. Amino Acid Abbreviations and Chemistry Resources

APPENDIX. Appendix. Table of Contents. Ethics Background. Creating Discussion Ground Rules. Amino Acid Abbreviations and Chemistry Resources Appendix Table of Contents A2 A3 A4 A5 A6 A7 A9 Ethics Background Creating Discussion Ground Rules Amino Acid Abbreviations and Chemistry Resources Codons and Amino Acid Chemistry Behind the Scenes with

More information

Applied Bioinformatics Exercise Learning to know a new protein and working with sequences

Applied Bioinformatics Exercise Learning to know a new protein and working with sequences Applied Bioinformatics Exercise Learning to know a new protein and working with sequences In this exercise we will explore some databases and tools that can be used to get more insight into a new protein

More information

Classification and Learning Using Genetic Algorithms

Classification and Learning Using Genetic Algorithms Sanghamitra Bandyopadhyay Sankar K. Pal Classification and Learning Using Genetic Algorithms Applications in Bioinformatics and Web Intelligence With 87 Figures and 43 Tables 4y Spri rineer 1 Introduction

More information

Evolutionary Genetics. LV Lecture with exercises 6KP

Evolutionary Genetics. LV Lecture with exercises 6KP Evolutionary Genetics LV 25600-01 Lecture with exercises 6KP HS2017 >What_is_it? AATGATACGGCGACCACCGAGATCTACACNNNTC GTCGGCAGCGTC 2 NCBI MegaBlast search (09/14) 3 NCBI MegaBlast search (09/14) 4 Submitted

More information

Analysis Report. Institution : Macrogen Japan Name : Macrogen Japan Order Number : 1501APB-0004 Sample Name : 8380 Type of Analysis : De novo assembly

Analysis Report. Institution : Macrogen Japan Name : Macrogen Japan Order Number : 1501APB-0004 Sample Name : 8380 Type of Analysis : De novo assembly Analysis Report Institution : Macrogen Japan Name : Macrogen Japan Order Number : 1501APB-0004 Sample Name : 8380 Type of Analysis : De novo assembly 1 Table of Contents 1. Result of Whole Genome Assembly

More information

UCSC Genome Browser. Introduction to ab initio and evidence-based gene finding

UCSC Genome Browser. Introduction to ab initio and evidence-based gene finding UCSC Genome Browser Introduction to ab initio and evidence-based gene finding Wilson Leung 06/2006 Outline Introduction to annotation ab initio gene finding Basics of the UCSC Browser Evidence-based gene

More information

GS Analysis of Microarray Data

GS Analysis of Microarray Data GS01 0163 Analysis of Microarray Data Keith Baggerly and Brad Broom Department of Bioinformatics and Computational Biology UT M. D. Anderson Cancer Center kabagg@mdanderson.org bmbroom@mdanderson.org 7

More information

GS Analysis of Microarray Data

GS Analysis of Microarray Data GS01 0163 Analysis of Microarray Data Keith Baggerly and Kevin Coombes Department of Bioinformatics and Computational Biology UT M. D. Anderson Cancer Center kabagg@mdanderson.org kcoombes@mdanderson.org

More information

Web based Bioinformatics Applications in Proteomics. Genbank

Web based Bioinformatics Applications in Proteomics. Genbank Web based Bioinformatics Applications in Proteomics Chiquito Crasto ccrasto@genetics.uab.edu February 9, 2010 Genbank Primary nucleic acid sequence database Maintained by NCBI National Center for Biotechnology

More information

Integration of data management and analysis for genome research

Integration of data management and analysis for genome research Integration of data management and analysis for genome research Volker Brendel Deparment of Zoology & Genetics and Department of Statistics Iowa State University 2112 Molecular Biology Building Ames, Iowa

More information

Small Genome Annotation and Data Management at TIGR

Small Genome Annotation and Data Management at TIGR Small Genome Annotation and Data Management at TIGR Michelle Gwinn, William Nelson, Robert Dodson, Steven Salzberg, Owen White Abstract TIGR has developed, and continues to refine, a comprehensive, efficient

More information

Sequence Screening. Robert Jones Craic Computing LLC, Seattle, Washington

Sequence Screening. Robert Jones Craic Computing LLC, Seattle, Washington Sequence Screening Robert Jones Craic Computing LLC, Seattle, Washington Cite as: Jones R. 2005. Sequence Screening. In: Working Papers for Synthetic Genomics: Risks and Benefits for Science and Society,

More information

Worksheet for Bioinformatics

Worksheet for Bioinformatics Worksheet for Bioinformatics ACTIVITY: Learn to use biological databases and sequence analysis tools Exercise 1 Biological Databases Objective: To use public biological databases to search for latest research

More information

BIOINFORMATICS Introduction

BIOINFORMATICS Introduction BIOINFORMATICS Introduction Mark Gerstein, Yale University bioinfo.mbb.yale.edu/mbb452a 1 (c) Mark Gerstein, 1999, Yale, bioinfo.mbb.yale.edu What is Bioinformatics? (Molecular) Bio -informatics One idea

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Changhui (Charles) Yan Old Main 401 F http://www.cs.usu.edu www.cs.usu.edu/~cyan 1 How Old Is The Discipline? "The term bioinformatics is a relatively recent invention, not

More information

Bioinformatics. Ingo Ruczinski. Some selected examples... and a bit of an overview

Bioinformatics. Ingo Ruczinski. Some selected examples... and a bit of an overview Bioinformatics Some selected examples... and a bit of an overview Department of Biostatistics Johns Hopkins Bloomberg School of Public Health July 19, 2007 @ EnviroHealth Connections Bioinformatics and

More information

Modern BLAST Programs

Modern BLAST Programs Modern BLAST Programs Jian Ma and Louxin Zhang Abstract The Basic Local Alignment Search Tool (BLAST) is arguably the most widely used program in bioinformatics. By sacrificing sensitivity for speed, it

More information

Concepts of Bioinformatics

Concepts of Bioinformatics 1. Introduction Bioinformatics is the field of science in which biology, computer science, and information technology merge to form a single discipline. It is the emerging field that deals with the application

More information

Study and Analysis of Various Bioinformatics Applications using Protein BLAST: An Overview

Study and Analysis of Various Bioinformatics Applications using Protein BLAST: An Overview Advances in Computational Sciences and Technology ISSN 0973-6107 Volume 10, Number 8 (2017) pp. 2587-2601 Research India Publications http://www.ripublication.com Study and Analysis of Various Bioinformatics

More information

EMBO COURSE. Practical Course on Genetic and Molecular Analysis of Arabidopsis. Module 3. Genome analysis and in silico functional predictions

EMBO COURSE. Practical Course on Genetic and Molecular Analysis of Arabidopsis. Module 3. Genome analysis and in silico functional predictions EMBO COURSE Practical Course on Genetic and Molecular Analysis of Arabidopsis Module 3 Genome analysis and in silico functional predictions Barbet J.C., Chiapello H., Cooke R., Lecharny A., Ollivier E.

More information

Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithm

Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithm Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithm Prateek Kumar 1, Steven Henikoff 2,3 & Pauline C Ng 1,3 1 Department of Genomic Medicine, J. Craig

More information

Host : Dr. Nobuyuki Nukina Tutor : Dr. Fumitaka Oyama

Host : Dr. Nobuyuki Nukina Tutor : Dr. Fumitaka Oyama Method to assign the coding regions of ESTs Céline Becquet Summer Program 2002 Structural Neuropathology Lab Molecular Neuropathology Group RIKEN Brain Science Institute Host : Dr. Nobuyuki Nukina Tutor

More information

Genome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013)

Genome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation AGACAAAGATCCGCTAAATTAAATCTGGACTTCACATATTGAAGTGATATCACACGTTTCTCTAAT AATCTCCTCACAATATTATGTTTGGGATGAACTTGTCGTGATTTGCCATTGTAGCAATCACTTGAA

More information

BIOINFORMATICS AN OVERVIEW

BIOINFORMATICS AN OVERVIEW BIOINFORMATICS AN OVERVIEW T.R. Sharma Genoinformatics Lab, National Research Centre on Plant Biotechnology I.A.R.I, New Delhi 110012 trsharma@nrcpb.org Introduction Bioinformatics is the computational

More information

Advanced Bioinformatics Biostatistics & Medical Informatics 776 Computer Sciences 776 Spring 2018

Advanced Bioinformatics Biostatistics & Medical Informatics 776 Computer Sciences 776 Spring 2018 Advanced Bioinformatics Biostatistics & Medical Informatics 776 Computer Sciences 776 Spring 2018 Anthony Gitter gitter@biostat.wisc.edu www.biostat.wisc.edu/bmi776/ These slides, excluding third-party

More information

user s guide Question 3

user s guide Question 3 Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.

More information

DNA is normally found in pairs, held together by hydrogen bonds between the bases

DNA is normally found in pairs, held together by hydrogen bonds between the bases Bioinformatics Biology Review The genetic code is stored in DNA Deoxyribonucleic acid. DNA molecules are chains of four nucleotide bases Guanine, Thymine, Cytosine, Adenine DNA is normally found in pairs,

More information

Function Prediction of Proteins from their Sequences with BAR 3.0

Function Prediction of Proteins from their Sequences with BAR 3.0 Open Access Annals of Proteomics and Bioinformatics Short Communication Function Prediction of Proteins from their Sequences with BAR 3.0 Giuseppe Profiti 1,2, Pier Luigi Martelli 2 and Rita Casadio 2

More information

Discover the Microbes Within: The Wolbachia Project. Bioinformatics Lab

Discover the Microbes Within: The Wolbachia Project. Bioinformatics Lab Bioinformatics Lab ACTIVITY AT A GLANCE "Understanding nature's mute but elegant language of living cells is the quest of modern molecular biology. From an alphabet of only four letters representing the

More information

Fundamentals of Bioinformatics: computation, biology, computational biology

Fundamentals of Bioinformatics: computation, biology, computational biology Fundamentals of Bioinformatics: computation, biology, computational biology Vasilis J. Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus A short self-introduction

More information

A Survey On Biological Databases And Applications Of Datamining

A Survey On Biological Databases And Applications Of Datamining Australian Journal of Basic and Applied Sciences, 6(13): 175-180, 2012 ISSN 1991-8178 A Survey On Biological Databases And Applications Of Datamining 1 N Saravanan, 2 T Devi 1 PhD Research Scholar Department

More information

Applied Bioinformatics

Applied Bioinformatics Applied Bioinformatics Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Course overview What is bioinformatics Data driven science: the creation and advancement

More information

AP BIOLOGY. Investigation #3 Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST. Slide 1 / 32. Slide 2 / 32.

AP BIOLOGY. Investigation #3 Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST. Slide 1 / 32. Slide 2 / 32. New Jersey Center for Teaching and Learning Slide 1 / 32 Progressive Science Initiative This material is made freely available at www.njctl.org and is intended for the non-commercial use of students and

More information

BLAST. Subject: The result from another organism that your query was matched to.

BLAST. Subject: The result from another organism that your query was matched to. BLAST (Basic Local Alignment Search Tool) Note: This is a complete transcript to the powerpoint. It is good to read through this once to understand everything. If you ever need help and just need a quick

More information

GenBank. Direct submissions individual records (BankIt( BankIt,, Sequin) Batch submissions via (EST, GSS, STS) ftp accounts sequencing centers

GenBank. Direct submissions individual records (BankIt( BankIt,, Sequin) Batch submissions via  (EST, GSS, STS) ftp accounts sequencing centers What is GenBank? NCBI s Primary Sequence Database Nucleotide sequence database Archival in nature GenBank Data Direct submissions individual records (BankIt( BankIt,, Sequin) Batch submissions via email

More information

Gene Identification in silico

Gene Identification in silico Gene Identification in silico Nita Parekh, IIIT Hyderabad Presented at National Seminar on Bioinformatics and Functional Genomics, at Bioinformatics centre, Pondicherry University, Feb 15 17, 2006. Introduction

More information

Exploring the Genetic Basis for Behavior. Instructor s Notes

Exploring the Genetic Basis for Behavior. Instructor s Notes Exploring the Genetic Basis for Behavior Instructor s Notes Introduction This lab was designed for our 300-level Advanced Genetics course taken by juniors and seniors majoring in Biology or Biochemistry.

More information

Advances in analytical biochemistry and systems biology: Proteomics

Advances in analytical biochemistry and systems biology: Proteomics Advances in analytical biochemistry and systems biology: Proteomics Brett Boghigian Department of Chemical & Biological Engineering Tufts University July 29, 2005 Proteomics The basics History Current

More information

New Programs in Quantitative Biology: Hunter College.

New Programs in Quantitative Biology: Hunter College. New Programs in Quantitative Biology: QuBi @ Hunter College What is QuBi? Quantitative Biology An initiative to join computational and quantitative disciplines to the analysis of biological data. Bioinformatics,

More information