SIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology.
|
|
- Lawrence Dalton
- 6 years ago
- Views:
Transcription
1 SIMS2003 Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School Introduction to Microarray Technology.
2 Lecture 1 I. EXPERIMENTAL DETAILS II. ARRAY CONSTRUCTION III. IMAGE ANALYSIS Lecture 2 IV. DATA ANALYSIS: V. DATA INTEGRATION
3 Microarray is about gene expression. Why bother? Gene expression All information about living being is coded in DNA as a set of genes. Each gene contains structural information about protein sequence and regulatory information about protein expression. Intermediate step between gene and protein is mrna. The concentration of mrna is measured by microarray.
4 Measuring RNA we know expression profile of cell that defines cell properties and functions Problem: RNA levels and protein levels are not always directly correlated: But no mrna no protein, but relation is not simple and not universal. Functional genomics fill the gap between gene expression and organism function The meaning of life is hidden in gene expression value but it is not easy to get it out
5 DNA mrna DNA array: Universal Easy to measure Scalable Protein array each protein unique not easy to measure, not scalable PROTEIN
6 Microarray Publication 1493 Pubmed analysis using keyword microarray total review
7 Complimentary hybridization the basis of RNA measurement A--T G--C T--A C--G Northern Blot/Southern Blot put RNA on support (membrane, glass) and measure the concentration of unknown sample RNA protection assay NMDAR1 bl B L RT PCR quantitative measurement by amplification
8 Dot Blot is closest relative for microarray Total RNA -target obe is a labeled fragment used to measure oncentration of unknown sample Probe becomes target Reverse northern blot Difference: Size 1-3 mm vs mm Switch target and probe Microarray Result: revolution 1. Miniaturization 2. Multiple probe 3. Sensitivity 4.Excitement!!!
9 Selection of cdna - Selection of sequences that represent the gene of interest.. - Finding sequences, usually in the EST database. - Problems : sequencing errors, alternative splicing, chimeric sequences, contamination selected DNA target DNA SEQUENCING ARRAYING
10 Array Fabrication cdna clones or oligonucleotides (probes) printing microarray 0.1nl/spot Apply target to slide 25x75 mm
11 Source: Affymetrix website
12
13 I. ARRAY CONSTRUCTION WHOLE GENOME ARRAY: e.coli yeast HIV PATHWAY ARRAY apoptotic toxicology array DISCOVERY ARRAY known and novel genes
14 DISCOVERY ARRAY gene selection: specific tissue library subtractive library genes of interest
15 DrugAbuse Array (ver. 2) Brain cdna library: ~ 1100 genes Subtractive library:~ 900 genes (following chronic opioid administration) Ver. 3: Ver. 2 + NIA15K set + kidney cdna library NIA15 K set (~15,000 genes): mouse embryonic libraries Embryonic Kidney libraries (~ 2,200 genes)
16 DrugAbuse array about 20,000 spots
17 DrugAbuse Array Gene class distribution Regulatory 44% Metabolic 35% Structural 21%
18 DrugAbuse Array Regulatory gene distribution Cell division & Differentiation 30% Intracellular messengers 20% Membrane associated 15% Transcription factors 45%
19 A. Synthesis of cdna EXPERIMENTAL PROTOCOL AAAAAA- mrna TTTTTTT- Synthesis of the second strand DNA B. Labeling cdna Single channel Multiple channel 350 nm 480 nm 570 nm 680 nm Cy3 Cy5 C. Hybridization D. Scanning
20 Control Treatment RNA extraction reverse transcription and labeling Red dye Cy5 Green dye Cy3 hybridization
21 laser 2 excitation laser 1 II. Image Analysis emission scanning Presentation: overlay images Image analysis
22 Scanner Details Laser PMT A/D Convertor Dye Photons Electrons Signal excitation amplification filtering
23 The computer (digital) image is two dimensional array of numbers of pixel intensity (z) z =f(x;y) x, y pixel location 8 bit image corresponds to 256 (2 8) levels of intensity 16 bit image corresponds to 65,000 (2 16-1) gray levels of intensity Image can be considered as a realization of a stochastic process, as a sample of whole class of possible images. Each pixel has a probability distribution f(z). This representation of image used in image inference: to reconstruct the characteristic of true unobservable image X from observed image Z using various statistical methods (MMS, ML, Bayesian estimation etc.)
24 Image structure
25 Steps in Images Processing I. Gridding: locate spots II. Segmentation: classification of pixels either as signal or background. III. Measurement: for each spot of the array, calculates signal intensity (mean,median,mode) background and quality measures. Assumption: signal intensity ~ mrna level
26 Local Background Mixed density distribution F(z)=pf(s)+(1-p)f(b) Local background Signal+background
27 Steps in Image Processing 3. Data Extraction Spot Intensities mean (pixel intensities). median (pixel intensities). M-estimators for location of pixel intensity distribution Background values Local Constant (global) None Quality Information Pixel distribution. Background Signal
28 Quality Measurements Spot Signal / Background ratio. Variation in pixel intensities. shape (circularity) Array Correlation between spot intensities. Percentage of bad spots. Distribution of spot signal area.
29 Pixel distribution C3_5 No of obs Expected Normal Upper Boundaries (x <= boundary)
30 Pixel distribution 50 B3_ No of obs Expected Normal Upper Boundaries (x <= boundary)
31 Pixel distribution C3_7 No of obs Expected Normal Upper Boundaries (x <= boundary)
32 IIB. Image Transformation: BACKGROUND CORRECTION: subtract local background from each pixel BACKGROUND SUBTRACTION: subtract local background from mean or median POWER FAMILY OF TRANSFORMATION: Xt=X p, p 0 Xt= lnx, p=0 monotonous, differentiable can adjust nonlinearity and asymmetry
33 pixel distribution and background correction C3-4 C3-4-bgr C3-3 C3-3-bgr
34 Background subtracted Power 3/4 Power 1/2 Power 1/4 logarithmic Logarithmic+ background subtraction
35 Power Family of Transformation and Background Correction NORMAL BGR CORRECTION logarithmic POWER 0.25 POWER 0.5 POWER 0.75
36 No background correction Background correction Background subtraction Power 0.25
37 Data diagnostic:non-transformed image Control: label with Cy3-dUTP Stress: label with Cy5 dutp
38 Data diagnostic:background subtraction Control: label with Cy3-dUTP Stress: label with Cy5 dutp
39 Data diagnostic:power 1/2 image transformation Control: label with Cy3-dUTP Stress: label with Cy5 dutp
40 Data diagnostic:background (mean+2s) correction Control: label with Cy3-dUTP Stress: label with Cy5 dutp
41 Image Analysis Algorithm: optimize scanning parameters spot quantification background determination background subtraction or correction (µ s) DATA ANALYSIS apply regression analysis detect differentially expressed genes pattern recognition and functional analysis
42 Normalization: Why We need to remove systematic error Within slide normalization Between slide normalization
43 Based on data from P.Brown et
44 Normalization: How Question: What kind of normalization should be applied: No normalization Global normalization with nonlinearity (lowess) correction Using normalization by regression (log-transform ratios-based normalization) Using non-changed gene Housekeeping genes Block-plate (Print-tip) normalization
45 Spinal cord injury
46 Spinal cord injury
47 PKC knockout mouse
48 PKC knockout mouse
49 next lecture: DATA ANALYSIS STATISTICAL ANALYSIS array as list of gene PATTERN RECOGNITION expression profile classification FUNCTIONAL ANALYSIS content analysis, gene network construction
DNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationRecent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
More informationCAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1
CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationAim of lecture:to get an overview of the whole process of microarrays, from study design to publication
Microarray pipeline Aim of lecture:to get an overview of the whole process of microarrays, from study design to publication Rita Holdhus Intoduction to Microarray technology September 2010 Many of the
More informationGene expression analysis: Introduction to microarrays
Gene expression analysis: Introduction to microarrays Adam Ameur The Linnaeus Centre for Bioinformatics, Uppsala University February 15, 2006 Overview Introduction Part I: How a microarray experiment is
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationDNA Microarray Technology
2 DNA Microarray Technology 2.1 Overview DNA microarrays are assays for quantifying the types and amounts of mrna transcripts present in a collection of cells. The number of mrna molecules derived from
More informationDNA/RNA MICROARRAYS NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT.
DNA/RNA MICROARRAYS This protocol is based on the EDVOTEK protocol DNA/RNA Microarrays. 10 groups of students NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT. 1. EXPERIMENT OBJECTIVE The objective of this
More informationExpressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes
Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Genes can be regulated at many levels Usually, gene regulation, are referring to transcriptional
More information3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
More informationGene expression. What is gene expression?
Gene expression What is gene expression? Methods for measuring a single gene. Northern Blots Reporter genes Quantitative RT-PCR Operons, regulons, and stimulons. DNA microarrays. Expression profiling Identifying
More informationChapter 1. from genomics to proteomics Ⅱ
Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more
More informationBioinformatics: Microarray Technology. Assc.Prof. Chuchart Areejitranusorn AMS. KKU.
Introduction to Bioinformatics: Microarray Technology Assc.Prof. Chuchart Areejitranusorn AMS. KKU. ความจร งเก ยวก บ ความจรงเกยวกบ Cell and DNA Cell Nucleus Chromosome Protein Gene (mrna), single strand
More informationMicroarrays: since we use probes we obviously must know the sequences we are looking at!
These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression
More informationMicroarray pipeline & Pre-processing
Microarray pipeline & Pre-processing Solveig Mjelstad Olafsrud J Express Analysis Course November 2010 Some slides adapted from Christine Stansberg thank you Christine! The microarray pipeline The goal
More informationSoybean Microarrays. An Introduction. By Steve Clough. November Common Microarray platforms
Soybean Microarrays Microarray construction An Introduction By Steve Clough November 2005 Common Microarray platforms cdna: spotted collection of PCR products from different cdna clones, each representing
More informationMoc/Bio and Nano/Micro Lee and Stowell
Moc/Bio and Nano/Micro Lee and Stowell Moc/Bio-Lecture GeneChips Reading material http://www.gene-chips.com/ http://trueforce.com/lab_automation/dna_microa rrays_industry.htm http://www.affymetrix.com/technology/index.affx
More informationMotivation From Protein to Gene
MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein
More informationChapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.
Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers
More informationLecture 22 Eukaryotic Genes and Genomes III
Lecture 22 Eukaryotic Genes and Genomes III In the last three lectures we have thought a lot about analyzing a regulatory system in S. cerevisiae, namely Gal regulation that involved a hand full of genes.
More informationPre processing and quality control of microarray data
Pre processing and quality control of microarray data Christine Stansberg, 20.04.10 Workflow microarray experiment 1 Problem driven experimental design Wet lab experiments RNA labelling 2 Data pre processing
More informationPlease purchase PDFcamp Printer on to remove this watermark. DNA microarray
DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of
More informationEECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and
More informationIntroduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationDeoxyribonucleic Acid DNA
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationMeasuring gene expression
Measuring gene expression Grundlagen der Bioinformatik SS2018 https://www.youtube.com/watch?v=v8gh404a3gg Agenda Organization Gene expression Background Technologies FISH Nanostring Microarrays RNA-seq
More informationCOS 597c: Topics in Computational Molecular Biology. DNA arrays. Background
COS 597c: Topics in Computational Molecular Biology Lecture 19a: December 1, 1999 Lecturer: Robert Phillips Scribe: Robert Osada DNA arrays Before exploring the details of DNA chips, let s take a step
More informationOutline. Array platform considerations: Comparison between the technologies available in microarrays
Microarray overview Outline Array platform considerations: Comparison between the technologies available in microarrays Differences in array fabrication Differences in array organization Applications of
More informationClones. Glass Slide PCR. Purification. Array Printing. Post-process. Hybridize. Scan. Array Fabrication. Sample Preparation/Hybridization.
Terminologies Reporter: the nucleotide sequence present in a particular location on the array (a.k.a. probe) Feature: the location of a reporter on the array Composite sequence: a set of reporters used
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Introduction
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationSelected Techniques Part I
1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative
More informationSite directed mutagenesis, Insertional and Deletion Mutagenesis. Mitesh Shrestha
Site directed mutagenesis, Insertional and Deletion Mutagenesis Mitesh Shrestha Mutagenesis Mutagenesis (the creation or formation of a mutation) can be used as a powerful genetic tool. By inducing mutations
More informationFACTORS CONTRIBUTING TO VARIABILITY IN DNA MICROARRAY RESULTS: THE ABRF MICROARRAY RESEARCH GROUP 2002 STUDY
FACTORS CONTRIBUTING TO VARIABILITY IN DNA MICROARRAY RESULTS: THE ABRF MICROARRAY RESEARCH GROUP 2002 STUDY K. L. Knudtson 1, C. Griffin 2, A. I. Brooks 3, D. A. Iacobas 4, K. Johnson 5, G. Khitrov 6,
More informationOutline. Analysis of Microarray Data. Most important design question. General experimental issues
Outline Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization Introduction to microarrays Experimental design Data normalization Other data transformation Exercises George Bell,
More informationComputational Biology I
Computational Biology I Microarray data acquisition Gene clustering Practical Microarray Data Acquisition H. Yang From Sample to Target cdna Sample Centrifugation (Buffer) Cell pellets lyse cells (TRIzol)
More informationExploration and Analysis of DNA Microarray Data
Exploration and Analysis of DNA Microarray Data Dhammika Amaratunga Senior Research Fellow in Nonclinical Biostatistics Johnson & Johnson Pharmaceutical Research & Development Javier Cabrera Associate
More informationGene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis
Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods
More informationMeasuring gene expression (Microarrays) Ulf Leser
Measuring gene expression (Microarrays) Ulf Leser This Lecture Gene expression Microarrays Idea Technologies Problems Quality control Normalization Analysis next week! 2 http://learn.genetics.utah.edu/content/molecules/transcribe/
More informationMicroarray. Key components Array Probes Detection system. Normalisation. Data-analysis - ratio generation
Microarray Key components Array Probes Detection system Normalisation Data-analysis - ratio generation MICROARRAY Measures Gene Expression Global - Genome wide scale Why Measure Gene Expression? What information
More informationAnalyzing DNA Microarray Data Using Bioconductor
Analyzing DNA Microarray Data Using Bioconductor Sandrine Dudoit and Rafael Irizarry Short Course on Mathematical Approaches to the Analysis of Complex Phenotypes The Jackson Laboratory, Bar Harbor, Maine
More informationIntroduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute
Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how
More information6. GENE EXPRESSION ANALYSIS MICROARRAYS
6. GENE EXPRESSION ANALYSIS MICROARRAYS BIOINFORMATICS COURSE MTAT.03.239 16.10.2013 GENE EXPRESSION ANALYSIS MICROARRAYS Slides adapted from Konstantin Tretyakov s 2011/2012 and Priit Adlers 2010/2011
More informationREAL TIME PCR USING SYBR GREEN
REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM
More informationIntroduction to biology and measurement of gene expression
Introduction to biology and measurement of gene expression Statistical analysis of gene expression data with R and Bioconductor University of Copenhagen, 17-21 August, 2009 Margaret Taub University of
More informationIntroduction to Bioinformatics and Gene Expression Technology
Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA
More information7.03, 2006, Lecture 23 Eukaryotic Genes and Genomes IV
1 Fall 2006 7.03 7.03, 2006, Lecture 23 Eukaryotic Genes and Genomes IV In the last three lectures we have thought a lot about analyzing a regulatory system in S. cerevisiae, namely Gal regulation that
More information7.05, 2005, Lecture 23 Eukaryotic Genes and Genomes IV
7.05, 2005, Lecture 23 Eukaryotic Genes and Genomes IV In the last three lectures we have thought a lot about analyzing a regulatory system in S. cerevisiae, namely Gal regulation that involved a hand
More informationQuantitative Real Time PCR USING SYBR GREEN
Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to
More informationRafael A Irizarry, Department of Biostatistics JHU
Getting Usable Data from Microarrays it s not as easy as you think Rafael A Irizarry, Department of Biostatistics JHU rafa@jhu.edu http://www.biostat.jhsph.edu/~ririzarr http://www.bioconductor.org Acknowledgements
More informationSGN-6106 Computational Systems Biology I
SGN-6106 Computational Systems Biology I A View of Modern Measurement Systems in Cell Biology Kaisa-Leena Taattola 21.2.2007 1 The cell a complex system (Source: Lehninger Principles of Biochemistry 4th
More informationComputing with large data sets
Computing with large data sets Richard Bonneau, spring 2009 Lecture 14 (week 8): genomics 1 Central dogma Gene expression DNA RNA Protein v22.0480: computing with data, Richard Bonneau Lecture 14 places
More informationGene expression profiling experiments:
Gene expression profiling experiments: Problems, pitfalls, and solutions. Heli Borg The Alternatives in Microarray Experiments bacteria - eucaryots non poly(a) + - poly(a) + oligonucleotide Affymetrix
More informationMeasuring and Understanding Gene Expression
Measuring and Understanding Gene Expression Dr. Lars Eijssen Dept. Of Bioinformatics BiGCaT Sciences programme 2014 Why are genes interesting? TRANSCRIPTION Genome Genomics Transcriptome Transcriptomics
More informationThen, we went on to discuss genome expression and described: Microarrays
In the previous lecture, we have discussed: - classical sequencing methods - newer authomatic sequencing methods - solid-phase parallel sequencing - Next Generation mass-sequencing methods Then, we went
More informationIntroduction to microarray technology and data analysis
Introduction to microarray technology and data analysis Aron C. Eklund eklund@cbs.dtu.dk Cancer Systems Biology group Center for Biological Sequence Analysis Technical University of Denmark Introduction
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Introduction
More information3. Microarrays: experimental design, statistical analysis and gene clustering
WUEMED Drought Course 3. Microarrays: experimental design, statistical analysis and gene clustering John Bennett International Rice Research Institute Los Baños, Philippines 3.1: Experimental overview
More information1. Introduction Gene regulation Genomics and genome analyses
1. Introduction Gene regulation Genomics and genome analyses 2. Gene regulation tools and methods Regulatory sequences and motif discovery TF binding sites Databases 3. Technologies Microarrays Deep sequencing
More informationBiotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
More informationDNA Microarrays and Clustering of Gene Expression Data
DNA Microarrays and Clustering of Gene Expression Data Martha L. Bulyk mlbulyk@receptor.med.harvard.edu Biophysics 205 Spring term 2008 Traditional Method: Northern Blot RNA population on filter (gel);
More informationSoybean Microarrays. Microarray construction. An Introduction. By Steve Clough
Soybean Microarrays Microarray construction An Introduction By Steve Clough Common Microarray platforms cdna: spotted collection of PCR products from different cdna clones, each representing a different
More informationPre-processing DNA Microarray Data
Pre-processing DNA Microarray Data Sandrine Dudoit, Robert Gentleman, Rafael Irizarry, and Yee Hwa Yang Bioconductor Short Course Winter 2002 Copyright 2002, all rights reserved Biological question Experimental
More informationBioinformatics III Structural Bioinformatics and Genome Analysis. PART II: Genome Analysis. Chapter 7. DNA Microarrays
Bioinformatics III Structural Bioinformatics and Genome Analysis PART II: Genome Analysis Chapter 7. DNA Microarrays 7.1 Motivation 7.2 DNA Microarray History and current states 7.3 DNA Microarray Techniques
More informationIntroduction to Bioinformatics. Fabian Hoti 6.10.
Introduction to Bioinformatics Fabian Hoti 6.10. Analysis of Microarray Data Introduction Different types of microarrays Experiment Design Data Normalization Feature selection/extraction Clustering Introduction
More informationGene expression analysis. Gene expression analysis. Total RNA. Rare and abundant transcripts. Expression levels. Transcriptional output of the genome
Gene expression analysis Gene expression analysis Biology of the transcriptome Observing the transcriptome Computational biology of gene expression sven.nelander@wlab.gu.se Recent examples Transcriptonal
More informationOptimizing crna fragmentation for microarray experiments using the Agilent 2100 bioanalyzer. Application Deborah Vitale.
Optimizing crna fragmentation for microarray experiments using the Agilent 2100 bioanalyzer Application Deborah Vitale Introduction Oligonucleotide arrays are a powerful tool for gene expression studies.
More informationCodeLink Human Whole Genome Bioarray
CodeLink Human Whole Genome Bioarray 55,000 human gene targets on a single bioarray The CodeLink Human Whole Genome Bioarray comprises one of the most comprehensive coverages of the human genome, as it
More informationIntroduction to microarray technology and data analysis
Introduction to microarray technology and data analysis Aron C. Eklund eklund@cbs.dtu.dk Cancer Systems Biology group Center for Biological Sequence Analysis Technical University of Denmark Introduction
More informationIntroduction to Microarray Analysis
Introduction to Microarray Analysis Methods Course: Gene Expression Data Analysis -Day One Rainer Spang Microarrays Highly parallel measurement devices for gene expression levels 1. How does the microarray
More informationReading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
More informationDesign. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
More informationDNA Chip Technology Benedikt Brors Dept. Intelligent Bioinformatics Systems German Cancer Research Center
DNA Chip Technology Benedikt Brors Dept. Intelligent Bioinformatics Systems German Cancer Research Center Why DNA Chips? Functional genomics: get information about genes that is unavailable from sequence
More informationGene Expression Data Analysis
Gene Expression Data Analysis Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu BMIF 310, Fall 2009 Gene expression technologies (summary) Hybridization-based
More informationIntroduction to gene expression microarray data analysis
Introduction to gene expression microarray data analysis Outline Brief introduction: Technology and data. Statistical challenges in data analysis. Preprocessing data normalization and transformation. Useful
More informationIntroduction to Microarray Technique, Data Analysis, Databases Maryam Abedi PhD student of Medical Genetics
Introduction to Microarray Technique, Data Analysis, Databases Maryam Abedi PhD student of Medical Genetics abedi777@ymail.com Outlines Technology Basic concepts Data analysis Printed Microarrays In Situ-Synthesized
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationExpression Array System
Integrated Science for Gene Expression Applied Biosystems Expression Array System Expression Array System SEE MORE GENES The most complete, most sensitive system for whole genome expression analysis. The
More informationBootcamp: Molecular Biology Techniques and Interpretation
Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing
More informationQ-PCR QUANTITATIVE-PCR 세포생물학및실험 2 박태식교수님
Q-PCR QUANTITATIVE-PCR 세포생물학및실험 2 박태식교수님 Title : Study that the Drug A inhibits the accumulation of fat. Schedules 1. Mouse necropsy : take up the blood and major tissues(organs) ex) heart, liver, fat,
More informationSMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation
More informationSupplementary Fig.1. Over-expression of RNase L in stable polyclonal cell line
Supplemental Data mrna Protein A kda 75 40 NEO/vector NEO/RNase L RNASE L β-actin RNASE L β-actin B % of control (neo vector), normalized 240 ** 200 160 120 80 40 0 Neo Neo/RNase L RNase L Protein Supplementary
More informationImage Analysis. Based on Information from Terry Speed s Group, UC Berkeley. Lecture 3 Pre-Processing of Affymetrix Arrays. Affymetrix Terminology
Image Analysis Lecture 3 Pre-Processing of Affymetrix Arrays Stat 697K, CS 691K, Microbio 690K 2 Affymetrix Terminology Probe: an oligonucleotide of 25 base-pairs ( 25-mer ). Based on Information from
More informationIntroduction to Bioinformatics: Chapter 11: Measuring Expression of Genome Information
HELSINKI UNIVERSITY OF TECHNOLOGY LABORATORY OF COMPUTER AND INFORMATION SCIENCE Introduction to Bioinformatics: Chapter 11: Measuring Expression of Genome Information Jarkko Salojärvi Lecture slides by
More informationNormalization. Getting the numbers comparable. DNA Microarray Bioinformatics - #27612
Normalization Getting the numbers comparable The DNA Array Analysis Pipeline Question Experimental Design Array design Probe design Sample Preparation Hybridization Buy Chip/Array Image analysis Expression
More informationSTATISTICAL CHALLENGES IN GENE DISCOVERY
STATISTICAL CHALLENGES IN GENE DISCOVERY THROUGH MICROARRAY DATA ANALYSIS 1 Central Tuber Crops Research Institute,Kerala, India 2 Dept. of Statistics, St. Thomas College, Pala, Kerala, India email:sreejyothi
More informationmeasuring gene expression December 11, 2018
measuring gene expression December 11, 2018 Intervening Sequences (introns): how does the cell get rid of them? Splicing!!! Highly conserved ribonucleoprotein complex recognizes intron/exon junctions and
More informationMicroarray Technique. Some background. M. Nath
Microarray Technique Some background M. Nath Outline Introduction Spotting Array Technique GeneChip Technique Data analysis Applications Conclusion Now Blind Guess? Functional Pathway Microarray Technique
More informationDNA Microarray Technology
CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic
More informationBackground Correction and Normalization. Lecture 3 Computational and Statistical Aspects of Microarray Analysis June 21, 2005 Bressanone, Italy
Background Correction and Normalization Lecture 3 Computational and Statistical Aspects of Microarray Analysis June 21, 2005 Bressanone, Italy Feature Level Data Outline Affymetrix GeneChip arrays Two
More informationThe essentials of microarray data analysis
The essentials of microarray data analysis (from a complete novice) Thanks to Rafael Irizarry for the slides! Outline Experimental design Take logs! Pre-processing: affy chips and 2-color arrays Clustering
More informationBasics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility
2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,
More informationUtility of Branched DNA Hybridization Methodology for the Quantitation of Oligonucleotides
Utility of Branched DNA Hybridization Methodology for the Quantitation of Oligonucleotides Laboratory Sciences, MPI Research, A Charles River Company Amy Smith, BA, Senior Director, Bioanalytical/Analytical
More informationChapter 20 Biotechnology
Chapter 20 Biotechnology Manipulation of DNA In 2007, the first entire human genome had been sequenced. The ability to sequence an organisms genomes were made possible by advances in biotechnology, (the
More information10.1 The Central Dogma of Biology and gene expression
126 Grundlagen der Bioinformatik, SS 09, D. Huson (this part by K. Nieselt) July 6, 2009 10 Microarrays (script by K. Nieselt) There are many articles and books on this topic. These lectures are based
More informationBioinformatics for Biologists
Bioinformatics for Biologists Microarray Data Analysis. Lecture 1. Fran Lewitter, Ph.D. Director Bioinformatics and Research Computing Whitehead Institute Outline Introduction Working with microarray data
More informationRNA Isolation and Technology Applications. Nadine Nassif Senior Research Scientist Promega Corporation
RNA Isolation and Technology Applications Nadine Nassif Senior Research Scientist Promega Corporation verview Brief overview of basic RNA/DNA chemistry. verview of total and poly(a+) RNA isolation. Discuss
More informationGranulometric Analysis of Spots in DNA Microarray Images
Article Granulometric Analysis of Spots in DNA Microarray Images Behara Latha 1 * and Balasubramanian Venkatesh 2 * 1 Faculty of Engineering and Technology, Multimedia University, 75450 Melaka, Malaysia;
More information