Li Zhang 1,2, Meng Xiao 1, Matthew R. Watts 3, He Wang 1, Xin Fan 1,2, Fanrong Kong 3 and Ying-Chun Xu 1*
|
|
- Preston Alexander
- 6 years ago
- Views:
Transcription
1 Zhang et al. BMC Infectious Diseases (2015) 15:340 DOI /s CSE REPORT Open ccess Development of fluconazole resistance in a series of Candida parapsilosis isolates from a persistent candidemia patient with prolonged antifungal therapy Li Zhang 1,2, Meng Xiao 1, Matthew R. Watts 3, He Wang 1, Xin Fan 1,2, Fanrong Kong 3 and Ying-Chun Xu 1* bstract Background: Candida parapsilosis was the most common species causing candidemia in the 2010 China Hospital Invasive Fungal Surveillance Net (CHIF-NET) database. Compared to Candida albicans, the description of azole resistance and mechanisms in C. parapsilosis is very limited. We report a patient with C. parapsilosis candidemia over several months, due to a probable intravascular source, who developed fluconazole resistance after prolonged treatment. Case presentation: n 82 year-old male had a hospital admission of approximately 1.5 years duration. He was initially admitted with acute pancreatitis. Prior to succumbing to the illness, he developed candidemia and treated with three antifungal drugs for nearly 5 months, at suboptimal doses and without source control. Following treatment, 6 blood cultures were still positive for C. parapsilosis. The last 2 strains were resistant to fluconazole (MICs 32 μg/ml) and intermediate to voriconazole (MICs 0.5 μg/ml). Microsatellite multilocus analysis indicated that the 6 isolates from the patient belonged to a single genotype. The first 4 isolates were susceptible to fluconazole (MICs 2 μg/ml) and voriconazole (MICs μg/ml), which were slightly higher than susceptible control strains from other patients. Overexpression of MDR1 genes were detected in the two resistant isolates, and this was associated with a homozygous mutation in MRR1 genes (T2957C /T2957C), with the amino acid exchange L986P. Conclusions: This case corroborates that the resistant C. parapsilosis isolates can emerge in the setting of complicated infections and the extensive use of antifungal agents, emphasizing the need for standardizing and improving the antifungal treatment as well as source control in the treatment of infection diseases. Keywords: Candida parapsilosis, Fluconazole resistance, Persistent candidemia, ntifungal treatment, MDR1, MRR1 Background Candida parapsilosis is a significant clinical pathogen that can grow in total parenteral nutrition, form biofilms on catheters and other implanted devices, persist in the hospital environment and be nosocomially transmitted by hand carriage [1 4]. In China, C. parapsilosis was the most common species causing candidemia in the 2010 China Hospital Invasive Fungal Surveillance Net (CHIF- NET) study [5]. * Correspondence: xycpumch@139.com 1 Department of Clinical Laboratory, Peking Union Medical College Hospital, Chinese cademy of Medical Sciences, Beijing , China Full list of author information is available at the end of the article zoles are the most commonly used drugs for the treatment of Candida infections. Besides species that show intrinsic resistance, such as Candida krusei, the acquisition of azole resistance, particularly after prolonged exposure and prophylactic overuse, is well described in Candida albicans, Candida tropicalis, Candida glabrata [6 9]. However, the descriptions of azole resistance in C. parapsilosis are very limited [10, 11]. Constitutive overexpression of 2 types of multidrug efflux pumps, encoded by CDR1 or MDR1 genes is a major cause of resistance to azoles [12 14]. Morschhäuser et al. found that gain of function mutations in MRR1 genes cause constitutive MDR1 overexpression in 2015 Zhang et al. Open ccess This article is distributed under the terms of the Creative Commons ttribution 4.0 International License ( which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver ( applies to the data made available in this article, unless otherwise stated.
2 Zhang et al. BMC Infectious Diseases (2015) 15:340 Page 2 of 7 fluconazole-resistant C. albicans and C. dubliniensis [15 17]. Similarly, the mutations in TC1, atranscription factor regulating CDR genes, are responsible for the constitutive high-level expression of CDR genes [18, 19]. nother common mechanism is the ERG11 gene overexpression or acquisition of mutations, resulting in target enzyme up-regulation or reduced affinity to bind azoles [12 14]. The mutations in UPC2 are a frequent cause of ERG upregulation [20]. We encountered a case of induced fluconazole resistance in C. parapsilosis from a patient with persistent candidemia due to a probable intravascular source in the Peking Union Medical College Hospital (PUMCH). Here we describe the case and explore the possible resistance mechanism. Case presentation n 82 year-old male was admitted to the PUMCH in December, 2008 with severe, acute pancreatitis. He was managed with mechanical ventilation and received parenteral nutrition, diuretics and anti-microbial therapy. His renal function deteriorated in the 11 th week following hospitalization, he began haemodialysis, 3 times per week, through a left internal jugular venous catheter. In the 49 th week, he developed a fever of 39 C, and blood culture were collected. He was treated with empirical meropenem and his fever resolved after 3 days. His blood culture were positive for C. parapsilosis after 7 days, however, due to his clinical improvement he was not given any antifungal therapy (Fig. 1). In the 52 nd week, the left internal jugular venous catheter was removed, and an arteriovenous fistula was created in the forearm using a polytetrafluoroethylene (PTFE) graft to allow hemodialysis. In the 66 th week, he became febrile and a sputum smear showed a large amount of yeast, with culture positive for C. glabrata. CT scan of the chest showed nodules in the right upper lobe and bilateral pleural effusion. He was treated for a pulmonary fungal infection, with fluconazole (100 mg/day, renal dose adjusted) (Fig. 1). While still on the antifungal therapy, C. parapsilosis susceptible to fluconazole was isolated from blood culture in the 71 st week following admission. In the subsequent 9 weeks the patient had intermittent fevers. There were 4 other blood cultures positive for C. parapsilosis, consistent with an intravascular source of infection (Fig. 1). The final two isolates (PU123 and PU127) were resistant to fluconazole and had intermediate susceptibility to voriconazole. ntifungal treatment received by the patient and isolated strains are summarized in Fig. 1. Due to fluconazole treatment failure, it was changed to intraconazole (100 mg/day) in the 74 th week. This was ceased in the 76 th week and fluconazole was recommenced at a higher dose (200 mg/day). s a possible source of infection, the synthetic arteriovenous fistula was removed in the 78 th week. However, the candidemia persisted and in the 80 th week caspofungin (50 mg/day) was commenced. In the 81 st week, the patient became comatosed (Glasogow Coma Scale 5) with hypertonia, a positive Babinski sign, and neck rigidity, indicative of central nervous system infection or metabolic encephalopathy. No further investigations were performed, as treatment was withdrawn following discussion with the patient s family. The patient died in the 82 nd week of admission. Comparison with control isolates The use of the isolates in the present study was approved by the Human Research Ethics Committee of Peking Union Medical College Hospital (No. S-263). We have obtained the writing consent from the control patients to publish the case report. There were 6 blood culture isolates from the patient described in the case study (patient 1). In addition, 6 isolates of C. parapsilosis obtained from the other patients (patients 2 7) in the PUMCH during the hospitalization of patient 1 were studied for control purpose. Identification of C. parapsilosis was confirmed by DN sequencing of the fungal internal transcribed spacer (ITS) region and the D1/D2 domain of the 28S rrn gene, using a published protocol [5]. Fig. 1 The antifungal treatment course and isolated C. parapsilosis strains information of the patient. a Sputum smear showed a large amount of yeast and antifungal treatment was commenced. b The patient died of systemic invasive fungal infection and chronic renal failure
3 Zhang et al. BMC Infectious Diseases (2015) 15:340 Page 3 of 7 Sensititre YeastOne YO10 broth microdilution susceptibility panels (TREK Diagnostic Systems, Westlake, Ohio) were used to test the susceptibility of C. parapsilosis to antifungal agents, according to a published protocol [21]. For C. parapsilosis, the interpretation of fluconazole, voriconazole and three echinocandins susceptibilities was done in accordance with CLSI M27-S4 [22]. Table 1 summarizes the in vitro susceptibility results of the 12 C. parapsilosis isolates. There was no significant difference in the drugs tested except for fluconazole and voriconazole. The isolates from patients 2 7 were susceptible to fluconazole (MICs μg/ ml) and voriconazole (MICs μg/ml) (Table 1). For patient 1, isolates PU017, PU110, PU112 and PU116 were susceptible to fluconazole (MICs 2 μg/ml) and voriconazole (MICs μg/ml), but with higher MICs than the other susceptible strains. Isolates PU123 and PU127 were resistant to fluconazole (MICs 32 μg/ ml) and had intermediate susceptibility to voriconazole (MICs 0.5 μg/ml) (Table 1). ll the strains were genotyped using the highly polymorphic microsatellite markers, B5, CP1, CP4 and CP6 [23]. mplification reactions were performed as previously reported [23]. The microsatellite multilocus genotypes allowed the differentiation of the 12 strains from 7 patients into 6 different genotypes. The 6 isolates from patient 1 involved a single genotype (genotype ). The strains isolated from control patients 2 4 and 6, 7 were assigned to genotypes B to G based on the observed differences. Isolate PU106 from the control patient 5 showed the same pattern on microsatellite sequence analysis as the isolates from patient 1 and designated genotype (Table 1). Primers used for PCR amplification of MRR1, TC1, UPC2, and ERG11 genes were listed in Table 2 (11). fter alignment of the MRR1 sequences from the 12 Table 1 C. parapsilosis strains information, antifungal susceptibilities, microsatellite typing results and the MRR1 gene mutations Strain no. a Patient Ward b Susceptibility results by Sensititre YeastOne c (μg/ml) Multilocus genotype d Genotype e MRR1 FLC VRC ITC POS NF MCF CS 5FC MB B5 CP1 CP4 CP6 PU017 1 EGW / PU110 1 EGW / PU112 1 EGW / PU116 1 EGW / PU123 1 EGW / PU127 1 EGW / PU004 2 Outpatient / 107 PU026 3 ICU / 145 PU090 4 Medical ward PU106 5 Surgical ward / / PU108 6 EGW / 129 PU131 7 Medical ward / TCC / / / / / 385 / / / / / / 267/ / / 270 / 267/ 267 B C D f E T2957C T2957C a ll strains were isolated from blood cultures b EGW Emergency general ward c FLC Fluconazole, VRC Voriconazole, ITC Itraconazole, POS Posaconazole, NF nidulafungin, MCF, Micafungin,CS Caspofungin, 5FC 5-Flucytosine, MB mphotericin B. Clinical breakpoints for susceptible, intermediate, and resistant for C. parapsilosis, respectively, were those of the CLSI M27-S4 for fluconazole ( 2/4/ 8 μg/ml); and for voriconazole ( 0.125/0.25/ 1 μg/ml); and for anidulafungin, caspofungin, and micafungin ( 2/4/ 8 μg/ml) d The numbers indicate the fragment size in base pairs of the different alleles obtained with the listed marker e The genotype was designated according to the different microsatellite typing results f The PU106 isolate yielded identical genotype with the isolates from patient 1 245/ / / 288 / F G
4 Zhang et al. BMC Infectious Diseases (2015) 15:340 Page 4 of 7 Table 2 Sequences of primers used in genes sequencing Primer name Primer sequence Reference MRR1-F 5'-CCCTTTCTTCCGCGTTTC-3' 11 MRR1-R 5'-CGTTGTGTGGCGTGGT-3' TC1-F 5'-GGCCTCGTGTGC-3' TC1-R 5'-CTTGGTGCTGGCTT-3' UPC2-F 5'-TTCGTGTGTTTTGGTGGTG-3' 11 UPC2-R 5'-TTTCCTCCCCCCTTTGTG-3' ERG11-F 5'-TGGCTTGTTGTTTGCCCT-3' ERG11-R 5'-TCGTTCCTGTTCTCTTT-3' isolates, a single nucleotide mutation () was detected in PU017, PU110, PU112 and PU116 compared with the MRR1 sequence of C. parapsilosis TCC and the control strain with the same pattern on microsatellite typing, PU106 genotype (Table 1). This mutation results in the replacement of a leucine amino acid residue with a proline (L986P). In the PU123 and PU127 isolates from patient 1, mutations were found in both alleles (T2957C). fter alignment of TC1, UPC2, and ERG11 gene sequences from the 12 isolates, no mutation was found. Overnight C. parapsilosis cultures were diluted to an optical density at 600 nm (OD 600 ) of 0.2 in YPD medium and then incubated at 35 C with shaking at 150 rpm for additional 6 h to mid-log phase. Total RN was extracted from isolates grown in YPD medium using the Yeast RNiso Reagent Kit (TaKaRa, Tokyo, Japan) and reverse transcribed to cdn using the PrimeScript RT Reagent Kit (TaKaRa, Tokyo, Japan) according to the instructions of the manufacturer. The quantitative realtime RT-PCRs were performed in triplicate using the SsoFast EvaGreen supermix (Bio-Rad, Hercules, C, US) on a BioRad CFX96 system. TCC were used as the control isolate. The primers used in this study were listed in Table 3 [11, 24, 25]. The CT1 gene was used as the endogenous control. The change in fold expression was obtained by calculating 2 -ΔΔCT, and a change of 2.5 times was considered to be overexpressed [26]. The 2 resistant isolates from patient 1 had higher expression levels of MRR1 than the four susceptible isolates from patient 1 (PU fold and PU fold; Fig. 2). The 4 susceptible isolates showed higher expression levels (>2.5 fold) than the controls. The MDR1 expression was further increased in the resistant isolates (PU fold and PU fold). In contrast, the CDR1, UPC2, ERG11 genes expression levels in the 2 azole-resistant isolates were not significantly different from the 4 susceptible isolates from patient 1 and the control isolates. In order to confirm that only MRR1 and MDR1 genes were overexpressed, we subcultured isolates in the Table 3 Sequences of primers used in quantitative real-time RT-PCR Primer name Primer sequence Reference MRR1-F 5'-CTGGTCTGGCTG-3' 11 MRR1-R 5'-GGCTCTGGTGTGG-3' MDR1-F 5'-TTCGTGTGTTTTGGTGGTG-3' 11 MDR1-R 5'-TGCCTGGGTGTCTTGT-3' CDR1-F 5'-GCGTTTGCCTCGGGTT-3' 24 CDR1-R 5'-TCCGCTGTTTGCGTCT-3' UPC2-F 5'-TTGGGTGTGGGTTCTTCT-3' 11 UPC2-R 5'-CCTTCGCCTTCTTCGTTC-3' ERG11-F 5'-GGTTTCTTGTGTTTGCTCCT-3' 11 ERG11-R 5'-GTCCTGTCGGCTGC-3' CT1-F 5'-TGTGGTTGGTGTTTGGTCT-3' 25 CT1-R 5'-CTCTGCTGGGTTGTTGGC-3' presence of sub-inhibitory concentrations of fluconazole, and repeated the gene expression studies. Two susceptible isolates (PU017, PU116), the 2 resistant isolates (PU123 and PU127) from patient 1, 3 control isolates (PU090, PU106 and PU131) were subcultured. ll the tested isolates and the control strain TCC were firstly incubated at 37 C for 4 h in RPMI 1640 (Sigma, US). Fluconazole was then added at a concentration of 1/2 MIC and the isolates were incubated for an additional 4 h. RN extraction and the quantitative realtime RT-PCRs were performed as the previous experiment in the present study. The 2 resistant isolates showed higher expression levels of MRR1 than the other isolates (PU fold and PU fold; Table 4). The MDR1 expression was also obviously increased in the resistant isolates (PU fold and PU fold). Similar to the previous experiment, the CDR1, UPC2, ERG11 genes expression levels in the 2 azole-resistant isolates were not higher than other susceptible isolates. Discussion Compared to other Candida species, C. parapsilosis tends to be associated with higher MICs to echinocandins [27]. Therefore, the development of azole resistant C. parapsilosis has significant clinical implications, as multiazole- and multiechinocandin-resistant isolates would limit available treatment options [10]. In addition, there could be nosocomial transmission of resistant C. parapsilosis between vulnerable patient groups [1 4]. Microsatellite genotyping was consistent with fluconazole resistant developing in previously susceptible strains of C. parapsilosis. The 2 resistant patient-isolates (PU123 and PU127) overexpressed MRR1 and MDR1. The MRR1 overexpression was highly associated with mutation (T2957C), leading to the amino acid exchange,
5 Zhang et al. BMC Infectious Diseases (2015) 15:340 Page 5 of 7 Fig. 2 Quantitative real-time RT-PCR analysis of MDR1 (a), MRR1 (b), CDR1 (c), ERG11 (d) and UPC2 (e) genes expression levels in the 6 isolates from patient 1 and 6 susceptible isolates from other patients. Each sample was processed in triplicate. Error bars show the standard deviations Table 4 Gene expression in the eight C. parapsilosis isolates cultured in the presence of fluconazole with concentrations of 1/2 MIC Sample MDR1 b MRR1 b CDR1 b ERG11 b UPC2 b TCC22019 a PU PU PU PU PU PU PU a TCC22019 isolates was used as control isolate, and was also cultured in the presence of 1/2 MIC of fluconazole b ll the samples for each gene were tested in triplicate. The left column shows the mean value of expression, and the right column shows the Standard Error of Mean ()
6 Zhang et al. BMC Infectious Diseases (2015) 15:340 Page 6 of 7 L986P. This indicates that the C. parapsilosis resistance to fluconazole was conferred by the increased expression of the MRR1 transcription factor, which resulted in a concomitant overexpression of MDR1. The previous studies have demonstrated that a gainof-function mutation in one MRR1 allele results only in slightly decreased susceptibilities to the azoles and the loss of heterozygosity further increases drug resistance [15, 16]. similar observation was made in the present study, where the patient isolates that were heterozygous MRR1 () mutants showed slightly higher MICs than wild type strains (). The last 2 isolates became homozygous (T2957C) mutants and showed much higher MICs and overexpression of MDR1. While this mutation was the probable cause of the phenotypic resistance in this case, a mutagenesis study that demonstrated the development of resistance and increased gene expression in a previously sensitive organism would provide additional evidence. fter repeating the experiment in which the strains were cultured in media containing fluconazole with concentrations of 1/2 MIC for each isolate, we confirmed that only MDR1 and MRR1 were overexpressed in 2 resistant isolates. However, MDR1 expression did not increase as much as in the initial experiment. This may be related to different medium as well as all the isolates, including the control isolate TCC22019, being exposed to fluconazole. The ERG11 genes in resistant isolates were not overexpressed, even following to fluconazole. Similarly, Grossman et al. has sequenced the ERG11 and MRR1 genes in 30 fluconazole resistant C. parapsilosis isolates and 37 susceptible dose-dependent isolates, and found no isolate with both the MRR1 and ERG11 gene mutation [28]. In most cases, phenotypes of resistance developed due to a combination of mechanisms, so the whole genome sequencing will be included in subsequent investigation. This case corroborates that the resistant C. parapsilosis isolates can emerge in the setting of complicated infections and the extensive use of antifungal agents. Patient 1 received fluconazole treatment for more than 3 months. However, treatment was not instituted for the first candidemia and when fluconazole treatment was commenced it was initially at a lower dose because of chronic renal failure, and on the basis of sputum microscopy. In the previous studies, suboptimal fluconazole dosing has leaded to the development of resistance in Candida species [6, 29]. In addition, itraconazole was used for 2 weeks, when it is not recommended for invasive candidiasis [30]. This highlights the need for standardization of antifungal treatment, in terms of drug selection, dose and duration [31]. In this case, probable sources of the persistent candidemia were the intravenous hemodialysis catheter and the synthetic vascular graft. Vascular catheters have been regarded as the source in more than 50 % of cases of C. parapsilosis candidemia and prompt removal of the catheter is recommended [32]. Conclusions This report described a case where fluconazole resistant C. parapsilosis emerged during prolonged antifungal treatment, with associated MDR1 overexpression, which was related to a MRR1 mutation (T2957C). Resistant C. parapsilosis has the potential to complicate the management of candidemia in vulnerable patient groups. This case illustrates the need for effective antifungal treatment, source control in the treatment of infection diseases. Consent Written informed consent was obtained from the patient for publication of this Case report. copy of the written consent is available for review by the Editor of this journal. Competing interests The authors declare that they have no competing interests. uthors contributions LZ, MX, FK and YCX conceived and designed the experiments; LZ, HW and XF performed the experiment, contributed to the acquisition, analysis and interpretation of data. LZ, MW and FK wrote the manuscript. ll authors read and approved the final manuscript. cknowledgments This present study was supported by Innovation Fund of Peking Union Medical College ( ) and Research Special Fund for Public Welfare Industry of Health ( ). This study was selected for oral presentation at the 12 th SM Conference on Candida and Candidiasis in 2014, New Orleans, merica. uthor details 1 Department of Clinical Laboratory, Peking Union Medical College Hospital, Chinese cademy of Medical Sciences, Beijing , China. 2 Graduate School, Peking Union Medical College, Chinese cademy of Medical Sciences, Beijing , China. 3 Centre for Infectious Diseases and Microbiology Laboratory Services, ICPMR Pathology West, University of Sydney, Westmead Hospital, Darcy Road, Westmead, Sydney, NSW 2145, ustralia. Received: 13 December 2014 ccepted: 4 ugust 2015 References 1. Trofa D, Gacser, Nosanchuk JD. Candida parapsilosis, an emerging fungal pathogen. Clin Microbiol Rev. 2008;21(4): van sbeck EC, Clemons KV, Stevens D. Candida parapsilosis: a review of its epidemiology, pathogenesis, clinical aspects, typing and antimicrobial susceptibility. Crit Rev Microbiol. 2009;35(4): Barchiesi F, Caggiano G, Falconi DFL, Montagna MT, Barbuti S, Scalise G. Outbreak of fungemia due to Candida parapsilosis in a pediatric oncology unit. Diagn Microbiol Infect Dis. 2004;49(4): Hernandez-Castro R, rroyo-escalante S, Carrillo-Casas EM, Moncada-Barron D, lvarez-verona E, Hernandez-Delgado L, et al. Outbreak of Candida parapsilosis in a neonatal intensive care unit: a health care workers source. Eur J Pediatr. 2010;169(7): Wang H, Xiao M, Chen SC, Kong F, Sun ZY, Liao K, et al. In vitro susceptibilities of yeast species to fluconazole and voriconazole as
7 Zhang et al. BMC Infectious Diseases (2015) 15:340 Page 7 of 7 determined by the 2010 National China Hospital Invasive Fungal Surveillance Net (CHIF-NET) study. J Clin Microbiol. 2012;50(12): ndes D, Forrest, Lepak, Nett J, Marchillo K, Lincoln L. Impact of antimicrobial dosing regimen on evolution of drug resistance in vivo: fluconazole and Candida albicans. ntimicrob gents Chemother. 2006;50(7): Barchiesi F, Calabrese D, Sanglard D, Falconi DFL, Caselli F, Giannini D, et al. Experimental induction of fluconazole resistance in Candida tropicalis TCC 750. ntimicrob gents Chemother. 2000;44(6): Wingard JR, Merz WG, Rinaldi MG, Johnson TR, Karp JE, Saral R. Increase in Candida krusei infection among patients with bone marrow transplantation and neutropenia treated prophylactically with fluconazole. N Engl J Med. 1991;325(18): Wingard JR, Merz WG, Rinaldi MG, Miller CB, Karp JE, Saral R. ssociation of Torulopsis glabrata infections with fluconazole prophylaxis in neutropenic bone marrow transplant patients. ntimicrob gents Chemother. 1993;37(9): Moudgal V, Little T, Boikov D, Vazquez J. Multiechinocandin- and multiazole-resistant Candida parapsilosis isolates serially obtained during therapy for prosthetic valve endocarditis. ntimicrob gents Chemother. 2005;49(2): Silva P, Miranda IM, Guida, Synnott J, Rocha R, Silva R, et al. Transcriptional profiling of azole-resistant Candida parapsilosis strains. ntimicrob gents Chemother. 2011;55(7): Sanglard D, Odds FC. Resistance of Candida species to antifungal agents: molecular mechanisms and clinical consequences. Lancet Infect Dis. 2002;2(2): Morschhauser J. The genetic basis of fluconazole resistance development in Candida albicans. Biochim Biophys cta. 2002;1587(2 3): Pfaller M. ntifungal drug resistance: mechanisms, epidemiology, and consequences for treatment. m J Med. 2012;125(1 Suppl):S Morschhauser J, Barker KS, Liu TT, BlaB-Warmuth J, Homayouni R, Rogers PD. The transcription factor Mrr1p controls expression of the MDR1 efflux pump and mediates multidrug resistance in Candida albicans. PLoS Pathog. 2007;3(11), e Dunkel N, Blass J, Rogers PD, Morschhauser J. Mutations in the multi-drug resistance regulator MRR1, followed by loss of heterozygosity, are the main cause of MDR1 overexpression in fluconazole-resistant Candida albicans strains. Mol Microbiol. 2008;69(4): Schubert S, Rogers PD, Morschhauser J. Gain-of-function mutations in the transcription factor MRR1 are responsible for overexpression of the MDR1 efflux pump in fluconazole-resistant Candida dubliniensis strains. ntimicrob gents Chemother. 2008;52(12): Coste T, Karababa M, Ischer F, Bille J, Sanglard D. TC1, transcriptional activator of CDR genes, is a new transcription factor involved in the regulation of Candida albicans BC transporters CDR1 and CDR2. Eukaryot Cell. 2004;3(6): Coste, Turner V, Ischer F, Morschhauser J, Forche, Selmecki, et al. mutation in Tac1p, a transcription factor regulating CDR1 and CDR2, is coupled with loss of heterozygosity at chromosome 5 to mediate antifungal resistance in Candida albicans. Genetics. 2006;172(4): Silver PM, Oliver BG, White TC. Role of Candida albicans transcription factor Upc2p in drug resistance and sterol metabolism. Eukaryot Cell. 2004;3(6): Pfaller M, Chaturvedi V, Diekema DJ, Ghannoum M, Holliday NM, Killian SB, et al. Clinical Evaluation of the Sensititre YeastOne Colorimetric ntifungal Panel for ntifungal Susceptibility Testing of the Echinocandins nidulafungin, Caspofungin, and Micafungin. J Clin Microbiol. 2008;46(7): Clinical and Laboratory Standards Institute. Reference Method for Broth Dilution ntifungal Susceptibility Testing of Yeasts; Fourth Informational Supplement M27-S4. CLSI, wayne, P, US, Sabino R, Sampaio P, Rosado L, Stevens D, Clemons KV, Pais C. New polymorphic microsatellite markers able to distinguish among Candida parapsilosis sensu stricto isolates. J Clin Microbiol. 2010;48(5): Berkow E, Manigaba K, Wanamaker E, Barker K, Caudle K, Rogers PD. Molecular Mechanisms of Multidrug Resistance in Candida parapsilosis. Poster. the 12th merican Society for Microbiology (SM) Conference, US, Rossignol T, Logue ME, Reynolds K, Grenon M, Lowndes NF, Butler G. Transcriptional response of Candida parapsilosis following exposure to farnesol. ntimicrob gents Chemother. 2007;51(7): Jiang C, Dong D, Yu B, Cai G, Wang X, Ji Y, et al. Mechanisms of azole resistance in 52 clinical isolates of Candida tropicalis in China. J ntimicrob Chemother. 2013;68(4): Perlin DS. Resistance to echinocandin-class antifungal drugs. Drug Resist Updat. 2007;10(3): Grossman NT, Pham CD, Cleveland, Lockhart SR. Molecular Mechanisms of Fluconazole Resistance in Candida parapsilosis Isolates from a U.S. Surveillance System. ntimicrob gents Chemother. 2015;59(2): Shah DN, Yau R, Lasco TM, Weston J, Salazar M, Palmer HR, et al. Impact of prior inappropriate fluconazole dosing on isolation of fluconazole-nonsusceptible Candida species in hospitalized patients with candidemia. ntimicrob gents Chemother. 2012;56(6): ndes D, Pascual, Marchetti O. ntifungal therapeutic drug monitoring: established and emerging indications. ntimicrob gents Chemother. 2009;53(1): Pappas PG, Rex JH, Sobel JD, Filler SG, Dismukes WE. Guidelines for Treatment of Candidiasis. Clin Infect Dis. 2004;38(2): Pfaller M, Diekema DJ, Gibbs DL, Newell V, Ng KP, Colombo, et al. Geographic and temporal trends in isolation and antifungal susceptibility of Candida parapsilosis: a global assessment from the RTEMIS DISK ntifungal Surveillance Program, 2001 to J Clin Microbiol. 2008;46(3): Submit your next manuscript to BioMed Central and take full advantage of: Convenient online submission Thorough peer review No space constraints or color figure charges Immediate publication on acceptance Inclusion in PubMed, CS, Scopus and Google Scholar Research which is freely available for redistribution Submit your manuscript at
Case. Case. Case. Case. Reference lab AST. Nelesh Govender, NICD 2013/03/08. Candida species: Antifungal susceptibility testing in 2013
Nelesh Govender, NICD 13/3/8 se ndida species: Antifungal susceptibility testing in 13 Nelesh Govender National Institute for Communicable Diseases and University of the Witwatersrand, Johannesburg Elderly
More informationAntifungal Resistance: Focus on Candida species
Antifungal Resistance: Focus on Candida species Peter G. Pappas, MD, FACP Professor of Medicine and Director, MSG Division of Infectious Diseases University of Alabama at Birmingham Birmingham, AL, USA
More informationCut-off Values and Species-Specific Breakpoints 12/19/2016
Welcome to Mayo Medical Laboratories Hot Topics. These presentations provide short discussion of current topics and may be helpful to you in your practice. 1 Laboratories and Professor of Laboratory Medicine
More informationtesting for the daily routine?
What is the role of in vitro antifungal susceptibility testing for the daily routine? ESCMID, Rome 2010 Cornelia Lass-Flörl Medical University Innsbruck Faculty disclosure Invited speaker: Pfizer, Gilead,
More informationESCMID Online Lecture Library. by author
Eric DANNAOUI ESCMID Postgraduate Education Course 20-22 June 2013, Sibiu Antifungal susceptibility testing and detection of resistance: principles and practices Unité de Parasitologie-Mycologie, Laboratoire
More informationApproximately 20% of the responding CLSI membership whose hospitals had greater than 200 beds was performing antifungal testing.
Vol. 28 No. 14 Replaces M27-A2 Vol. 22 No. 15 Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeasts; Approved Standard Third Edition This document addresses the selection and
More informationEmpfindlichkeitstestung bei Pilzen Neuigkeiten? Bericht aus einem EUCAST AFST (yeasts and moulds) Netzwerk-Laboratorium
Empfindlichkeitstestung bei Pilzen Neuigkeiten? Bericht aus einem EUCAST AFST (yeasts and moulds) Netzwerk-Laboratorium EUCAST reloaded 6.0 Follow-up Workshop 23.03.2017 Cornelia Lass-Flörl Division of
More informationCandida biofilm. José Garnacho Montero Hospital Universitario Virgen del Rocío Sevilla. Spain
Candida biofilm José Garnacho Montero Hospital Universitario Virgen del Rocío Sevilla. Spain Introduction Candidemia is frequently associated with the biofilm growth of Candida organisms on medical devices
More informationEXPRESSION PATTERN OF DRUG-RESISTANCE GENES IN CANDIDA ALBICANS AT DIFFERENT FLUCONAZOLE CONCENTRATIONS. A THESIS IN Cell and Molecular Biology
EXPRESSION PATTERN OF DRUG-RESISTANCE GENES IN CANDIDA ALBICANS AT DIFFERENT FLUCONAZOLE CONCENTRATIONS. A THESIS IN Cell and Molecular Biology Presented to the Faculty of the University of Missouri-Kansas
More informationDr. Rukumani Devi Velayuthan Mycology Unit Co-ordinator PPUM
Antifungal sensitivity testing using VITEK 2 Dr. Rukumani Devi Velayuthan Mycology Unit Co-ordinator PPUM VITEK 2 Systems The VITEK 2 System is intended for the automated identification and susceptibility
More informationPhenotypic characterization of Candida isolates obtained from non respiratory clinical specimens from superspeciality tertiary care center in Mumbai
Original article: Phenotypic characterization of Candida isolates obtained from non respiratory clinical specimens from superspeciality tertiary care center in Mumbai Dr. Dhruv K. Mamtora, Dr Sanjith Saseedharan,
More informationChapter 2 Antifungal Susceptibility Testing: Clinical Laboratory and Standards Institute (CLSI) Methods
Chapter 2 Antifungal Susceptibility Testing: Clinical Laboratory and Standards Institute (CLSI) Methods Annette W. Fothergill Abstract Antifungal susceptibility testing has become an important tool for
More informationVoriconazole and Aspergillus spp. Rationale for the EUCAST clinical breakpoints, version May 2012
Voriconazole and Aspergillus spp. Rationale for the EUCAST clinical breakpoints, version 1.0 20 May 2012 Foreword EUCAST The European Committee on Antimicrobial Susceptibility Testing (EUCAST) is organised
More informationReceived 14 November 2010/Returned for modification 27 December 2010/Accepted 13 March 2011
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, June 2011, p. 3031 3035 Vol. 55, No. 6 0066-4804/11/$12.00 doi:10.1128/aac.01569-10 Copyright 2011, American Society for Microbiology. All Rights Reserved. In Vitro
More informationFLUCONAZOLE SUSCEPTIBILITY TESTING OF CANDIDA SPECIES BY DISC DIFFUSION AND AGAR DILUTION METHOD
FLUCONAZOLE SUSCEPTIBILITY TESTING OF CANDIDA SPECIES BY DISC DIFFUSION AND AGAR DILUTION METHOD Supriya Tankhiwale, Sunita Gajbhiye, Rajaram Powar 1. Associate Professor, Department of Microbiology, Government
More informationAntifungal PK/PD Made Simple. David Andes, MD University of Wisconsin
Antifungal PK/PD Made Simple David Andes, MD University of Wisconsin PK/PD Concept Serum Drug Concentration Peak:MIC AUC:MIC Ratio Time Above MIC MIC Time Hypothesis and Concept There is an optimal drug
More informationTranscriptional regulation of IFN-l genes in Hepatitis C virus-infected hepatocytes via IRF-3 IRF-7 NF- B complex
POSTER PRESENTATION Transcriptional regulation of IFN-l genes in Hepatitis C virus-infected hepatocytes via IRF-3 IRF-7 NF- B complex Hai-Chon Lee *, Je-In Youn, Kyungwha Lee, Hwanyul Yong, Seung-Yong
More informationGentian Violet Exhibits Activity against Biofilms formed by Oral Candida isolates Obtained from HIV-infected Patients
AAC Accepts, published online ahead of print on 28 March 2011 Antimicrob. Agents Chemother. doi:10.1128/aac.01601-10 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions.
More informationInt.J.Curr.Microbiol.App.Sci (2018) 7(8):
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 7 Number 08 (2018) Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2018.708.276
More informationANTIFUNGAL SUSCEPTIBILITY TESTING
MYCOLOGY QAP UPDATE ANTIFUNGAL SUSCEPTIBILITY TESTING Sarah Kidd: National Mycology Reference Centre, SA Pathology Deb Walker, Elizabeth Haremza, Arthur Morris: RCPAQAP sarah.kidd@sa.gov.au @thefunguskidd
More informationMinimum Inhibitory Concentration (MIC) Assay for Antifungal Drugs
Minimum Inhibitory Concentration (MIC) Assay for Antifungal Drugs Jinglin L. Xie 1, Sheena D. Singh-Babak 2 and Leah E. Cowen 2* 1 Molecular Genetics, University of Toronto, Toronto, Canada; 2 Department
More informationMICROBIOLOGY AND INVASIVE FUNGAL INFECTION. Javier Pemán, MD, PhD. Mycology Unit, Hospital Univ. La Fe Valencia (Spain)
MICROBIOLOGY Mycology Unit, Hospital Univ. La Fe Valencia (Spain) AND INVASIVE FUNGAL INFECTION Javier Pemán, MD, PhD What tools we can offer to optimize antifungal treatment? From lab Bench to Bedside:
More informationNew Hope For Serious Infections
New Hope For Serious Infections Forward-Looking Statements Statements contained in this press release regarding matters that are not historical facts are "forward-looking statements" within the meaning
More informationACCEPTED. Yanjun Li 1. M. Hong Nguyen 2,3,4. Harmut Derendorf 1. Shaoji Cheng 2. *Cornelius J. Clancy 2,3
AAC Accepts, published online ahead of print on 21 May 2007 Antimicrob. Agents Chemother. doi:10.1128/aac.00308-07 Copyright 2007, American Society for Microbiology and/or the Listed Authors/Institutions.
More informationACCEPTED. Species-Specific Differences in the Susceptibility of Biofilms Formed by. University Medical School, Gwangju, Korea
AAC Accepts, published online ahead of print on February 00 Antimicrob. Agents Chemother. doi:./aac.01-0 Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights
More informationDisk diffusion test and E-test with enriched Mueller-Hinton agar for determining susceptibility of Candida species to voriconazole and fluconazole
J Microbiol Immunol Infect. 2009;42:148-153 Disk diffusion test and E-test with enriched Mueller-Hinton agar for determining susceptibility of Candida species to voriconazole and fluconazole Sai-Cheong
More informationReceived 5 September 2006/Returned for modification 17 October 2006/Accepted 21 December 2006
JOURNAL OF CLINICAL MICROBIOLOGY, Mar. 2007, p. 698 706 Vol. 45, No. 3 0095-1137/07/$08.00 0 doi:10.1128/jcm.01840-06 Copyright 2007, American Society for Microbiology. All Rights Reserved. Comparative
More informationCencountered problem in hospitalised
Utility of Chrom Medium for Antifungal Susceptibility Testing of Candida Species Against Fluconazole and Voriconazole in Resource Constrained Settings Shashir Wanjare, Rupali Suryawanshi, Arati Bhadade,
More informationEVOLUTION OF DRUG RESISTANCE IN CANDIDA ALBICANS
Annu. Rev. Microbiol. 2002. 56:139 65 doi: 10.1146/annurev.micro.56.012302.160907 Copyright c 2002 by Annual Reviews. All rights reserved First published online as a Review in Advance on May 16, 2002 EVOLUTION
More informationUtility of the Germ Tube Test for the Identification of Candida albicans Directly from Positive Blood Culture Bottles. ACCEPTED
JCM Accepts, published online ahead of print on August 00 J. Clin. Microbiol. doi:./jcm.01-0 Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationTerapia delle Infezioni Fungine. Claudio Viscoli Malattie Infettive Università di Genova e IRCCS an Martino-IST
Terapia delle Infezioni Fungine Claudio Viscoli Malattie Infettive Università di Genova e IRCCS an Martino-IST Invasive candidiasis IDSA guidelines 2016 Treatment for candidemia in non-neutropenic patients
More informationNew Hope For Serious Infections
New Hope For Serious Infections Forward-Looking Statements These slides and the accompanying oral presentation (the Presentation ) contain forward-looking statements within the meaning of the Private Securities
More informationNeji et al. Journal of Biomedical Science (2017) 24:67 DOI /s
Neji et al. Journal of Biomedical Science (27) 24:67 DOI.86/s2929-7-376-2 RESEARCH Virulence factors, antifungal susceptibility and molecular mechanisms of azole resistance among Candida parapsilosis complex
More informationMycology Diagnostics
Mycology Diagnostics Catriona Halliday Clinical Mycology Reference Laboratory, NSW Health Pathology - CIDMLS, Westmead Hospital www.wslhd.health.nsw.gov.au/cidm-ph Diagnosis of IFD IFDs associated with
More informationFollow this and additional works at: Part of the Medicinal and Pharmaceutical Chemistry Commons
Butler University Digital Commons @ Butler University Undergraduate Honors Thesis Collection Undergraduate Scholarship 5-9-2015 The Impact of Peptide Nucleic Acid Fluorescence In Situ Hybridization (PNA
More informationAntifungal Suceptibility Testing : Guidelines to Practical approach. Dr Deepti Rawat
Antifungal Suceptibility Testing : Guidelines to Practical approach Dr Deepti Rawat Introduction Increase incidence of fungal infections Increase in immunosuppressive states Increasing evidence of invasive
More informationIdentification of Candida inconspicua clinical isolates and testing of fluconazole, amphotericin B, flucytosine and caspofungin susceptibility
Identification of Candida inconspicua clinical isolates and testing of fluconazole, amphotericin B, flucytosine and caspofungin susceptibility Ph.D. theses László Majoros Department of Medical Microbiology,
More informationRole of matrix β-1,3 glucan in antifungal resistance of non-albicans Candida biofilms
AAC Accepts, published online ahead of print on 14 January 2013 Antimicrob. Agents Chemother. doi:10.1128/aac.02378-12 Copyright 2013, American Society for Microbiology. All Rights Reserved. 1 Role of
More informationNucleotide substitutions in the Candida albicans ERG11 gene of azole-susceptible and azole-resistant clinical isolates
Regular paper Vol. 60, No 4/2013 547 552 on-line at: www.actabp.pl Nucleotide substitutions in the Candida albicans ERG11 gene of azole-susceptible and azole-resistant clinical isolates Joanna Katarzyna
More informationHours: Comparison of the Rapid Susceptibility Assay with the Clinical and Laboratory. Standards Institute s Microbroth Dilution Assay AFFILIATION
JCM Accepts, published online ahead of print on 21 October 2009 J. Clin. Microbiol. doi:10.1128/jcm.01306-09 Copyright 2009, American Society for Microbiology and/or the Listed Authors/Institutions. All
More informationLauren A. Darling1#, Ann M. Evans1, Kathleen A. Stellrecht1,2, Seela M. Nattanmai1,
JCM Accepted Manuscript Posted Online 20 September 2017 J. Clin. Microbiol. doi:10.1128/jcm.01185-17 Copyright 2017 American Society for Microbiology. All Rights Reserved. 1 JCM Letter to the Editor Submission
More informationQuantification of CDR1 Gene Expression in Fluconazole Resistant Candida Glabrata Strains Using Real-time PCR
Iran J Public Health, Vol. 46, No.8, Aug 2017, pp.1118-1122 Original Article Quantification of CDR1 Gene Expression in Fluconazole Resistant Candida Glabrata Strains Using Real-time PCR Shadi SHAHROKHI¹,
More informationfor Antifungal Susceptibility Testing of Yeast Isolates
JOURNAL OF CLINICAL MICROBIOLOGY, Aug. 1994, p. 1992-1996 0095-1137/94/$00+0 Copyright C 1994, American Society for Microbiology Vol., No. 8 Evaluation of a Novel Colorimetric Broth Microdilution Method
More informationfor Antifungal Susceptibility Testing of Yeast Isolates
JOURNAL OF CLINICAL MICROBIOLOGY, Aug. 1994, p. 1992-1996 0095-1137/94/$00+0 Copyright C 1994, American Society for Microbiology Vol., No. 8 Evaluation of a Novel Colorimetric Broth Microdilution Method
More informationfor Antifungal Susceptibility Testing of Yeast Isolates
JOURNAL OF CLINICAL MICROBIOLOGY, Aug. 1994, p. 1992-1996 0095-1137/94/$00+0 Copyright C 1994, American Society for Microbiology Vol., No. 8 Evaluation of a Novel Colorimetric Broth Microdilution Method
More informationOptimizing a Candida Biofilm Microtiter Plate Model for Measurement of Antifungal Susceptibility by Tetrazolium Salt Assay
JOURNAL OF CLINICAL MICROBIOLOGY, Apr. 2011, p. 1426 1433 Vol. 49, No. 4 0095-1137/11/$12.00 doi:10.1128/jcm.02273-10 Copyright 2011, American Society for Microbiology. All Rights Reserved. Optimizing
More informationECCMID SCY-078 Scientific Data Presentation Conference Call
A New Path for Antifungal Treatments ECCMID SCY-078 Scientific Data Presentation Conference Call April 25, 2017 4:05pm ET Forward-Looking Statements Certain statements regarding SCYNEXIS, Inc. (the Company
More informationCandida species remain the most common cause of invasive fungal infections, with. crossm
PHARMACOLOGY crossm SCY-078 Is Fungicidal against Candida Species in Time-Kill Studies Bernard Scorneaux, a David Angulo, a Katyna Borroto-Esoda, a Mahmoud Ghannoum, b Michael Peel, a Stephen Wring a Scynexis,
More informationWhat have we learnt from clinical trials in invasive candidiasis?
What have we learnt from clinical trials in invasive candidiasis? Eva Mª Roselló Micology Unit Microbiology Department Vall d Hebron Hospital Barcelona Epidemiology Candida spp: most common cause of invasive
More informationCandida haemulonii species complex: identification and antifungal susceptibility profiles of
JCM Accepted Manuscript Posted Online 17 August 2016 J. Clin. Microbiol. doi:10.1128/jcm.01492-16 Copyright 2016, American Society for Microbiology. All Rights Reserved. 1 2 Candida haemulonii species
More information2111: ALL Post-HCT. Add/ Remove/ Modify. Manual Section. Date. Description. Comprehensive Disease- Specific Manuals
2111: ALL Post-HCT The Acute Lymphoblastic Leukemia Post-HCT Data Form is one of the Comprehensive Report Forms. This form captures ALL-specific post-hct data such as: planned treatments post-hct, the
More informationResistance Patterns and Clinical Significance of Candida Colonization and Infection in Combat- Related Injured Patients From Iraq and Afghanistan
MAJOR ARTICLE Resistance Patterns and Clinical Significance of Candida Colonization and Infection in Combat- Related Injured Patients From Iraq and Afghanistan Dana M. Blyth, 1 Katrin Mende, 1,2,3 Amy
More informationResearch of Mrr1, Cap1 and MDR1 in Candida albicans resistant to azole medications
EXPERIMENTAL AND THERAPEUTIC MEDICINE 15: 1217-1224, 2018 Research of Mrr1, Cap1 and MDR1 in Candida albicans resistant to azole medications WENLI FENG *, JING YANG *, LU YANG, QING LI, XIN ZHU, ZHIQIN
More informationRapid identification of Candida glabrata in Candida bloodstream infections
Journal of Medical Microbiology (2007), 56, 1639 1643 DOI 10.1099/jmm.0.47406-0 Rapid identification of Candida glabrata in Candida bloodstream infections Nicholas Foster, Charlotte Symes, Richard Barton
More informationSHORT THESIS FOR DEGREE OF DOCTOR OF PHILOSOPHY (Ph.D.)
SHORT THESIS FOR DEGREE OF DOCTOR OF PHILOSOPHY (Ph.D.) The paradoxical growth of Candida albicans, C. dubliniensis, C. krusei and C. tropicalis strains in the presence of high concentration caspofungin
More informationMultilocus sequence typing of sequential Candida albicans isolates from patients with persistent or recurrent fungemia
Medical Mycology August 2010, 48, 757 762 Multilocus sequence typing of sequential Candida albicans isolates from patients with persistent or recurrent fungemia DANIEL A. DA MATTA*, ANALY S. MELO*, THAÍS
More informationT-2307 Shows Efficacy in a Murine Model of Candida glabrata Infection despite In Vitro Trailing Growth Phenomena
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Sept. 2010, p. 3630 3634 Vol. 54, No. 9 0066-4804/10/$12.00 doi:10.1128/aac.00355-10 Copyright 2010, American Society for Microbiology. All Rights Reserved. T-2307
More informationInfection Prevention and Control Candida auris Board of Directors Oct 17. Dr C Bates
Infection Prevention and Control Candida auris Board of Directors Oct 17 Dr C Bates Candida auris is a fungus Fungi Fungi are more complicated than virus and bacteria and nearer to mammalian cells can
More informationAn In Vitro Study of Sequential Fluconazole/Caspofungin Treatment. against Candida albicans Biofilms
AAC Accepts, published online ahead of print on 11 November 2013 Antimicrob. Agents Chemother. doi:10.1128/aac.01745-13 Copyright 2013, American Society for Microbiology. All Rights Reserved. 1 2 3 4 5
More informationPrevalence of albicans and non-albicans candiduria in a Malaysian medical centre
1375 ORIGINAL ARTICLE Prevalence of albicans and non-albicans candiduria in a Malaysian medical centre Chuan Hun Ding, Asrul Abdul Wahab, Najihan Abdul Samat Muttaqillah, Mohd Nizam Tzar Abstract Objective:
More informationThe genus Candida is composed of an extremely heterogeneous. Fungal Biofilms and Drug Resistance
Fungal Biofilms and Drug Resistance Mary Ann Jabra-Rizk,* William A. Falkler,* and Timothy F. Meiller* Candida species, including the novel opportunistic pathogen Candida dubliniensis, are now emerging
More informationAGATCCACTAGTTCTAGAGCTCAACTTGTTGGTTTGTCTTT TGTCCAAAAACGGTTTCCAG TGCCTTTCTGTTCGATTGAT
1 Table S1. PCR primers Primer Use Sequence (5 3 ) JC17 SAT1 flipper GGCCCCCCCTCGAGGAAGTT JC18 SAT1 flipper GCTCTAGAACTAGTGGATCT JC57 5 NCR of CNA1 AATGATGGAGTTTATGGGAA JC58 5 NCR of CNA1 AACTTCCTCGAGGGGGGGCCGAAAAAAAAAAAGGGGGGGG
More informationVulvovaginal Candidiasis due to non albicans Candida: its species distribution and antifungal susceptibility profile
ISSN: 2319-7706 Volume 2 Number 12 (2013) pp. 323-328 http://www.ijcmas.com Original Research Article Vulvovaginal Candidiasis due to non albicans Candida: its species distribution and antifungal susceptibility
More informationActivity of Isavuconazole and Other Azoles Against Candida Clinical Isolates and. Yeast Model Systems with Known Azole Resistance Mechanisms
AAC Accepted Manuscript Posted Online 19 October 2015 Antimicrob. Agents Chemother. doi:10.1128/aac.02157-15 Copyright 2015, American Society for Microbiology. All Rights Reserved. 1 1 2 Activity of Isavuconazole
More informationMontagna et al. BMC Microbiology (2015) 15:106 DOI /s
Montagna et al. BMC Microbiology (2015) 15:106 DOI 10.1186/s12866-015-0442-4 RESEARCH ARTICLE Open Access Susceptibility to echinocandins of Candida spp. strains isolated in Italy assessed by European
More informationPharmacodynamic Target Evaluation of a Novel Oral Glucan Synthase Inhibitor, SCY-078 (MK-3118), using an In Vivo Murine Invasive Candidiasis Model
AAC Accepts, published online ahead of print on 15 December 2014 Antimicrob. Agents Chemother. doi:10.1128/aac.04445-14 Copyright 2014, American Society for Microbiology. All Rights Reserved. 1 2 Pharmacodynamic
More informationACCEPTED. In vitro interactions of micafungin with amphotericin B against. clinical isolates of Candida spp.
AAC Accepts, published online ahead of print on January 00 Antimicrob. Agents Chemother. doi:./aac.0-0 Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights
More informationRESEARCH ARTICLE Ghezzi et al., Journal of Medical Microbiology 2017;66: DOI /jmm
RESEARCH ARTICLE Ghezzi et al., Journal of Medical Microbiology 217;66:99 998 DOI 1.199/jmm..55 Candidaemia in a tertiary care academic hospital in Italy. The impact of C. parapsilosis complex on the species
More informationEvaluation of Candida albicans Diagnosis by using conventional PCR. Abstract
Evaluation of Candida albicans Diagnosis by using conventional PCR Nihad A.M. Al-Rashedi Biology Dep.- Science College, Muthanna University Abstract This study involved evaluate conventional polymerase
More informationCorrelation of MIC with Outcome for Candida Species Tested against Voriconazole: Analysis and Proposal for Interpretive Breakpoints
JOURNAL OF CLINICAL MICROBIOLOGY, Mar. 2006, p. 819 826 Vol. 44, No. 3 0095-1137/06/$08.00 0 doi:10.1128/jcm.44.3.819 826.2006 Copyright 2006, American Society for Microbiology. All Rights Reserved. Correlation
More informationInvestigation of Association between Slime Production by Candida Spp and Susceptibility to Fluconazole and Voriconazole
Original Research Article Tropical Journal of Pharmaceutical Research October 2013; 12 (5): 821-825 ISSN: 1596-5996 (print); 1596-9827 (electronic) Pharmacotherapy Group, Faculty of Pharmacy, University
More informationAlle Echinocandine sind gleich?
Alle Echinocandine sind gleich? Giftiger Donnerstag Hospital Velden, 1.06.2017 Cornelia Lass-Flörl Division of Hygiene and Medical Microbiology Innsbruck Medical University Indications Caspofungin - Candicas
More informationAuthor's response to reviews. Title: Candidiasis caused by Candida kefyr in a neonate. Authors:
Author's response to reviews Title: Candidiasis caused by Candida kefyr in a neonate. Authors: Stefan Weichert (stefan.weichert@medma.uni-heidelberg.de) Konrad Reinshagen (konrad.reinshagen@umm.de) Katrin
More informationReceived 5 June 2009/Returned for modification 31 July 2009/Accepted 23 October 2009
JOURNAL OF CLINICAL MICROBIOLOGY, Jan. 2010, p. 154 161 Vol. 48, No. 1 0095-1137/10/$12.00 doi:10.1128/jcm.01096-09 Copyright 2010, American Society for Microbiology. All Rights Reserved. Antifungal Susceptibility
More informationCharacterization of Candida parapsilosis complex strains isolated from invasive fungal infections
DOI 10.1007/s10096-011-1242-x ARTICLE Characterization of Candida parapsilosis complex strains isolated from invasive fungal infections E. orghi & R. Sciota & R. Iatta & C. iassoni & M. T. Montagna & G.
More informationBiofilm Protocol Optimization For Pseudomonas aeruginosa. Introduction. Materials and Methods. Culture Media, Incubation Time, and Biofilm Measurement
Biofilm Protocol Optimization For Pseudomonas aeruginosa Culture Media, Incubation Time, and Biofilm Measurement Introduction In addition to the conventional arsenal of antibiotic resistance mechanisms
More informationPreliminary Evaluation of a Semisolid Agar Antifungal Susceptibility Test for Yeasts and Molds
JOURNAL OF CLINICAL MICROBIOLOGY, Feb. 2000, p. 537 541 Vol. 38, No. 2 0095-1137/00/$04.00 0 Copyright 2000, American Society for Microbiology. All Rights Reserved. Preliminary Evaluation of a Semisolid
More informationEUCAST DEFINITIVE DOCUMENT
EUCAST DEFINITIVE DOCUMENT 10.1111/j.1469-0691.2007.01935.x EUCAST Definitive Document EDef 7.1: method for the determination of broth dilution MICs of antifungal agents for fermentative yeasts Subcommittee
More informationCandida dubliniensis. genesig Standard Kit. Cytosine deaminase (FCA1) gene. 150 tests. Primerdesign Ltd. For general laboratory and research use only
TM Primerdesign Ltd Candida dubliniensis Cytosine deaminase (FCA1) gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Candida dubliniensis Candida dubliniensis
More informationDetection of azole resistance and ERG11 point mutations in Candida albicans isolates from tertiary hospitals in the Philippines
Current Research in Environmental & Applied Mycology 8(3): 298 305 (2018) ISSN 2229-2225 www.creamjournal.org Article Doi 10.5943/cream/8/3/1 Copyright Beijing Academy of Agriculture and Forestry Sciences
More informationNew antifungal strategies
New and upcoming antifungals New antifungal strategies Patricia Muñoz, MD. Ph.D. (pmunoz@hggm.es) Hospital General Universitario Gregorio Marañón Universidad Complutense de Madrid Monday, March 2nd 2015
More informationGenetic Basis of Candida Biofilm Resistance Due to Drug-Sequestering Matrix Glucan
BRIEF REPORT Genetic Basis of Candida Biofilm Resistance Due to Drug-Sequestering Matrix Glucan Jeniel E. Nett, 1,3 Hiram Sanchez, 1 Michael T Cain, 1 and David R. Andes 1,2 Departments of 1 Medicine,
More informationCaspofungin in Combination with Amphotericin B against Candida parapsilosis
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Mar. 2007, p. 941 945 Vol. 51, No. 3 0066-4804/07/$08.00 0 doi:10.1128/aac.00880-06 Copyright 2007, American Society for Microbiology. All Rights Reserved. Caspofungin
More informationInfluence of Test Conditions on Antifungal Time-Kill Curve Results: Proposal for Standardized Methods
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, May 1998, p. 1207 1212 Vol. 42, No. 5 0066-4804/98/$04.00 0 Copyright 1998, American Society for Microbiology Influence of Test Conditions on Antifungal Time-Kill
More informationDifferentiated Antifungal Potentially Meeting A Clear Medical Need: Initiating BUY/$14 TP
SCYNEXIS, Inc November 17, 2016 BUY (SCYX, $3.53) Differentiated Antifungal Potentially Meeting A Clear Medical Need: Initiating BUY/$14 TP Jonathan Aschoff, Ph.D. 212.417.8277 jaschoff@opnresearch.com
More informationComparison of four reading methods of broth microdilution based on the Clinical and Laboratory Standards Institute M27-A3 method for Candida spp.
Oct. 2012 THE JAPANESE JOURNAL OF ANTIBIOTICS 65 5 335 45 Comparison of four reading methods of broth microdilution based on the Clinical and Laboratory Standards Institute M27-A3 method for Candida spp.
More informationInfluence of Glucose Supplementation and Inoculum Size on Growth Kinetics and Antifungal Susceptibility Testing of Candida spp.
JOURNAL OF CLINICAL MICROBIOLOGY, Feb. 2001, p. 525 532 Vol. 39, No. 2 0095-1137/01/$04.00 0 DOI: 10.1128/JCM.39.2.525 532.2001 Copyright 2001, American Society for Microbiology. All Rights Reserved. Influence
More informationSusceptibility testing in Aspergillus species complex
REVIEW 10.1111/1469-0691.12514 Susceptibility testing in Aspergillus species complex C. Lass-Fl orl Division of Hygiene and Medical Microbiology, Innsbruck Medical University, Innsbruck, Austria Abstract
More informationIn vitro and In vivo antifungal activity of the methanol extract from Gracilaria changii
ISPUB.COM The Internet Journal of Pharmacology Volume 6 Number 1 In vitro and In vivo antifungal activity of the methanol extract from Gracilaria changii S Sasidharan, I Darah, K Jain Citation S Sasidharan,
More informationMulticenter Evaluation of Four Methods of Yeast Inoculum Preparation
JOURNAL OF CLINICAL MICROBIOLOGY, Aug. 1988, p. 1437-1441 0095-1137/88/081437-05$02.00/0 Copyright C 1988, American Society for Microbiology Vol. 26, No. 8 Multicenter Evaluation of Four Methods of Yeast
More informationAPX001 is effective against echinocandin and multidrug resistant Candida isolates
APX001 is effective against echinocandin and multidrug resistant Candida isolates David S. Perlin Executive Director and Professor Public Health Research Institute New Jersey Medical School, Rutgers University
More informationTHIAZOLE DERIVATIVES WITH ANTIFUNGAL ACTIVITY AGAINST CANDIDA SPECIES
STUDIA UBB CHEMIA, LXI, 3, Tom I, 2016 (p. 117-123) (RECOMMENDED CITATION) Dedicated to Professor Luminița Silaghi-Dumitrescu on the occasion of her 65 th anniversary THIAZOLE DERIVATIVES WITH ANTIFUNGAL
More informationComparison between Disk Diffusion and Microdilution Methods for Determining Susceptibility of Clinical Fungal Isolates to Caspofungin
JOURNAL OF CLINICAL MICROBIOLOGY, Nov. 2007, p. 3529 3533 Vol. 45, No. 11 0095-1137/07/$08.00 0 doi:10.1128/jcm.00826-07 Copyright 2007, American Society for Microbiology. All Rights Reserved. Comparison
More informationUse of Molecular Assays for Resistance Detection
Use of Molecular Assays for Resistance Detection Antimicrobial resistance and susceptibility are complex, and current in vitro methods have been developed to predict a microorganism s response to antibacterial
More informationSupplemental Table 1: Strains used in this study.
Supplemental Table 1: Strains used in this study. Strain Genotype Reference SC5314 Prototroph (4) RM1000 CJC5 CJC25 CJC26 CJC27 CJC28 CJC29 CJC30 CJC31 ura3::λimm434/ura3:: λimm434 his1::hisg/his1::hisg
More informationEvaluation of reference genes for real-time quantitative PCR studies in Candida glabrata following azole treatment
Li et al. BMC Molecular Biology 2012, 13:22 RESEARCH ARTICLE Open Access Evaluation of reference genes for real-time quantitative PCR studies in Candida glabrata following azole treatment Qingdi Quentin
More informationA Combination Approach to Treating Fungal Infections
University of Kentucky UKnowledge Pharmaceutical Sciences Faculty Publications Pharmaceutical Sciences 11-23-2015 A Combination Approach to Treating Fungal Infections Sanjib K. Shrestha University of Kentucky,
More informationGain of Function Mutations in CgPDR1 of Candida glabrata Not Only Mediate Antifungal Resistance but Also Enhance Virulence
Gain of Function Mutations in CgPDR1 of Candida glabrata Not Only Mediate Antifungal Resistance but Also Enhance Virulence Sélène Ferrari 1, Françoise Ischer 1, David Calabrese 1, Brunella Posteraro 2,
More informationPlasma EGFR T790M ctdna status is associated with clinical outcome in. advanced NSCLC patients with acquired EGFR-TKI resistance
Plasma EGFR T790M ctdna status is associated with clinical outcome in advanced NSCLC patients with acquired EGFR-TKI resistance 1# D Zheng; 2# X Ye; 3 MZ Zhang; 2 Y Sun; 1 JY Wang; 1 J Ni; 1 HP Zhang;
More informationIn vitro Activity of Caspofungin against Planktonic and Sessile Candida sp. Cells
Polish Journal of Microbiology 2006, Vol. 55, No 2, 133 137 In vitro Activity of Caspofungin against Planktonic and Sessile Candida sp. Cells ANNA SEREFKO, BEATA CHUDZIK and ANNA MALM Department of Pharmaceutical
More information