ELE4120 Bioinformatics. Tutorial 5

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "ELE4120 Bioinformatics. Tutorial 5"

Transcription

1 ELE4120 Bioinformatics Tutorial 5 1

2 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2

3 Databases A common situation for alignment is to search through a database to retrieve the similar sequences. Common Databases: GenBank at the National Center for Biological Information(NCBI) RefSeq at NCBI TPA at NCBI UniProt 3

4 NCBI (http://www.ncbi.nlm.nih.gov/about/) Established in 1988 as a National resource for molecular biology information, NCBI creates public databases, conducts research in computational biology, develops software tools for analyzing genome data, and disseminates biomedical information - all for the better understanding of molecular processes affecting human health and diseases. 4

5 5

6 ------What is GenBank: 1.1 GenBank (http://www.ncbi.nlm.nih.gov/genbank/) GenBank is the NIH genetic sequence database, with more than 20 millions sequences for now. 6

7 The complete release notes for the current version of GenBank are available on the NCBI ftp site. A new release is made every two months. GenBank is part of the International Nucleotide Sequence Database Collaboration, which comprises the DNA DataBank of Japan (DDBJ), the European Molecular Biology Laboratory (EMBL), and GenBank at NCBI. These three organizations exchange data on a daily basis Submissions to GenBank The WWW-based submission tool, called BankIt, for convenient and quick submission of sequence data. Sequin, NCBI's stand-alone submission software for 7

8 MAC, PC, and UNIX platforms, is available by FTP. When using Sequin, the output files for direct submission should be sent to GenBank by electronic mail Access to GenBank (http://www.ncbi.nlm.nih.gov/genbank/genbanksearch.html): GenBank is available for searching at NCBI via several methods. Text and Similarity Searching Information about Access to GenBank 8

9 9

10 1.2 The Reference Sequence (RefSeq) (http://www.ncbi.nlm.nih.gov/refseq/) Refseq collection aims to provide a comprehensive, integrated, non-redundant set of sequences, including genomic DNA, transcript (RNA), and protein products. RefSeq is a baseline for medical, functional, and diversity studies; they provide a stable reference for genome annotation, gene identification and characterization, mutation and polymorphism analysis, expression studies, and comparative analyses. 10

11 11

12 12

13 1.3 Third Party Annotation Sequence Database (http://www.ncbi.nlm.nih.gov/genbank/tpa.html) TPA: A database designed to capture experimental or inferential results that support submitter-provided annotation for sequence data that the submitter did not directly determine but derived from GenBank primary data. TPA records are divided into two categories: TPA:experimental: Annotation of sequence data is supported by peer-reviewed wet-lab experimental evidence. TPA:inferential: Annotation of sequence data by inference (where the source 13

14 molecule or its product(s) have not been the subject of direct experimentation). 14

15 1.4 UniProt UniProt (Universal Protein Resource) is the world's most comprehensive catalog of information on proteins. It is a central repository of protein sequence and function created by joining the information contained in Swiss-Prot, TrEMBL, and PIR. UniProt has three parts, each optimized for different uses. The UniProt Knowledgebase (UniProtKB) is the central access point for extensive curated protein information, including function, classification, and cross-reference. The UniProt Reference Clusters (UniRef) databases combine closely related sequences into a single record to speed searches. The UniProt Archive (UniParc) is a comprehensive repository, reflecting the history of all protein sequences. 15

16 16

17 17

18 2. Database Searches GenBank database with more than 20 millions sequences at NCBI Compare a new found gene with similar sequences in database might give us an idea about the new found gene 18

19 Searching sequences that align well with our sequence by calculating its alignment with each sequence in database needs long execution time Many database search algorithm are used instead of alignment scores BLAST, FASTA Fast Not guaranteed to be best match, but with high probability that the return sequences are well aligned with our query sequence 19

20 BLAST algorithm Basic Local Alignment Search Tool Original BLAST searches a sequence from the database for maximal ungapped local alignments For protein or nucleotide sequences Many members of the BLAST family E.g. BLASTP, BLASTN, BLASTX 20

21 21

Types of Databases - By Scope

Types of Databases - By Scope Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of

More information

Protein Bioinformatics Part I: Access to information

Protein Bioinformatics Part I: Access to information Protein Bioinformatics Part I: Access to information 260.655 April 6, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Outline [1] Proteins at NCBI RefSeq accession numbers Cn3D to visualize structures

More information

Sequence Databases and database scanning

Sequence Databases and database scanning Sequence Databases and database scanning Marjolein Thunnissen Lund, 2012 Types of databases: Primary sequence databases (proteins and nucleic acids). Composite protein sequence databases. Secondary databases.

More information

Gene-centered resources at NCBI

Gene-centered resources at NCBI COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving

More information

NCBI web resources I: databases and Entrez

NCBI web resources I: databases and Entrez NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table

More information

Product Applications for the Sequence Analysis Collection

Product Applications for the Sequence Analysis Collection Product Applications for the Sequence Analysis Collection Pipeline Pilot Contents Introduction... 1 Pipeline Pilot and Bioinformatics... 2 Sequence Searching with Profile HMM...2 Integrating Data in a

More information

I nternet Resources for Bioinformatics Data and Tools

I nternet Resources for Bioinformatics Data and Tools ~i;;;;;;;'s :.. ~,;;%.: ;!,;s163 ~. s :s163:: ~s ;'.:'. 3;3 ~,: S;I:;~.3;3'/////, IS~I'//. i: ~s '/, Z I;~;I; :;;; :;I~Z;I~,;'//.;;;;;I'/,;:, :;:;/,;'L;;;~;'~;~,::,:, Z'LZ:..;;',;';4...;,;',~/,~:...;/,;:'.::.

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What

More information

Bioinformatics for Proteomics. Ann Loraine

Bioinformatics for Proteomics. Ann Loraine Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data

More information

Overview of Health Informatics. ITI BMI-Dept

Overview of Health Informatics. ITI BMI-Dept Overview of Health Informatics ITI BMI-Dept Fellowship Week 5 Overview of Health Informatics ITI, BMI-Dept Day 10 7/5/2010 2 Agenda 1-Bioinformatics Definitions 2-System Biology 3-Bioinformatics vs Computational

More information

Basic Bioinformatics: Homology, Sequence Alignment,

Basic Bioinformatics: Homology, Sequence Alignment, Basic Bioinformatics: Homology, Sequence Alignment, and BLAST William S. Sanders Institute for Genomics, Biocomputing, and Biotechnology (IGBB) High Performance Computing Collaboratory (HPC 2 ) Mississippi

More information

Sequence Databases. Chapter 2. caister.com/bioinformaticsbooks. Paul Rangel. Sequence Databases

Sequence Databases. Chapter 2. caister.com/bioinformaticsbooks. Paul Rangel. Sequence Databases Chapter 2 Paul Rangel Abstract DNA and Protein sequence databases are the cornerstone of bioinformatics research. DNA databases such as GenBank and EMBL accept genome data from sequencing projects around

More information

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015 Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck

More information

Sequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University

Sequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Usage scenarios for sequence based function annotation Function prediction of newly cloned

More information

Why learn sequence database searching? Searching Molecular Databases with BLAST

Why learn sequence database searching? Searching Molecular Databases with BLAST Why learn sequence database searching? Searching Molecular Databases with BLAST What have I cloned? Is this really!my gene"? Basic Local Alignment Search Tool How BLAST works Interpreting search results

More information

Files for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz]

Files for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz] BLAST Exercise: Detecting and Interpreting Genetic Homology Adapted by W. Leung and SCR Elgin from Detecting and Interpreting Genetic Homology by Dr. J. Buhler Prequisites: None Resources: The BLAST web

More information

Bioinformatics to chemistry to therapy: Some case studies deriving information from the literature

Bioinformatics to chemistry to therapy: Some case studies deriving information from the literature Bioinformatics to chemistry to therapy: Some case studies deriving information from the literature. Donald Walter August 22, 2007 The Typical Drug Development Paradigm Gary Thomas, Medicinal Chemistry:

More information

ONLINE BIOINFORMATICS RESOURCES

ONLINE BIOINFORMATICS RESOURCES Dedan Githae Email: d.githae@cgiar.org BecA-ILRI Hub; Nairobi, Kenya 16 May, 2014 ONLINE BIOINFORMATICS RESOURCES Introduction to Molecular Biology and Bioinformatics (IMBB) 2014 The larger picture.. Lower

More information

B I O I N F O R M A T I C S

B I O I N F O R M A T I C S B I O I N F O R M A T I C S Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be SUPPLEMENTARY CHAPTER: DATA BASES AND MINING 1 What

More information

Engineering Genetic Circuits

Engineering Genetic Circuits Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art

More information

Access to Information from Molecular Biology and Genome Research

Access to Information from Molecular Biology and Genome Research Future Needs for Research Infrastructures in Biomedical Sciences Access to Information from Molecular Biology and Genome Research DG Research: Brussels March 2005 User Community for this information is

More information

Bioinformatics, in general, deals with the following important biological data:

Bioinformatics, in general, deals with the following important biological data: Pocket K No. 23 Bioinformatics for Plant Biotechnology Introduction As of July 30, 2006, scientists around the world are pursuing a total of 2,126 genome projects. There are 405 published complete genomes,

More information

Korilog. high-performance sequence similarity search tool & integration with KNIME platform. Patrick Durand, PhD, CEO. BIOINFORMATICS Solutions

Korilog. high-performance sequence similarity search tool & integration with KNIME platform. Patrick Durand, PhD, CEO. BIOINFORMATICS Solutions KLAST high-performance sequence similarity search tool & integration with KNIME platform Patrick Durand, PhD, CEO Sequence analysis big challenge DNA sequence... Context 1. Modern sequencers produce huge

More information

The String Alignment Problem. Comparative Sequence Sizes. The String Alignment Problem. The String Alignment Problem.

The String Alignment Problem. Comparative Sequence Sizes. The String Alignment Problem. The String Alignment Problem. Dec-82 Oct-84 Aug-86 Jun-88 Apr-90 Feb-92 Nov-93 Sep-95 Jul-97 May-99 Mar-01 Jan-03 Nov-04 Sep-06 Jul-08 May-10 Mar-12 Growth of GenBank 160,000,000,000 180,000,000 Introduction to Bioinformatics Iosif

More information

GenBank. Dennis A. Benson*, Mark S. Boguski, David J. Lipman, James Ostell and B. F. Francis Ouellette

GenBank. Dennis A. Benson*, Mark S. Boguski, David J. Lipman, James Ostell and B. F. Francis Ouellette 1998 Oxford University Press Nucleic Acids Research, 1998, Vol. 26, No. 1 1 7 GenBank Dennis A. Benson*, Mark S. Boguski, David J. Lipman, James Ostell and B. F. Francis Ouellette National Center for Biotechnology

More information

FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE

FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE BIOMOLECULES COURSE: COMPUTER PRACTICAL 1 Author of the exercise: Prof. Lloyd Ruddock Edited by Dr. Leila Tajedin 2017-2018 Assistant: Leila Tajedin (leila.tajedin@oulu.fi)

More information

Comparative Bioinformatics. BSCI348S Fall 2003 Midterm 1

Comparative Bioinformatics. BSCI348S Fall 2003 Midterm 1 BSCI348S Fall 2003 Midterm 1 Multiple Choice: select the single best answer to the question or completion of the phrase. (5 points each) 1. The field of bioinformatics a. uses biomimetic algorithms to

More information

SAMPLE LITERATURE Please refer to included weblink for correct version.

SAMPLE LITERATURE Please refer to included weblink for correct version. Edvo-Kit #340 DNA Informatics Experiment Objective: In this experiment, students will explore the popular bioninformatics tool BLAST. First they will read sequences from autoradiographs of automated gel

More information

BLAST. compared with database sequences Sequences with many matches to high- scoring words are used for final alignments

BLAST. compared with database sequences Sequences with many matches to high- scoring words are used for final alignments BLAST 100 times faster than dynamic programming. Good for database searches. Derive a list of words of length w from query (e.g., 3 for protein, 11 for DNA) High-scoring words are compared with database

More information

Bioinformatic tools for metagenomic data analysis

Bioinformatic tools for metagenomic data analysis Bioinformatic tools for metagenomic data analysis MEGAN - blast-based tool for exploring taxonomic content MG-RAST (SEED, FIG) - rapid annotation of metagenomic data, phylogenetic classification and metabolic

More information

Entrez Gene: gene-centered information at NCBI

Entrez Gene: gene-centered information at NCBI D54 D58 Nucleic Acids Research, 2005, Vol. 33, Database issue doi:10.1093/nar/gki031 Entrez Gene: gene-centered information at NCBI Donna Maglott*, Jim Ostell, Kim D. Pruitt and Tatiana Tatusova National

More information

Hands-On Four Investigating Inherited Diseases

Hands-On Four Investigating Inherited Diseases Hands-On Four Investigating Inherited Diseases The purpose of these exercises is to introduce bioinformatics databases and tools. We investigate an important human gene and see how mutations give rise

More information

Biotechnology Explorer

Biotechnology Explorer Biotechnology Explorer C. elegans Behavior Kit Bioinformatics Supplement explorer.bio-rad.com Catalog #166-5120EDU This kit contains temperature-sensitive reagents. Open immediately and see individual

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics IMBB 2017 RAB, Kigali - Rwanda May 02 13, 2017 Joyce Nzioki Plan for the Week Introduction to Bioinformatics Raw sanger sequence data Introduction to CLC Bio Quality Control

More information

Sequencing the Human Genome

Sequencing the Human Genome The Biotechnology 339 EDVO-Kit # Sequencing the Human Genome Experiment Objective: In this experiment, DNA sequences obtained from automated sequencers will be submitted to Data bank searches using the

More information

Chimp Sequence Annotation: Region 2_3

Chimp Sequence Annotation: Region 2_3 Chimp Sequence Annotation: Region 2_3 Jeff Howenstein March 30, 2007 BIO434W Genomics 1 Introduction We received region 2_3 of the ChimpChunk sequence, and the first step we performed was to run RepeatMasker

More information

Analysis Report. Institution : Macrogen Japan Name : Macrogen Japan Order Number : 1501APB-0004 Sample Name : 8380 Type of Analysis : De novo assembly

Analysis Report. Institution : Macrogen Japan Name : Macrogen Japan Order Number : 1501APB-0004 Sample Name : 8380 Type of Analysis : De novo assembly Analysis Report Institution : Macrogen Japan Name : Macrogen Japan Order Number : 1501APB-0004 Sample Name : 8380 Type of Analysis : De novo assembly 1 Table of Contents 1. Result of Whole Genome Assembly

More information

1. Proteomics database contents Protein sequence databases

1. Proteomics database contents Protein sequence databases 1. Proteomics contents Protein sequence s Salvador Martínez de Bartolomé smartinez@proteored.org Bioinformatics support ProteoRed Proteomics Facility, National Center for Biotechnology, Madrid Menu Introduction

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

NATIONAL OPEN UNIVERSITY OF NIGERIA SCHOOL OF ARTS AND SOCIAL SCIENCES COURSE CODE: BIO 316 COURSE TITLE: INTRODUCTION TO BIOINFORMATICS

NATIONAL OPEN UNIVERSITY OF NIGERIA SCHOOL OF ARTS AND SOCIAL SCIENCES COURSE CODE: BIO 316 COURSE TITLE: INTRODUCTION TO BIOINFORMATICS NATIONAL OPEN UNIVERSITY OF NIGERIA SCHOOL OF ARTS AND SOCIAL SCIENCES COURSE CODE: BIO 316 COURSE TITLE: INTRODUCTION TO BIOINFORMATICS 1 Course Code : BIO 316 Course Title : Introduction to Bioinformatics

More information

Introduction to Molecular Biology Databases

Introduction to Molecular Biology Databases Introduction to Molecular Biology Databases Laboratorio de Bioinformática Centro de Astrobiología INTA-CSIC Centro de Astrobiología PRESENT BIOLOGY RESEARCH Data sources Genome sequencing projects: genome

More information

Outline. Annotation of Drosophila Primer. Gene structure nomenclature. Muller element nomenclature. GEP Drosophila annotation projects 01/04/2018

Outline. Annotation of Drosophila Primer. Gene structure nomenclature. Muller element nomenclature. GEP Drosophila annotation projects 01/04/2018 Outline Overview of the GEP annotation projects Annotation of Drosophila Primer January 2018 GEP annotation workflow Practice applying the GEP annotation strategy Wilson Leung and Chris Shaffer AAACAACAATCATAAATAGAGGAAGTTTTCGGAATATACGATAAGTGAAATATCGTTCT

More information

Applied Bioinformatics Exercise Learning to know a new protein and working with sequences

Applied Bioinformatics Exercise Learning to know a new protein and working with sequences Applied Bioinformatics Exercise Learning to know a new protein and working with sequences In this exercise we will explore some databases and tools that can be used to get more insight into a new protein

More information

Classification and Learning Using Genetic Algorithms

Classification and Learning Using Genetic Algorithms Sanghamitra Bandyopadhyay Sankar K. Pal Classification and Learning Using Genetic Algorithms Applications in Bioinformatics and Web Intelligence With 87 Figures and 43 Tables 4y Spri rineer 1 Introduction

More information

UCSC Genome Browser. Introduction to ab initio and evidence-based gene finding

UCSC Genome Browser. Introduction to ab initio and evidence-based gene finding UCSC Genome Browser Introduction to ab initio and evidence-based gene finding Wilson Leung 06/2006 Outline Introduction to annotation ab initio gene finding Basics of the UCSC Browser Evidence-based gene

More information

Exploring the Genetic Basis for Behavior. Instructor s Notes

Exploring the Genetic Basis for Behavior. Instructor s Notes Exploring the Genetic Basis for Behavior Instructor s Notes Introduction This lab was designed for our 300-level Advanced Genetics course taken by juniors and seniors majoring in Biology or Biochemistry.

More information

Sequence Screening. Robert Jones Craic Computing LLC, Seattle, Washington

Sequence Screening. Robert Jones Craic Computing LLC, Seattle, Washington Sequence Screening Robert Jones Craic Computing LLC, Seattle, Washington Cite as: Jones R. 2005. Sequence Screening. In: Working Papers for Synthetic Genomics: Risks and Benefits for Science and Society,

More information

Integration of data management and analysis for genome research

Integration of data management and analysis for genome research Integration of data management and analysis for genome research Volker Brendel Deparment of Zoology & Genetics and Department of Statistics Iowa State University 2112 Molecular Biology Building Ames, Iowa

More information

Worksheet for Bioinformatics

Worksheet for Bioinformatics Worksheet for Bioinformatics ACTIVITY: Learn to use biological databases and sequence analysis tools Exercise 1 Biological Databases Objective: To use public biological databases to search for latest research

More information

Modern BLAST Programs

Modern BLAST Programs Modern BLAST Programs Jian Ma and Louxin Zhang Abstract The Basic Local Alignment Search Tool (BLAST) is arguably the most widely used program in bioinformatics. By sacrificing sensitivity for speed, it

More information

BIOINFORMATICS Introduction

BIOINFORMATICS Introduction BIOINFORMATICS Introduction Mark Gerstein, Yale University bioinfo.mbb.yale.edu/mbb452a 1 (c) Mark Gerstein, 1999, Yale, bioinfo.mbb.yale.edu What is Bioinformatics? (Molecular) Bio -informatics One idea

More information

AP BIOLOGY. Investigation #3 Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST. Slide 1 / 32. Slide 2 / 32.

AP BIOLOGY. Investigation #3 Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST. Slide 1 / 32. Slide 2 / 32. New Jersey Center for Teaching and Learning Slide 1 / 32 Progressive Science Initiative This material is made freely available at www.njctl.org and is intended for the non-commercial use of students and

More information

Bioinformatics. Ingo Ruczinski. Some selected examples... and a bit of an overview

Bioinformatics. Ingo Ruczinski. Some selected examples... and a bit of an overview Bioinformatics Some selected examples... and a bit of an overview Department of Biostatistics Johns Hopkins Bloomberg School of Public Health July 19, 2007 @ EnviroHealth Connections Bioinformatics and

More information

Concepts of Bioinformatics

Concepts of Bioinformatics 1. Introduction Bioinformatics is the field of science in which biology, computer science, and information technology merge to form a single discipline. It is the emerging field that deals with the application

More information

EMBO COURSE. Practical Course on Genetic and Molecular Analysis of Arabidopsis. Module 3. Genome analysis and in silico functional predictions

EMBO COURSE. Practical Course on Genetic and Molecular Analysis of Arabidopsis. Module 3. Genome analysis and in silico functional predictions EMBO COURSE Practical Course on Genetic and Molecular Analysis of Arabidopsis Module 3 Genome analysis and in silico functional predictions Barbet J.C., Chiapello H., Cooke R., Lecharny A., Ollivier E.

More information

Host : Dr. Nobuyuki Nukina Tutor : Dr. Fumitaka Oyama

Host : Dr. Nobuyuki Nukina Tutor : Dr. Fumitaka Oyama Method to assign the coding regions of ESTs Céline Becquet Summer Program 2002 Structural Neuropathology Lab Molecular Neuropathology Group RIKEN Brain Science Institute Host : Dr. Nobuyuki Nukina Tutor

More information

Genome Annotation Genome annotation What is the function of each part of the genome? Where are the genes? What is the mrna sequence (transcription, splicing) What is the protein sequence? What does

More information

Fundamentals of Bioinformatics: computation, biology, computational biology

Fundamentals of Bioinformatics: computation, biology, computational biology Fundamentals of Bioinformatics: computation, biology, computational biology Vasilis J. Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus A short self-introduction

More information

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF) Guideline for the submission of DNA sequences derived from genetically modified organisms and associated annotations within the framework of Directive 2001/18/EC and Regulation (EC) No 1829/2003 European

More information

user s guide Question 3

user s guide Question 3 Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.

More information

A Survey On Biological Databases And Applications Of Datamining

A Survey On Biological Databases And Applications Of Datamining Australian Journal of Basic and Applied Sciences, 6(13): 175-180, 2012 ISSN 1991-8178 A Survey On Biological Databases And Applications Of Datamining 1 N Saravanan, 2 T Devi 1 PhD Research Scholar Department

More information

GenBank. Direct submissions individual records (BankIt( BankIt,, Sequin) Batch submissions via (EST, GSS, STS) ftp accounts sequencing centers

GenBank. Direct submissions individual records (BankIt( BankIt,, Sequin) Batch submissions via  (EST, GSS, STS) ftp accounts sequencing centers What is GenBank? NCBI s Primary Sequence Database Nucleotide sequence database Archival in nature GenBank Data Direct submissions individual records (BankIt( BankIt,, Sequin) Batch submissions via email

More information

Read Mapping and Variant Calling. Johannes Starlinger

Read Mapping and Variant Calling. Johannes Starlinger Read Mapping and Variant Calling Johannes Starlinger Application Scenario: Personalized Cancer Therapy Different mutations require different therapy Collins, Meredith A., and Marina Pasca di Magliano.

More information

Advances in analytical biochemistry and systems biology: Proteomics

Advances in analytical biochemistry and systems biology: Proteomics Advances in analytical biochemistry and systems biology: Proteomics Brett Boghigian Department of Chemical & Biological Engineering Tufts University July 29, 2005 Proteomics The basics History Current

More information

Introduction to EMBL-EBI.

Introduction to EMBL-EBI. Introduction to EMBL-EBI www.ebi.ac.uk What is EMBL-EBI? Part of EMBL Austria, Belgium, Croatia, Denmark, Finland, France, Germany, Greece, Iceland, Ireland, Israel, Italy, Luxembourg, the Netherlands,

More information

Examination Assignments

Examination Assignments Bioinformatics Institute of India H-109, Ground Floor, Sector-63, Noida-201307, UP. INDIA Tel.: 0120-4320801 / 02, M. 09818473366, 09810535368 Email: info@bii.in, Website: www.bii.in INDUSTRY PROGRAM IN

More information

Annow: BLAST Based Analytical Sequence Annotation Software

Annow: BLAST Based Analytical Sequence Annotation Software Annow: BLAST Based Analytical Sequence Annotation Software The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters. Citation Accessed

More information

The EMBL nucleotide sequence database

The EMBL nucleotide sequence database Nucleic Acids Research, 2001, Vol. 29, No. 1 17 21 The EMBL nucleotide sequence database Guenter Stoesser*, Wendy Baker, Alexandra van den Broek, Evelyn Camon, Maria Garcia-Pastor, Carola Kanz, Tamara

More information

Genome Annotation. What Does Annotation Describe??? Genome duplications Genes Mobile genetic elements Small repeats Genetic diversity

Genome Annotation. What Does Annotation Describe??? Genome duplications Genes Mobile genetic elements Small repeats Genetic diversity Genome Annotation Genome Sequencing Costliest aspect of sequencing the genome o But Devoid of content Genome must be annotated o Annotation definition Analyzing the raw sequence of a genome and describing

More information

Application for Automating Database Storage of EST to Blast Results. Vikas Sharma Shrividya Shivkumar Nathan Helmick

Application for Automating Database Storage of EST to Blast Results. Vikas Sharma Shrividya Shivkumar Nathan Helmick Application for Automating Database Storage of EST to Blast Results Vikas Sharma Shrividya Shivkumar Nathan Helmick Outline Biology Primer Vikas Sharma System Overview Nathan Helmick Creating ESTs Nathan

More information

Alignment to a database. November 3, 2016

Alignment to a database. November 3, 2016 Alignment to a database November 3, 2016 How do you create a database? 1982 GenBank (at LANL, 2000 sequences) 1988 A way to search GenBank (FASTA) Genome Project 1982 GenBank (at LANL, 2000 sequences)

More information

Custom TaqMan Assays DESIGN AND ORDERING GUIDE. For SNP Genotyping and Gene Expression Assays. Publication Number Revision G

Custom TaqMan Assays DESIGN AND ORDERING GUIDE. For SNP Genotyping and Gene Expression Assays. Publication Number Revision G Custom TaqMan Assays DESIGN AND ORDERING GUIDE For SNP Genotyping and Gene Expression Assays Publication Number 4367671 Revision G For Research Use Only. Not for use in diagnostic procedures. Manufacturer:

More information

BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers

BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html UCSC

More information

Basic molecular biology and overview of major bioinforma6cs web resources. Yanbin Yin Fall 2015

Basic molecular biology and overview of major bioinforma6cs web resources. Yanbin Yin Fall 2015 Basic molecular biology and overview of major bioinforma6cs web resources Yanbin Yin Fall 2015 1 Outline Basic molecular biology Web Databases Web Servers 2 References NAR database and web server annual

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Alla L Lapidus, Ph.D. SPbSU St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as "the study of

More information

Genomics and Bioinformatics GMS6231 (3 credits)

Genomics and Bioinformatics GMS6231 (3 credits) Genomics and Bioinformatics GMS6231 (3 credits) COURSE DESCRIPTION: Principles of genomic characterization and bioinformatic analysis of eukaryotes, including an overview of analytical platforms, computational

More information

Genome and DNA Sequence Databases. BME 110: CompBio Tools Todd Lowe April 5, 2007

Genome and DNA Sequence Databases. BME 110: CompBio Tools Todd Lowe April 5, 2007 Genome and DNA Sequence Databases BME 110: CompBio Tools Todd Lowe April 5, 2007 Admin Reading: Chapters 2 & 3 Notes available in PDF format on-line (see class calendar page): http://www.soe.ucsc.edu/classes/bme110/spring07/bme110-calendar.html

More information

Sequence Analysis Lab Protocol

Sequence Analysis Lab Protocol Sequence Analysis Lab Protocol You will need this handout of instructions The sequence of your plasmid from the ABI The Accession number for Lambda DNA J02459 The Accession number for puc 18 is L09136

More information

BLAST. Basic Local Alignment Search Tool. Optimized for finding local alignments between two sequences.

BLAST. Basic Local Alignment Search Tool. Optimized for finding local alignments between two sequences. BLAST Basic Local Alignment Search Tool. Optimized for finding local alignments between two sequences. An example could be aligning an mrna sequence to genomic DNA. Proteins are frequently composed of

More information

NCBI reference sequences (RefSeq): a curated non-redundant sequence database of genomes, transcripts and proteins

NCBI reference sequences (RefSeq): a curated non-redundant sequence database of genomes, transcripts and proteins Published online 27 November 2006 Nucleic Acids Research, 2007, Vol. 35, Database issue D61 D65 doi:10.1093/nar/gkl842 NCBI reference sequences (RefSeq): a curated non-redundant sequence database of genomes,

More information

Analysis of the tryptic search space in UniProt databases

Analysis of the tryptic search space in UniProt databases 48 Proteomics 2015, 15, 48 57 DOI 10.1002/pmic.201400227 RESEARCH ARTICLE Analysis of the tryptic search space in UniProt databases Emanuele Alpi, Johannes Griss, Alan Wilter Sousa da Silva, Benoit Bely,

More information

FINDING GENES AND EXPLORING THE GENE PAGE AND RUNNING A BLAST (Exercise 1)

FINDING GENES AND EXPLORING THE GENE PAGE AND RUNNING A BLAST (Exercise 1) FINDING GENES AND EXPLORING THE GENE PAGE AND RUNNING A BLAST (Exercise 1) 1.1 Finding a gene using text search. Note: For this exercise use http://www.plasmodb.org a. Find all possible kinases in Plasmodium.

More information

Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood - a Platform Comparison. CodeLink compatible

Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood - a Platform Comparison. CodeLink compatible Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood - a Platform Comparison CodeLink compatible Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood

More information

BABELOMICS: Microarray Data Analysis

BABELOMICS: Microarray Data Analysis BABELOMICS: Microarray Data Analysis Madrid, 21 June 2010 Martina Marbà mmarba@cipf.es Bioinformatics and Genomics Department Centro de Investigación Príncipe Felipe (CIPF) (Valencia, Spain) DNA Microarrays

More information

AGENDA for 10/11/13 AGENDA: HOMEWORK: Due end of the period OBJECTIVES:

AGENDA for 10/11/13 AGENDA: HOMEWORK: Due end of the period OBJECTIVES: AGENDA for 10/11/13 AGENDA: 1. Finish 1.2.3 DNA Analysis Analyzing DNA Samples Using Current Forensic Methods OBJECTIVES: 1. Demonstrate the steps of gel electrophoresis 2. Analyze restriction fragment

More information

NCBI Reference Sequences: current status, policy and new initiatives

NCBI Reference Sequences: current status, policy and new initiatives D32 D36 Nucleic Acids Research, 2009, Vol. 37, Database issue Published online 16 October 2008 doi:10.1093/nar/gkn721 NCBI Reference Sequences: current status, policy and new initiatives Kim D. Pruitt*,

More information

Molecular Biology Primer. CptS 580, Computational Genomics, Spring 09

Molecular Biology Primer. CptS 580, Computational Genomics, Spring 09 Molecular Biology Primer pts 580, omputational enomics, Spring 09 Starting 19 th century What do we know of cellular biology? ell as a fundamental building block 1850s+: ``DNA was discovered by Friedrich

More information

Identification of Single Nucleotide Polymorphisms and associated Disease Genes using NCBI resources

Identification of Single Nucleotide Polymorphisms and associated Disease Genes using NCBI resources Identification of Single Nucleotide Polymorphisms and associated Disease Genes using NCBI resources Navreet Kaur M.Tech Student Department of Computer Engineering. University College of Engineering, Punjabi

More information

The Catalytic Site Atlas: a resource of catalytic sites and residues identi ed in enzymes using structural data

The Catalytic Site Atlas: a resource of catalytic sites and residues identi ed in enzymes using structural data The Catalytic Site Atlas: a resource of catalytic sites and residues identi ed in enzymes using structural data Craig T. Porter 1, Gail J. Bartlett 1,2 and Janet M. Thornton 1, * Nucleic Acids Research,

More information

Databases NCBI - ENTREZ

Databases NCBI - ENTREZ Databases NCBI - ENTREZ Data & Software Resources BLAST CDD COG GENSAT GenBank Whole Genome Shotgun Sequences Gene Gene Expression Nervous System Atlas (GENSAT) Gene Expression Omnibus (GEO) Profiles

More information

Database Searching and BLAST Dannie Durand

Database Searching and BLAST Dannie Durand Computational Genomics and Molecular Biology, Fall 2013 1 Database Searching and BLAST Dannie Durand Tuesday, October 8th Review: Karlin-Altschul Statistics Recall that a Maximal Segment Pair (MSP) is

More information

Using the Potato Genome Sequence! Robin Buell! Michigan State University! Department of Plant Biology! August 15, 2010!

Using the Potato Genome Sequence! Robin Buell! Michigan State University! Department of Plant Biology! August 15, 2010! Using the Potato Genome Sequence! Robin Buell! Michigan State University! Department of Plant Biology! August 15, 2010! buell@msu.edu! 1 Whole Genome Shotgun Sequencing 2 New Technologies Revolutionize

More information

New services of the EMBL Data Library

New services of the EMBL Data Library 7990 Oxford University Press Nucleic Acids Research, Vol. 18, No. 15 4319 New services of the EMBL Data Library Rainer Fuchs, Peter Stoehr, Peter Rice 1, Roy Omond 1 and Graham Cameron The EMBL Data Library

More information

National Center for Biotechnology Information (NCBI):

National Center for Biotechnology Information (NCBI): National Center for Biotechnology Information (NCBI): http://www.ncbi.nlm.nih.gov By: Dr Hadi Mozafari As a national resource for molecular biology information, NCBI's mission is to develop new information

More information

What is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases.

What is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases. What is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases. Bioinformatics is the marriage of molecular biology with computer

More information

Open Access. Abstract

Open Access. Abstract Software ProSplicer: a database of putative alternative splicing information derived from protein, mrna and expressed sequence tag sequence data Hsien-Da Huang*, Jorng-Tzong Horng*, Chau-Chin Lee and Baw-Jhiune

More information

MATH 5610, Computational Biology

MATH 5610, Computational Biology MATH 5610, Computational Biology Lecture 2 Intro to Molecular Biology (cont) Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/24 Announcements Error on syllabus Class

More information

Agenda. Annotation of Drosophila. Muller element nomenclature. Annotation: Adding labels to a sequence. GEP Drosophila annotation projects 01/03/2018

Agenda. Annotation of Drosophila. Muller element nomenclature. Annotation: Adding labels to a sequence. GEP Drosophila annotation projects 01/03/2018 Agenda Annotation of Drosophila January 2018 Overview of the GEP annotation project GEP annotation strategy Types of evidence Analysis tools Web databases Annotation of a single isoform (walkthrough) Wilson

More information