Biology: The substrate of bioinformatics

Size: px
Start display at page:

Download "Biology: The substrate of bioinformatics"

Transcription

1 Bi01_1 Unit 01: Biology: The substrate of bioinformatics What is Bioinformatics? Bi01_2 handling of information related to living organisms understood on the basis of molecular biology Nature does it. We try to understand store model, represent simulate predict visualize search it... Bio- Informatics 1

2 Information is a key feature of life Bi01_3 wing of a fly: highly ordered structure, based on information high order - low entropy heap of rubbish: low order - high entropy Information is the key feature of life Bi01_4! wing of a fly: highly ordered structure, based on information heap of rubbish: Living organism: low order - entropy fighting high entropy apparatus 2

3 Living System: Entropy Fighting Apparatus Bi01_5 In order to maintain low entropy, living organisms must expend energy to keep things orderly. The functions of life, therefore, are meant to facilitate the acquisition and orderly expenditure of energy substrates, nutrition (low order) Living System: Entropy Fighting Apparatus Bi01_6 How does it work? (understanding the mechanisms of life) substrates, nutrition (low order) 3

4 The Central Dogma Bi01_7 feedback = gene regulation genome can replicate itself transcription translation GENE Expression DesoxyriboNucleic Acid Living System: Closeups 4 letter alphabeth for nucleotides A...adenine G...guanine C...cytosine T...thymine Bi01_8 4

5 Living System: Closeups Bi01_9 Living System: Closeups Bi01_10 DNA replication 5

6 Living System: Closeups Bi01_11 (1998) replication transcription translation (1998) Transcription from tandemly arranged rrna genes, as visualized in the electron microscope. The pattern of alternating transcribed gene and nontranscribed spacer is readily seen in the lower-magnification view in the upper panel. The large particles at the 5' end of each rrna transcript ( lower panel) are believed to reflect the beginning of ribosome assembly; RNA polymerase molecules are also clearly visible as a series of dots along the DNA. (Upper panel, from V.E. Foe, Cold Spring Harbor Symp. Quant. Biol. 42: , 1978; lower panel, courtesy of Ulrich Scheer.) transcription DNA unwinding and rewinding by RNA polymerase. A moving RNA polymerase molecule is continuously unwinding the DNA helix ahead of the polymerization site while rewinding the two DNA strands behind this site to displace the newly formed RNA chain. A short region of DNA/RNA helix is therefore formed only transiently, and the final RNA product is released as a single-stranded copy of one of the two DNA strands. transcription, start & end Living System: Closeups Bi01_12 replication transcription translation transcription, proceeding from high Lewin resolution (2000) 6

7 transcription, start & end Living System: Closeups Bi01_13 replication transcription translation RNA polymerase Transcription and mrna Processing Bi01_14 from Lewin(2000) 7

8 Transcription,, Start & Stop Bi01_15 (1998) Transcriptions,, Start & Stop, Details Bi01_16 (1998) Start and stop signals for RNA synthesis by a bacterial RNA polymerase. Here, the lower strand of DNA is the template strand, whereas the upper strand corresponds in sequence to the RNA that is made (note the substitution of U in RNA for T in DNA). (A) The polymerase begins transcribing at the start site. Two short sequences (shaded red), about -35 and -10 nucleotides from the start, determine where the polymerase binds; close relatives of these two hexanucleotide sequences, properly spaced from each other, specify the promoter for most E. coli genes. (B) A stop (termination) signal. The E. colirna polymerase stops when it synthesizes a run of U residues (shaded blue) from a complementary run of A residues on the template strand, provided that it has just synthesized a selfcomplementary RNA nucleotide sequence (shaded green), which rapidly forms a hairpin helix that is crucial for stopping transcription. The sequence of nucleotides in the self-complementary region can vary widely. 8

9 Transcription of multiple Genes in different directions Bi01_17 (1998) Gene looks like fragmented files on disk Bi01_18 (1998) 9

10 1 st st Copy whole stuff, then cut out introns (splicing) Bi01_19 (1998) Splicing,, Details Bi01_20 (1998) The RNA splicing mechanism. RNA splicing is catalyzed by a spliceosome formed from the assembly of U1, U2, U5, and U4/U6 snrnps (shown as green circles) plus other components (not shown). After assembly of the spliceosome, the reaction occurs in two steps: in step 1 the branch-point A nucleotide in the intron sequence, which is located close to the 3' splice site, attacks the 5' splice site and cleaves it; the cut 5' end of the intron sequence thereby becomes covalently linked to this A nucleotide, forming the branched nucleotide shown in Figure In step 2 the 3'-OH end of the first exon sequence, which was created in the first step, adds to the beginning of the second exon sequence, cleaving the RNA molecule at the 3' splice site; the two exon sequences are thereby joined to each other and the intron sequence is released as a lariat. The spliceosome complex sediments at 60S, indicating that it is nearly as large as a ribosome. These splicing reactions occur in the nucleus and generate mrna molecules from primary RNA transcripts (mrna precursor molecules). 10

11 Different Roles of RNA Bi01_21 RiboNucleic Acid 4 letter alphabeth Adenine Guanine Cytosine Uracil (instead of T in DNA) acting as a template (source of information) for synthesis of a complementary strand synthesis of a protein (mrna) acting as a catalyst for copying processes of various types: RNA RNA RNA protein) Role 1: RNA as a template for RNA-synthesis Bi01_22 (1994) Relevant aspects: Carrying of information passing on information encoded in nucleotide sequence (1994) 11

12 Exhibitionist RNA: shows its body Bi01_23 (1994) binding preferences A-U & C-G induce bindings within RNA-molecule and a 3D-shape Bi01_24 Role 2: RNA as catalyst (1994) 12

13 Fully advanced role of trna as a catalyst: 3D structures and selective binding capability of trna Bi01_25 selective binding to amino acid information the protein machinery housing where all that (translation) occurs selective binding to mrna Special RNA Structure helps Splicing Bi01_26 from Lewin(2000) 13

14 Roles of RNA in evolution of life (in a nutshell) Bi01_27 An RNA molecule therefore has two special characteristics: it carries information encoded in its nucleotide sequence that it can pass on by the process of replication, and it has a specific folded structure that enables it to interact selectively with other molecules and determines how it will respond to the ambient conditions. These two features - one informational, the other functional - are the two properties essential for evolution. The nucleotide sequence of an RNA molecule is analogous to the genotype - the hereditary information - of an organism. The folded three-dimensional structure is analogous to the phenotype - the expression of the genetic information on which natural selection operates. (1994) Folded RNA scetch Living System: Closeups Bi01_28 replication transcription translation RiboNucleic Acid 4 letter alphabeth Adenine Guanine Cytosine Uracil (instead of T in DNA) 20 letter alphabeth why? 14

15 Bi01_29 Proteins are chains of amino acids (Polypeptides) from Brown (1999) DNA replication RNA transcription PROTEIN translation Bi01_30 Proteine sind Polypeptide Aminosäure DNA Molmasse Polarität der R-Gruppe 89,1apparatus unpolar The entropy fighting 174,4 positiv polar replication Abkürzungen* drei ein Buchstaben Buchstabe Alanin Ala A Arginin Arg R Asparagin Asn N Asparaginsäure Asp D Cystein Cys C Glutaminsäure Glu E Glutamin Gln Q Glycin Gly G Histidin His H Isoleucin Ile I Leucin translation Leu L Lysin Lys K Methionin Met M Phenylalanin Phe F Prolin Pro P Serin Ser S Threonin Thr T Tryptophan Trp W Tyrosin Tyr Y Valin Val V RNA transcription 132,1 133,1 121,2 147,1 146,2 75,1 155,2 131,2 131,2 146,2 149,2 165,2 115,1 105,1 119,1 204,2 181,2 117,2 PROTEIN ungeladen polar negativ polar ungeladen polar negativ polar ungeladen polar ungeladen polar positiv polar unpolar unpolar positiv polar unpolar unpolar unpolar ungeladen polar ungeladen polar unpolar ungeladen polar unpolar * Am häufigsten verwendet man die Standardabkürzungen mit drei Buchstaben. die Abkürzungen aus einem Buchstaben sollten nur dann benutzt werden, wenn man die Aminosäuresequenz eines Polypeptids platzsparend aufschreiben möchte. aa_table1.pdf from Brown (1999) 15

16 Living System: Closeups Bi01_31 replication transcription translation 4 letter alphabeth Genetic Code 20 letter alphabeth Living System: Closeups Bi01_32 energy (solar, nutri The entropy fightin replication DNA RNA PROTEI transcription translation Genetic Code (1994) Copyright W. Schreiner

17 Living System: Closeups Bi01_33 replication transcription translation close up of translation Translation: Overview Living System: Closeups Bi01_34 replication transcription translation 17

18 Living System: Summary Bi01_35 How does it work? Use genome information + ATP-Energy to create ordered Structures (Proteins)! substrates, nutrition (low order) 18

Basic concepts of molecular biology

Basic concepts of molecular biology Basic concepts of molecular biology Gabriella Trucco Email: gabriella.trucco@unimi.it Life The main actors in the chemistry of life are molecules called proteins nucleic acids Proteins: many different

More information

Basic concepts of molecular biology

Basic concepts of molecular biology Basic concepts of molecular biology Gabriella Trucco Email: gabriella.trucco@unimi.it What is life made of? 1665: Robert Hooke discovered that organisms are composed of individual compartments called cells

More information

Bioinformatics. ONE Introduction to Biology. Sami Khuri Department of Computer Science San José State University Biology/CS 123A Fall 2012

Bioinformatics. ONE Introduction to Biology. Sami Khuri Department of Computer Science San José State University Biology/CS 123A Fall 2012 Bioinformatics ONE Introduction to Biology Sami Khuri Department of Computer Science San José State University Biology/CS 123A Fall 2012 Biology Review DNA RNA Proteins Central Dogma Transcription Translation

More information

Algorithms in Bioinformatics ONE Transcription Translation

Algorithms in Bioinformatics ONE Transcription Translation Algorithms in Bioinformatics ONE Transcription Translation Sami Khuri Department of Computer Science San José State University sami.khuri@sjsu.edu Biology Review DNA RNA Proteins Central Dogma Transcription

More information

Unit 1. DNA and the Genome

Unit 1. DNA and the Genome Unit 1 DNA and the Genome Gene Expression Key Area 3 Vocabulary 1: Transcription Translation Phenotype RNA (mrna, trna, rrna) Codon Anticodon Ribosome RNA polymerase RNA splicing Introns Extrons Gene Expression

More information

Molecular Biology. Biology Review ONE. Protein Factory. Genotype to Phenotype. From DNA to Protein. DNA à RNA à Protein. June 2016

Molecular Biology. Biology Review ONE. Protein Factory. Genotype to Phenotype. From DNA to Protein. DNA à RNA à Protein. June 2016 Molecular Biology ONE Sami Khuri Department of Computer Science San José State University Biology Review DNA RNA Proteins Central Dogma Transcription Translation Genotype to Phenotype Protein Factory DNA

More information

Lecture for Wednesday. Dr. Prince BIOL 1408

Lecture for Wednesday. Dr. Prince BIOL 1408 Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that

More information

BIOLOGY. Monday 14 Mar 2016

BIOLOGY. Monday 14 Mar 2016 BIOLOGY Monday 14 Mar 2016 Entry Task List the terms that were mentioned last week in the video. Translation, Transcription, Messenger RNA (mrna), codon, Ribosomal RNA (rrna), Polypeptide, etc. Agenda

More information

CS 4491/CS 7990 SPECIAL TOPICS IN BIOINFORMATICS

CS 4491/CS 7990 SPECIAL TOPICS IN BIOINFORMATICS 1 CS 4491/CS 7990 SPECIAL TOPICS IN BIOINFORMATICS * Some contents are adapted from Dr. Jean Gao at UT Arlington Mingon Kang, PhD Computer Science, Kennesaw State University 2 Genetics The discovery of

More information

Nucleic acid and protein Flow of genetic information

Nucleic acid and protein Flow of genetic information Nucleic acid and protein Flow of genetic information References: Glick, BR and JJ Pasternak, 2003, Molecular Biotechnology: Principles and Applications of Recombinant DNA, ASM Press, Washington DC, pages.

More information

Bi Lecture 3 Loss-of-function (Ch. 4A) Monday, April 8, 13

Bi Lecture 3 Loss-of-function (Ch. 4A) Monday, April 8, 13 Bi190-2013 Lecture 3 Loss-of-function (Ch. 4A) Infer Gene activity from type of allele Loss-of-Function alleles are Gold Standard If organism deficient in gene A fails to accomplish process B, then gene

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by

More information

Problem: The GC base pairs are more stable than AT base pairs. Why? 5. Triple-stranded DNA was first observed in 1957. Scientists later discovered that the formation of triplestranded DNA involves a type

More information

36. The double bonds in naturally-occuring fatty acids are usually isomers. A. cis B. trans C. both cis and trans D. D- E. L-

36. The double bonds in naturally-occuring fatty acids are usually isomers. A. cis B. trans C. both cis and trans D. D- E. L- 36. The double bonds in naturally-occuring fatty acids are usually isomers. A. cis B. trans C. both cis and trans D. D- E. L- 37. The essential fatty acids are A. palmitic acid B. linoleic acid C. linolenic

More information

Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein)

Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein) Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein) I. Review A. Cells copy their DNA (in S phase of Interphase)-Why? Prepare for Cell Division (Mitosis & Cytokinesis) Genes

More information

11 questions for a total of 120 points

11 questions for a total of 120 points Your Name: BYS 201, Final Exam, May 3, 2010 11 questions for a total of 120 points 1. 25 points Take a close look at these tables of amino acids. Some of them are hydrophilic, some hydrophobic, some positive

More information

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as

More information

How life. constructs itself.

How life. constructs itself. How life constructs itself Life constructs itself using few simple rules of information processing. On the one hand, there is a set of rules determining how such basic chemical reactions as transcription,

More information

Big Idea 3C Basic Review

Big Idea 3C Basic Review Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end

More information

Problem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below.

Problem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below. Problem Set Unit 3 Name 1. Which molecule is found in both DNA and RNA? A. Ribose B. Uracil C. Phosphate D. Amino acid 2. Which molecules form the nucleotide marked in the diagram? A. phosphate, deoxyribose

More information

Chapter 12. DNA TRANSCRIPTION and TRANSLATION

Chapter 12. DNA TRANSCRIPTION and TRANSLATION Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making

More information

DNA.notebook March 08, DNA Overview

DNA.notebook March 08, DNA Overview DNA Overview Deoxyribonucleic Acid, or DNA, must be able to do 2 things: 1) give instructions for building and maintaining cells. 2) be copied each time a cell divides. DNA is made of subunits called nucleotides

More information

BIOSTAT516 Statistical Methods in Genetic Epidemiology Autumn 2005 Handout1, prepared by Kathleen Kerr and Stephanie Monks

BIOSTAT516 Statistical Methods in Genetic Epidemiology Autumn 2005 Handout1, prepared by Kathleen Kerr and Stephanie Monks Rationale of Genetic Studies Some goals of genetic studies include: to identify the genetic causes of phenotypic variation develop genetic tests o benefits to individuals and to society are still uncertain

More information

From Gene to Protein Transcription and Translation

From Gene to Protein Transcription and Translation Name: Hour: From Gene to Protein Transcription and Translation Introduction: In this activity you will learn how the genes in our DNA influence our characteristics. For example, how can a gene cause albinism

More information

Gene function at the level of traits Gene function at the molecular level

Gene function at the level of traits Gene function at the molecular level Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines

More information

Lecture 19A. DNA computing

Lecture 19A. DNA computing Lecture 19A. DNA computing What exactly is DNA (deoxyribonucleic acid)? DNA is the material that contains codes for the many physical characteristics of every living creature. Your cells use different

More information

From Gene to Protein

From Gene to Protein 8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are

More information

The Structure of RNA. The Central Dogma

The Structure of RNA. The Central Dogma 12-3 12-3 RNA and Protein Synthesis The Structure of RNA The Central Dogma Phenotype A gene is a SEQUENCE of DNA that codes for a protein (or functional RNA). Phenotype is the individual s observable trait

More information

Protein Synthesis. Application Based Questions

Protein Synthesis. Application Based Questions Protein Synthesis Application Based Questions MRNA Triplet Codons Note: Logic behind the single letter abbreviations can be found at: http://www.biology.arizona.edu/biochemistry/problem_sets/aa/dayhoff.html

More information

13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription.

13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription. 13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription. The Role of RNA 1. Complete the table to contrast the structures of DNA and RNA. DNA Sugar Number of Strands Bases

More information

Chapter 14: From DNA to Protein

Chapter 14: From DNA to Protein Chapter 14: From DNA to Protein Steps from DNA to Proteins Same two steps produce all proteins: 1) DNA is transcribed to form RNA Occurs in the nucleus RNA moves into cytoplasm 2) RNA is translated in

More information

Protein Synthesis & Gene Expression

Protein Synthesis & Gene Expression DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that

More information

Ch 10 Molecular Biology of the Gene

Ch 10 Molecular Biology of the Gene Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read

More information

LABS 9 AND 10 DNA STRUCTURE AND REPLICATION; RNA AND PROTEIN SYNTHESIS

LABS 9 AND 10 DNA STRUCTURE AND REPLICATION; RNA AND PROTEIN SYNTHESIS LABS 9 AND 10 DNA STRUCTURE AND REPLICATION; RNA AND PROTEIN SYNTHESIS OBJECTIVE 1. OBJECTIVE 2. OBJECTIVE 3. OBJECTIVE 4. Describe the structure of DNA. Explain how DNA replicates. Understand the structure

More information

ENZYMES AND METABOLIC PATHWAYS

ENZYMES AND METABOLIC PATHWAYS ENZYMES AND METABOLIC PATHWAYS This document is licensed under the Attribution-NonCommercial-ShareAlike 2.5 Italy license, available at http://creativecommons.org/licenses/by-nc-sa/2.5/it/ 1. Enzymes build

More information

Transcription. DNA to RNA

Transcription. DNA to RNA Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy

More information

Name. Student ID. Midterm 2, Biology 2020, Kropf 2004

Name. Student ID. Midterm 2, Biology 2020, Kropf 2004 Midterm 2, Biology 2020, Kropf 2004 1 1. RNA vs DNA (5 pts) The table below compares DNA and RNA. Fill in the open boxes, being complete and specific Compare: DNA RNA Pyrimidines C,T C,U Purines 3-D structure

More information

Materials Protein synthesis kit. This kit consists of 24 amino acids, 24 transfer RNAs, four messenger RNAs and one ribosome (see below).

Materials Protein synthesis kit. This kit consists of 24 amino acids, 24 transfer RNAs, four messenger RNAs and one ribosome (see below). Protein Synthesis Instructions The purpose of today s lab is to: Understand how a cell manufactures proteins from amino acids, using information stored in the genetic code. Assemble models of four very

More information

PROTEIN SYNTHESIS WHAT IS IT? HOW DOES IT WORK?

PROTEIN SYNTHESIS WHAT IS IT? HOW DOES IT WORK? PROTEIN SYNTHESIS WHAT IS IT? HOW DOES IT WORK? Learning Outcomes All: Will be able to describe simple steps in protein synthesis: Transcription and Translation and be able to distinguish between them.

More information

Station 1: DNA Structure Use the figure above to answer each of the following questions. 1.This is the subunit that DNA is composed of. 2.

Station 1: DNA Structure Use the figure above to answer each of the following questions. 1.This is the subunit that DNA is composed of. 2. 1. Station 1: DNA Structure Use the figure above to answer each of the following questions. 1.This is the subunit that DNA is composed of. 2.This subunit is composed of what 3 parts? 3.What molecules make

More information

The Structure of Proteins The Structure of Proteins. How Proteins are Made: Genetic Transcription, Translation, and Regulation

The Structure of Proteins The Structure of Proteins. How Proteins are Made: Genetic Transcription, Translation, and Regulation How Proteins are Made: Genetic, Translation, and Regulation PLAY The Structure of Proteins 14.1 The Structure of Proteins Proteins - polymer amino acids - monomers Linked together with peptide bonds A

More information

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,

More information

Create a model to simulate the process by which a protein is produced, and how a mutation can impact a protein s function.

Create a model to simulate the process by which a protein is produced, and how a mutation can impact a protein s function. HASPI Medical Biology Lab 0 Purpose Create a model to simulate the process by which a protein is produced, and how a mutation can impact a protein s function. Background http://mssdbio.weebly.com/uploads/1//7/6/17618/970_orig.jpg

More information

DNA is normally found in pairs, held together by hydrogen bonds between the bases

DNA is normally found in pairs, held together by hydrogen bonds between the bases Bioinformatics Biology Review The genetic code is stored in DNA Deoxyribonucleic acid. DNA molecules are chains of four nucleotide bases Guanine, Thymine, Cytosine, Adenine DNA is normally found in pairs,

More information

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These

More information

From Gene to Protein Transcription and Translation i

From Gene to Protein Transcription and Translation i From Gene to Protein Transcription and Translation i How do the genes in our DNA influence our characteristics? A gene is a segment of DNA that provides the instructions for making a protein. Proteins

More information

A Zero-Knowledge Based Introduction to Biology

A Zero-Knowledge Based Introduction to Biology A Zero-Knowledge Based Introduction to Biology Konstantinos (Gus) Katsiapis 25 Sep 2009 Thanks to Cory McLean and George Asimenos Cells: Building Blocks of Life cell, membrane, cytoplasm, nucleus, mitochondrion

More information

Daily Agenda. Warm Up: Review. Translation Notes Protein Synthesis Practice. Redos

Daily Agenda. Warm Up: Review. Translation Notes Protein Synthesis Practice. Redos Daily Agenda Warm Up: Review Translation Notes Protein Synthesis Practice Redos 1. What is DNA Replication? 2. Where does DNA Replication take place? 3. Replicate this strand of DNA into complimentary

More information

The combination of a phosphate, sugar and a base forms a compound called a nucleotide.

The combination of a phosphate, sugar and a base forms a compound called a nucleotide. History Rosalin Franklin: Female scientist (x-ray crystallographer) who took the picture of DNA James Watson and Francis Crick: Solved the structure of DNA from information obtained by other scientist.

More information

Protein Synthesis: Transcription and Translation

Protein Synthesis: Transcription and Translation Review Protein Synthesis: Transcription and Translation Central Dogma of Molecular Biology Protein synthesis requires two steps: transcription and translation. DNA contains codes Three bases in DNA code

More information

NUCLEIC ACID METABOLISM. Omidiwura, B.R.O

NUCLEIC ACID METABOLISM. Omidiwura, B.R.O NUCLEIC ACID METABOLISM Omidiwura, B.R.O Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid

More information

From Gene to Protein Transcription and Translation i

From Gene to Protein Transcription and Translation i How do genes influence our characteristics? From Gene to Protein Transcription and Translation i A gene is a segment of DNA that provides the instructions for making a protein. Proteins have many different

More information

Chapter 12: Molecular Biology of the Gene

Chapter 12: Molecular Biology of the Gene Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,

More information

Granby Transcription and Translation Services plc

Granby Transcription and Translation Services plc ompany Resources ranby Transcription and Translation Services plc has invested heavily in the Protein Synthesis business. mongst the resources available to new recruits are: the latest cellphones which

More information

From Gene to Protein. How Genes Work

From Gene to Protein. How Genes Work From Gene to Protein How Genes Work 2007-2008 The Central Dogma Flow of genetic information in a cell How do we move information from DNA to proteins? DNA RNA protein replication phenotype You! Step 1:

More information

From Gene to Protein via Transcription and Translation i

From Gene to Protein via Transcription and Translation i How do genes influence our characteristics? From Gene to Protein via Transcription and Translation i A gene is a segment of DNA that provides the instructions for making a protein. Proteins have many different

More information

Protein Synthesis. DNA to RNA to Protein

Protein Synthesis. DNA to RNA to Protein Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.

More information

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation 1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous

More information

Gene Expression: Transcription, Translation, RNAs and the Genetic Code

Gene Expression: Transcription, Translation, RNAs and the Genetic Code Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a

More information

Chapter 11. Gene Expression and Regulation. Lectures by Gregory Ahearn. University of North Florida. Copyright 2009 Pearson Education, Inc..

Chapter 11. Gene Expression and Regulation. Lectures by Gregory Ahearn. University of North Florida. Copyright 2009 Pearson Education, Inc.. Chapter 11 Gene Expression and Regulation Lectures by Gregory Ahearn University of North Florida Copyright 2009 Pearson Education, Inc.. 11.1 How Is The Information In DNA Used In A Cell? Most genes contain

More information

Why are proteins important?

Why are proteins important? PROTEIN SYNTHESIS Why are proteins important? proteins help build cell structures some proteins are enzymes that promote biological reactions Proteins are found in muscles, blood, bones, etc.. RNA RNA

More information

Key Concept Translation converts an mrna message into a polypeptide, or protein.

Key Concept Translation converts an mrna message into a polypeptide, or protein. 8.5 Translation VOBLRY translation codon stop codon start codon anticodon Key oncept Translation converts an mrn message into a polypeptide, or protein. MIN IDES mino acids are coded by mrn base sequences.

More information

RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013

RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein

More information

Expression of the genome. Books: 1. Molecular biology of the gene: Watson et al 2. Genetics: Peter J. Russell

Expression of the genome. Books: 1. Molecular biology of the gene: Watson et al 2. Genetics: Peter J. Russell Expression of the genome Books: 1. Molecular biology of the gene: Watson et al 2. Genetics: Peter J. Russell 1 Transcription 1. Francis Crick (1956) named the flow of information from DNA RNA protein the

More information

PROTEIN SYNTHESIS. copyright cmassengale

PROTEIN SYNTHESIS. copyright cmassengale PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other

More information

Alpha-helices, beta-sheets and U-turns within a protein are stabilized by (hint: two words).

Alpha-helices, beta-sheets and U-turns within a protein are stabilized by (hint: two words). 1 Quiz1 Q1 2011 Alpha-helices, beta-sheets and U-turns within a protein are stabilized by (hint: two words) Value Correct Answer 1 noncovalent interactions 100% Equals hydrogen bonds (100%) Equals H-bonds

More information

BME205: Lecture 2 Bio systems. David Bernick

BME205: Lecture 2 Bio systems. David Bernick BME205: Lecture 2 Bio systems David Bernick Bioinforma;cs Infer pa>erns from life biological sequences structures molecular pathways. Suggest hypotheses from inferred pa>erns Structure and Func;on Novel

More information

Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.

Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA. Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally

More information

6-Foot Mini Toober Activity

6-Foot Mini Toober Activity Big Idea The interaction between the substrate and enzyme is highly specific. Even a slight change in shape of either the substrate or the enzyme may alter the efficient and selective ability of the enzyme

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

BIO 101 : The genetic code and the central dogma

BIO 101 : The genetic code and the central dogma BIO 101 : The genetic code and the central dogma NAME Objectives The purpose of this exploration is to... 1. design experiments to decipher the genetic code; 2. visualize the process of protein synthesis;

More information

Review of Protein (one or more polypeptide) A polypeptide is a long chain of..

Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic

More information

Sections 12.3, 13.1, 13.2

Sections 12.3, 13.1, 13.2 Sections 12.3, 13.1, 13.2 Background: Watson & Crick recognized that base pairing in the double helix allows DNA to be copied, or replicated Each strand in the double helix has all the information to remake

More information

Chapter 10. The Structure and Function of DNA. Lectures by Edward J. Zalisko

Chapter 10. The Structure and Function of DNA. Lectures by Edward J. Zalisko Chapter 10 The Structure and Function of DNA PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey,

More information

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested

More information

Chapter 13 From Genes to Proteins

Chapter 13 From Genes to Proteins Chapter 13 From Genes to Proteins True/False Indicate whether the sentence or statement is true(a) or false(b). 1. RNA nucleotides contain the sugar ribose. 2. Only DNA molecules contain the nitrogen base

More information

RNA and Protein Synthesis

RNA and Protein Synthesis RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and

More information

I. Gene Expression Figure 1: Central Dogma of Molecular Biology

I. Gene Expression Figure 1: Central Dogma of Molecular Biology I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases

More information

A. Incorrect! This feature does help with it suitability as genetic material.

A. Incorrect! This feature does help with it suitability as genetic material. College Biology - Problem Drill 08: Gene Structures and Functions No. 1 of 10 1. Which of the statements below is NOT true in explaining why DNA is a suitable genetic material? #01 (A) Its double helix

More information

Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site.

Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site. Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site. Still having trouble understanding the material? Check

More information

PROTEIN SYNTHESIS. copyright cmassengale

PROTEIN SYNTHESIS. copyright cmassengale PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other

More information

What is necessary for life?

What is necessary for life? Life What is necessary for life? Most life familiar to us: Eukaryotes FREE LIVING Or Parasites First appeared ~ 1.5-2 10 9 years ago Requirements: DNA, proteins, lipids, carbohydrates, complex structure,

More information

Proteins: Wide range of func2ons. Polypep2des. Amino Acid Monomers

Proteins: Wide range of func2ons. Polypep2des. Amino Acid Monomers Proteins: Wide range of func2ons Proteins coded in DNA account for more than 50% of the dry mass of most cells Protein func9ons structural support storage transport cellular communica9ons movement defense

More information

Replication, Transcription, and Translation

Replication, Transcription, and Translation Replication, Transcription, and Translation Information Flow from DNA to Protein The Central Dogma of Molecular Biology Replication is the copying of DNA in the course of cell division. Transcription is

More information

Steroids. Steroids. Proteins: Wide range of func6ons. lipids characterized by a carbon skeleton consis3ng of four fused rings

Steroids. Steroids. Proteins: Wide range of func6ons. lipids characterized by a carbon skeleton consis3ng of four fused rings Steroids Steroids lipids characterized by a carbon skeleton consis3ng of four fused rings 3 six sided, and 1 five sided Cholesterol important steroid precursor component in animal cell membranes Although

More information

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Ch 17 Practice Questions MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) Garrod hypothesized that "inborn errors of metabolism" such as alkaptonuria

More information

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made

More information

Chapter 10: Gene Expression and Regulation

Chapter 10: Gene Expression and Regulation Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must

More information

CH 17 :From Gene to Protein

CH 17 :From Gene to Protein CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there

More information

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery

More information

Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL

Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct

More information

BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION.

BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION. !! www.clutchprep.com CONCEPT: GENES Beadle and Tatum develop the one gene one enzyme hypothesis through their work with Neurospora (bread mold). This idea was later revised as the one gene one polypeptide

More information

Bundle 5 Test Review

Bundle 5 Test Review Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic

More information

The Flow of Genetic Information

The Flow of Genetic Information Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins

More information

Do you remember. What is a gene? What is RNA? How does it differ from DNA? What is protein?

Do you remember. What is a gene? What is RNA? How does it differ from DNA? What is protein? Lesson 1 - RNA Do you remember What is a gene? What is RNA? How does it differ from DNA? What is protein? Gene Segment of DNA that codes for building a protein DNA code is copied into RNA form, and RNA

More information

Section 14.1 Structure of ribonucleic acid

Section 14.1 Structure of ribonucleic acid Section 14.1 Structure of ribonucleic acid The genetic code Sections of DNA are transcribed onto a single stranded molecule called RNA There are two types of RNA One type copies the genetic code and transfers

More information

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information

EE550 Computational Biology

EE550 Computational Biology EE550 Computational Biology Week 1 Course Notes Instructor: Bilge Karaçalı, PhD Syllabus Schedule : Thursday 13:30, 14:30, 15:30 Text : Paul G. Higgs, Teresa K. Attwood, Bioinformatics and Molecular Evolution,

More information

6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA

6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA 6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA DNA mrna Protein DNA is found in the nucleus, but making a protein occurs at the ribosome

More information