Providing clear solutions to microbiological challenges TM. cgmp/iso CLIA. Polyphasic Microbial Identification & DNA Fingerprinting
|
|
- Prosper Cunningham
- 6 years ago
- Views:
Transcription
1 Providing clear solutions to microbiological challenges TM Cert. No Polyphasic Microbial Identification & DNA Fingerprinting Microbial Contamination Tracking & Trending cgmp/iso CLIA
2 What is in your Vial? The Requirement for Polyphasic Microbial Identification and Strain Characterization of Escherichia coli (E. coli) ATCC 8739 Jaspreet Sidhu, Ph.D. Molecular Epidemiology, Inc
3 Overview Regulatory, Guidance and Economic Issues Microbial Identification in the Pharmaceutical Industry Methodologies and Tools for Microbial Identification Case Study linking Microbial ID, DNA Fingerprinting to demonstrate specific needs for Polyphasic Approach to Microbial Identification of a critical Compendia QC organism: Escherichia coli (E. coli) ATCC 8739
4 Microbial ID in the Pharmaceutical Industry The identification of microbes recovered from the pharmaceutical (manufacturing) environment is of critical concern Regulatory requirement Process requirement Implications for product safety and efficacy
5 Concerns regarding Mis-identified Microbe Product Recall Economic Loss Regulatory Issues Patient Safety Public Relations
6 Level of Microbial Characterization and ID Gram Stain and cell morphology: EM in ISO 7/8, excipient derived isolates, finished product, below alert level EM ID to Genus: EM in ISO 5/6 with number below alert level ID to Species: EM in ISO 5 areas; alert and/or action level isolates from all excipient, finished product, EM and water monitoring Strain Typing: Significant product failures, e.g. media fill, sterility test and microbial limit test. Significant adverse trends in EM and water monitoring
7 Comparison of Phenotypic and Genotypic Approaches to Microbial ID Genotypic DNA sequence based Stable Found in all organisms Independent of environmental factors Independent of protein expression *Footnote-case study Phenotypic Protein/enzyme based Expression variability Absent in some organisms Environment and growth dependent Lack of functional expression
8 How far has microbial ID evolved. Classification of bacteria based on: Cellular morphology Staining reactions (Gram, spore etc. ) Physiological requirements e.g. oxygen, ph, salt tolerance etc. Biochemical (substrate utilization, metabolic profiles) Bergey s Manual of Determinative Bacteriology Ed. 9 - now an in depth phylogenetic understanding of bacterial taxonomy: Bergey s Manual of Systematic Bacteriology, Ed. 2. Critical role for DNA Sequencing
9 Genotypic ID-Benefits Genotypic methods have been shown to be more accurate and precise than traditional biochemical and phenotypic techniques. These methods are especially valuable for investigations into failures (e.g., sterility test; media fill contamination). However, appropriate biochemical and phenotypic methods can be used for routine identification of isolates FDA Guidance for Industry - September 2004 Sterile Drug Products Produced by Aseptic Processing Current Good Manufacturing Practice This reflects general acceptance that changes in Microbial Taxonomy have been made as a result of advances in Phylogenetics and therefore genetic speciation is now considered the Gold Standard
10 Genotypic Methodologies DNA Sequencing-ID (16S/23S/28S highly conserved across organisms but also divergent amongst species) Pulsed Field Gel Electrophoresis of whole chromosomal DNA Southern blotting and Restriction Fragment Length Polymorphism (RFLP) PCR-based locus-specific RFLP Random Amplified Polymorphic DNA Rep-PCR Amplified Fragment Length Polymorphism
11 Microbial Contaminant Mapping Goal is to link effective Microbial Identification with Microbial Tracking and Trending Complete picture of potential contamination sources by matching genetic fingerprints to process flow throughout production (area, operators, raw materials, supply chain and inventory), packaging, QC testing and post-market Using a risk based approach to problem solving before problem escalates and production is impacted or worse still, actual finished product is discarded
12 MEI Polyphasic Approach to ID Using a Polyphasic approach that combines Phenotypic and Genetic ID (rrna Gene Sequence) together with DNA Fingerprinting (Genetic Subtyping) Reduce the burden of mis-identification as well as incomplete ID Complete the analysis to Identify and Authenticate fidelity of QC Microorganism or confirm source of potential contamination (e.g. Sterility Test Failure Investigation)
13 Aerobic/Anaerobic Pure Isolate Gram Stain
14 Pure Isolate Phenotypic Testing DNA Sequencing Lysis Basic Biochemical Test Gram Stain Spore Motility Antibiotics PCR PCR sequencing (biochemical taxonomic ID) Electropherogram
15 Polyphasic Identification Data analysis Database match ID (assignment) Phenotypic Corroboration ID confirmation
16 Polyphasic approach is critical to provide differentiation between very closely related species of B. cereus group
17 B. cereus B. cereus
18 B. Cereus SBA
19 The Requirement for Polyphasic Microbial Identification and Strain Characterization of Escherichia coli (E. coli) ATCC 8739 Identify and Authenticate TM
20 Escherichia coli (E. coli) ATCC 8739 Isolated pure colonies Subjected to: Genetic (16s), Phenotypic and PFGE Analysis
21 Escherichia coli (E. coli) ATCC 8739 Raw Electropherogram
22 16S SSU rrna Sequence: Escherichia coli (E. coli) ATCC 8739 GGCTTTTCTGCGGGTACGTCATGAGCAAAGGTATAACTTTACTCCCTTCC TCCCCGCTGAAAGTACTTTACAACCCGAAGGCCTTCTTCATACACGCGGC ATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCACTGCTGCCT CCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGGCTGGTCATCCTC TCAGACCAGCTAGGGATCGTCGCCTAGGTGAGCCGTTACCCCACCTACTA GCTAATCCCATCTGGGCACATCCGATGGCAAGAGGCCCGAAGGTCCCCCT CTTTGGTCTTGCGACGTTATGCGGTATTAGCTACCGTTTCCAGTAGTTAT CCCCCTCCATCAGGCAGTTTCCCAGACATTACTCACCCGTCCGCCACTCG TCAGCAAAGAAGCAAGCTGCTTCCTGTTACCGTTCGACTTGCATGTGTTA GGCCTGCCGCCAGCGTTCAATCTGAGCAGGATCAAAACTCAAA
23 16S ID is only possible to Family Level
24 Genetic Similarity Comparison of select Enterobacteriaceae
25 Phenotypic Characterization of select Enterobacteriaceae
26 Polyphasic ID MEI ATCC 8739 Source: ATCC
27 Polyphasic ID MEI ATCC Source: ATCC
28 Polyphasic ID MEI ATCC Source: ATCC
29 Polyphasic ID MEI ATCC Source: ATCC
30 The Requirement for Polyphasic Microbial Identification and Strain Characterization of Escherichia coli (E. coli) ATCC 8739 What is it and is it the right one?
31 PFGE Analysis for Select Enterobacteriaceae
32 Polyphasic ID MEI ATCC Source: MEI
33 Polyphasic ID MEI ATCC 8739 Source: ATCC
34 Polyphasic ID MEI Source: Environmental Isolate
35 Polyphasic ID MEI ATCC Source: MEI Note: O157:H7
36 Polyphasic ID for MEI Source: MEI Lab Isolate Note: O157:H7
37 Multiplex PCR Analysis of Pathogenicity markers for Unknown E. coli
38 PFGE Analysis for Select Enterobacteriaceae
39 PFGE Comparison for Select Enterobacteriaceae MEI 2010
40 Conclusion Study demonstrates the limitations of genetic based ID (16S rrna) in ID of Escherichia coli ATCC 8739 relative to other select closely related Enterobacteriaceae as well as other Escherichia and potential pathogenic forms of E. coli such as serotypes of O157, EHEC, ETEC, EPEC, EIEC Use of a Polyphasic approach that combines genetic derived information with key biochemical and phenotypic characteristics to correctly Identify Escherichia coli ATCC 8739 and exclude potential laboratory and or process related cross contaminants Use of PFGE DNA Fingerprint to Authenticate and Verify ATCC derived QC strain of Escherichia coli ATCC 8739
cgmp/iso CLIA Experience Unsurpassed Quality
Cert. No. 2254.01 cgmp/iso-17025-2005 CLIA Experience Unsurpassed Quality Polyphasic Microbial Identification & DNA Fingerprinting Microbial Contamination Tracking & Trending Microbial Identification
More informationRibotyping Easily Fills in for Whole Genome Sequencing to Characterize Food-borne Pathogens David Sistanich
Ribotyping Easily Fills in for Whole Genome Sequencing to Characterize Food-borne Pathogens David Sistanich Technical Support Specialist Hygiena, LLC Whole genome sequencing (WGS) has become the ultimate
More informationMochamad Nurcholis. Food Technology Department Agricuktural Technology Faculty Brawijaya University 2013
Mochamad Nurcholis Food Technology Department Agricuktural Technology Faculty Brawijaya University 2013 Microbial Identification Type Conventional Identification DNA Hybridization PCR Amplification DNA
More informationThe right answer, every time
MICROSEQ MICROBIAL IDENTIFICATION SYSTEM The right answer, every time Definitive identification of bacterial and fungal isolates. Accuracy adds confidence. When microbial contamination poses problems,
More informationManaging Your Environmental Isolates
Managing Your Environmental Isolates The Controversy Good practice includes the periodic challenge of prepared media with low levels of organisms. This includes USP indicator organisms as well as normal
More informationCERTIFICATE OF ACCREDITATION
CERTIFICATE OF ACCREDITATION ANSI-ASQ National Accreditation Board/ACLASS 500 Montgomery Street, Suite 625, Alexandria, VA 22314, 877-344-3044 This is to certify that Molecular Epidemiology, Inc. (MEI)
More informationA risk based approach to managing environmental excursions
A risk based approach to managing environmental excursions RACI: Monitoring & protecting your GMP facility s Environment 20 th April Ngoc Anh-Thu Phan www.eurofins.com Content Introduction Risk Assessment
More informationEfficient Characterisation of Bacterial Contaminants in the Milk industry: A Case for Molecular Sequencing
SA Society of Dairy Technology 2015 Dairy Symposium 14 16 April, 2015 Cape St. Francis Resort, Cape St. Francis, Eastern Cape Efficient Characterisation of Bacterial Contaminants in the Milk industry:
More informationApplication of Different Typing Methods for Detection of Microbial Contamination of Biological Products and Clean Rooms
Application of Different Typing Methods for Detection of Microbial Contamination of Biological Products and Clean Rooms Pejvak Khaki Department of Microbiology Razi Vaccine & Serum Research Institute Karaj,
More informationTaxonomy. Classification of microorganisms 3/12/2017. Is the study of classification. Chapter 10 BIO 220
Taxonomy Is the study of classification Organisms are classified based on relatedness to each other Chapter 10 BIO 220 Fig. 10.1 1 Species Binomial nomenclature for species identification A eukaryotic
More informationAntonio Del Casale. Microbion srl Verona University Spin-off - Italy
Antonio Del Casale Microbion srl Verona University Spin-off - Italy Food Matters Live 19 November 2014 Microbion Verona University Spin-off Biodiversity services & products Finds the best performing microbes
More informationBiotechnology Chapter 20
Biotechnology Chapter 20 DNA Cloning DNA Cloning AKA Plasmid-based transformation or molecular cloning First off-let s sum up what happens. A plasmid is taken from a bacteria A gene is inserted into the
More informationMOLECULAR TYPING TECHNIQUES
MOLECULAR TYPING TECHNIQUES RATIONALE Used for: Identify the origin of a nosocomial infection Identify transmission of disease between individuals Recognise emergence of a hypervirulent strain Recognise
More informationWhole Genome Sequence Data Quality Control and Validation
Whole Genome Sequence Data Quality Control and Validation GoSeqIt ApS / Ved Klædebo 9 / 2970 Hørsholm VAT No. DK37842524 / Phone +45 26 97 90 82 / Web: www.goseqit.com / mail: mail@goseqit.com Table of
More informationIsolation and Characterization of Two Antibiotic-Producing Bacteria
Isolation and Characterization of Two Antibiotic-Producing Bacteria Madeline Gibson Abstract The discovery of antibiotics with novel mechanisms has plateaued in the last twenty years. As antibiotics are
More informationAbstract... i. Committee Membership... iii. Foreword... vii. 1 Scope Introduction Standard Precautions References...
Vol. 28 No. 12 Replaces MM18-P Vol. 27 No. 22 Interpretive Criteria for Identification of Bacteria and Fungi by DNA Target Sequencing; Approved Guideline Sequencing DNA targets of cultured isolates provides
More informationPathogenic bacteria replicate and persevere in ecological niches called reservoirs
TYPING METHODS WHAT IS TYPING AND WHAT ARE TYPING METHODS? Pathogenic bacteria replicate and persevere in ecological niches called reservoirs Reservoirs may be humans, including (fellow) patients and healthcare
More informationMicrobiology Testing: USP requirements for Sterile and Nonsterile Preparations Webinar Q&A
USP Antimicrobial Effectiveness Testing Microbiology Testing: Webinar Q&A 1. If a base ingredient is designed for the purpose of compounding a specific type of preparation does this forgo the necessity
More informationVTEC strains typing: from traditional methods to NGS
VTEC strains typing: from traditional methods to NGS 2 nd course on bioinformatics tools for Next Generation Sequencing data mining: use of bioinformatics tools for typing pathogenic E. coli ISS, Rome
More informationNext Generation Sequencing Applications in Food Safety and Quality
Next Generation Sequencing Applications in Food Safety and Quality Our science National and international centre of excellence for interdisciplinary investigation and problem solving across plant and bee
More informationInsight into microbial world molecular biology research in environmental microbiology
Insight into microbial world molecular biology research in environmental microbiology Aleksandra Ziembi ska The Silesian University of Technology, Environmental Biotechnology Department aleksandra.ziembinska@polsl.pl
More informationClassification of Microorganisms
PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College C H A P T E R 10 Classification of Microorganisms The Study of Phylogenetic Relationships Taxonomy is the science
More informationContents. 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA Introduction Principle...
Contents 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA... 1 Introduction... 1 Principle... 1 Reagents Required and Their Role... 2 Procedure... 3 Observation... 4 Result
More informationMicroSEQ TM ID Rapid Microbial Identification System:
MicroSEQ TM ID Rapid Microbial Identification System: the complete solution for reliable genotypic microbial identification 1 The world leader in serving science Rapid molecular methods for pharmaceutical
More informationmost dysentery cases even in developed countries and Salmonella typhi which is
CHAPTER 2: LITERATURE REVIEW 2.1 Water Quality and Sanitation Water is a natural resource that has an essential role in all aspects of life. Water resources include lakes, rivers and underground aquifers
More informationBIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
More informationImplementation of the VITEK MS and Its Use in Microbial Identification
Implementation of the VITEK MS and Its Use in Microbial Identification K a t a l i n K i s s, P h. D., P M P M a n a g e r, S c i e n t i s t, L a b o r a t o r y Te s t i n g S e r v i c e s, AT C C O
More informationDEPARTMENT: MICROBIOLOGY PROGRAMME: B SC. Statements of Programme Specific Outcomes (PSOs)
DEPARTMENT: MICROBIOLOGY PROGRAMME: B SC Statements of Programme Specific Outcomes (PSOs) 1. Understand the contributions of various scientist in microbiology and scope of various branches of it 2. Understand
More informationCombining Techniques to Answer Molecular Questions
Combining Techniques to Answer Molecular Questions UNIT FM02 How to cite this article: Curr. Protoc. Essential Lab. Tech. 9:FM02.1-FM02.5. doi: 10.1002/9780470089941.etfm02s9 INTRODUCTION This manual is
More informationMicrobial Diversity and Assessment (III) Spring, 2007 Guangyi Wang, Ph.D. POST103B
Microbial Diversity and Assessment (III) Spring, 2007 Guangyi Wang, Ph.D. POST103B guangyi@hawaii.edu http://www.soest.hawaii.edu/marinefungi/ocn403webpage.htm Overview of Last Lecture Taxonomy (three
More informationWhat is it? Sherlock knows! Microbial Identification System
What is it? Sherlock knows! Microbial Identification System Sherlock Microbial Identification System Microbial ID 10 Minutes... $2.50 Is it accurate? Established technology with 15 years of clinical and
More informationAP Laboratory: Microbes in Action Bacterial Transformation & Gel Electrophoresis
AP Laboratory: Microbes in Action Name: Bacterial Transformation & Gel Electrophoresis Introduction In this laboratory you will use some basic tools of molecular biology to gain an understanding of some
More information1-Microbial Taxonomy: classification nomenclature identification
Part 1 Basic Medical Microbiology 1-Microbial Taxonomy: Taxonomy is the area of biologic science comprising three distinct, but highly interrelated, disciplines that include classification, nomenclature,
More informationFood Safety and Inspection Service A review of laboratory-based regulatory and response activities.
Food Safety and Inspection Service A review of laboratory-based regulatory and response activities. Objective Provide an overview of recently implemented regulatory testing programs for non-o157 shiga-toxin
More informationAnalysis of Shigella strains by Pulsed Field Gel Electrophoresis
Analysis of Shigella strains by Pulsed Field Gel Electrophoresis Kim N. Pham Public Health Internship Program School of Biological Sciences The University of Texas at Austin Mentor: Ana Maria Valle-Rivera,
More informationMicrobial Source Tracking: An Overview
Microbial Source Tracking: An Overview Sharon C. Long, Kyung Han, and Catalina Arango Civil and Environmental Engineering University of Massachusetts Amherst December 5, 2003 Motivation Waterborne outbreaks
More informationMain Topics. Microbial habitats. Microbial habitats. Lecture 21: Bacterial diversity and Microbial Ecology. Ecological characteristics of bacteria
Lecture 21: Bacterial diversity and Microbial Ecology Dr Mike Dyall-Smith Haloarchaea Research Lab., Lab 3.07 mlds@unimelb.edu.au Ref: Prescott, Harley & Klein, 6th ed., parts of chapters 21-24 (refer
More informationDiagnostic Microbiology
Diagnostic Microbiology Identification of Microbes Lecture: 1 Out lines What is expected out of this course??? At the end of this course, you will be able to apply Conventional/ Molecular diagnostic methods
More informationManipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.
Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules
More informationLujain Hamdan. Sarah Jaar. Anas Abu-Humaidan
9 Lujain Hamdan Sarah Jaar Anas Abu-Humaidan Taxonomy It s the ordering of organisms in organized and related groups according to their characteristics. Identification, classification and nomenclature
More informationMicrobial Culture Collection of Cantacuzino Institute
Microbial Culture Collection of Cantacuzino Institute Present and perspectives of development Olguta Dracea, Camelia Babes, Rodica Oancea, Anca Israil, Irina Codita, Adrian Onu, Gabriel Ionescu Cantacuzino
More informationPERANAN MIKROBIOLOGI DALAM DIAGNOSIS PENYAKIT INFEKSI. dr. Agus Eka Darwinata, Ph.D.
PERANAN MIKROBIOLOGI DALAM DIAGNOSIS PENYAKIT INFEKSI dr. Agus Eka Darwinata, Ph.D. CLINICAL MICROBIOLOGY Clinical microbiology is the discipline of detection, characterization, and quantification of
More informationAntibiotic resistance genes located in integrons isolated from Escherichia coli recovered from humans and animals
University of Wollongong Research Online University of Wollongong Thesis Collection 1954-2016 University of Wollongong Thesis Collections 2009 Antibiotic resistance genes located in integrons isolated
More informationThe University of Jordan. Accreditation & Quality Assurance Center. COURSE Syllabus
The University of Jordan Accreditation & Quality Assurance Center COURSE Syllabus 1 Course title General Microbiology 2 Course number 0304251 Credit hours (theory, practical) 3, 1 3 Contact hours (theory,
More informationB. Incorrect! Ligation is also a necessary step for cloning.
Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationStandards for Safety Assessments of Food Additives produced Using Genetically Modified Microorganisms
Standards for Safety Assessments of Food Additives produced Using Genetically Modified Microorganisms (Food Safety Commission Decision of March 25, 2004) Chapter 1 General Provisions No. 1 Background on
More informationSAMPLE. Interpretive Criteria for Identification of Bacteria and Fungi by Targeted DNA Sequencing
MM18 Interpretive Criteria for Identification of Bacteria and Fungi by Targeted DNA Sequencing This guideline includes information on sequencing DNA targets of cultured isolates, provides a quantitative
More informationBeef Industry Safety Summit Renaissance Austin Hotel 9721 Arboretum Blvd. Austin, TX March 1-3
1 USDA, Food Safety and Inspection Service Beef Industry Safety Summit - 2016 Renaissance Austin Hotel 9721 Arboretum Blvd. Austin, TX 78759 March 1-3 Uday Dessai MPH, MS, PhD Senior Public Health Advisor
More informationCourse Title: Microbiology. Course to be designated as a General Education course (part of the 36 hours of A.A. Gen. Ed. coursework): Yes No
Course Competencies Template - Form 112 GENERAL INFORMATION Name: Edwin Ginés-Candelaria Phone #: (305) 237-3396 Course Prefix/Number: MCB 2010 Number of Credits: 3 Degree Type Course Title: Microbiology
More informationInoculate: Media. Physical State of Media: Liquid. The Five I s: Basic Techniques to Culture Microbes Tools of the Microbiology Laboratory
The Five I s: Basic Techniques to Culture Microbes Tools of the Microbiology Laboratory 1. Inoculate 2. Incubate 3. Isolate 4. Inspect 5. Identify The Five I s: Inoculate Inoculate: Media Classified according
More informationBIOTECHNOLOGY. Biotechnology is the process by which living organisms are used to create new products THE ORGANISMS
BIOTECHNOLOGY Biotechnology is the process by which living organisms are used to create new products THE ORGANISMS Bacteria: are prokaryotic organisms that contain circular DNA and no organelles. They
More informationChapter 10 Genetic Engineering: A Revolution in Molecular Biology
Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical
More informationIntroduction, by Tortora, Funke and Case, 11th Ed. TENTATIVE LECTURE OUTLINE DATE TOPIC CHAPTER
MICROBIOLOGY 220 Spring 2014 TTh Section Professor: Scott Rose Text: Microbiology; An Introduction, by Tortora, Funke and Case, 11th Ed. TENTATIVE LECTURE OUTLINE DATE TOPIC CHAPTER Jan. 23 Introduction
More informationName: Ally Bonney. Date: January 29, 2015 February 24, Purpose
Name: Ally Bonney Title: Genome sequencing and annotation of Pseudomonas veronii isolated from Oregon State University soil and 16S rrna characterization of Corvallis, OR soil microbial populations Date:
More informationDEC PCR KIT. SSI Diagnostica
DEC PCR KIT SSI Diagnostica 2 DEC PCR Kit for PCR Detection of Diarrhoeagenic E. coli (DEC) for in vitro diagnostic use Application The DEC PCR Kit is for in vitro diagnostic PCR detection of diarrhoeagenic
More informationBIOTECHNOLOGY. Sticky & blunt ends. Restriction endonucleases. Gene cloning an overview. DNA isolation & restriction
BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY Recombinant DNA technology involves sticking together bits of DNA from different sources. Made possible because DNA & the genetic code are universal. 2004 Biology
More information11/19/2018 1:59 PM Approved (Changed Course) MICRO 5 Course Outline as of Fall 2017
11/19/2018 1:59 PM Approved (Changed Course) MICRO 5 Course Outline as of Fall 2017 CATALOG INFORMATION Dept and Nbr: MICRO 5 Title: GENERAL MICROBIOLOGY Full Title: General Microbiology Last Reviewed:
More informationVanessa G. Allen MD Medical Microbiologist Ontario Agency for Health Protection and Promotion
Vanessa G. Allen MD Medical Microbiologist Ontario Agency for Health Protection and Promotion Public Health Laboratory Services for Foodborne Outbreaks in Ontario Clinical Specimens Typing Food and Water
More informationMidterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score
Midterm 1 Results 10 Midterm 1 Akey/ Fields Median - 69 8 Number of Students 6 4 2 0 21 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 101 Exam Score Quick review of where we left off Parental type: the
More informationChapter 10: Classification of Microorganisms
Chapter 10: Classification of Microorganisms 1. The Taxonomic Hierarchy 2. Methods of Identification 1. The Taxonomic Hierarchy Phylogenetic Tree of the 3 Domains Taxonomic Hierarchy 8 successive taxa
More informationEuropean Pharmacopoeia
EXAMPLES OF VALIDATION PROTOCOLS OF THE ALTERNATIVE MICROBIOLOGICAL METHODS ACCORDING TO CHAPTER 5.1.6 Alternative methods for control of microbiological quality European Pharmacopoeia EDQM Edition 2018
More informationBiotechnology (Chapter 20) Objectives
Biotechnology (Chapter 20) Objectives Understand the background science behind the technology applications Understand the tools and details of the technology Develop familiarity with performing the select
More informationMicrobiology BIOL 202Lab Course Outcome Guide (COG)
Microbiology BIOL 202Lab Course Outcome Guide (COG) Course: Credits: 3 Instructor: Course Description: Concepts and Issues 1. Scientific method scientific notation and metric system. 2. Use of equipment
More information280 Index. Bacteriophage typing, discrimination, 18 reaction difference rule, 19, 23, 24 reproducibility, 18, 19 selection of bacteriophage, 17
Index Antibiotic, 1-4 factors affecting activity, 3 minimum inhibitory concentration (MIC), 1, 3 solubility, 2, 4 Antibiotic resistance profiling, 1-4 antibiogram, 2 breakpoint method, 2 Antibodies, enzyme
More informationABSTRACT. tropical and sub-tropical countries. Recent utility of turmeric by the pharmaceutical
ABSTRACT Turmeric (Curcuma longa L; Zingiberaceae) is one of the most important herb in the tropical and sub-tropical countries. Recent utility of turmeric by the pharmaceutical industries as a source
More informationBio Course Syllabus Spring Biology Spring Biology Second Year Laboratory
Biology 216 - Spring 2015 - Biology Second Year Laboratory Laboratory Sections. CRN 55840-2 W 2:00 pm 4:50 pm ISC 107, 302, 304 Instructors. Dr. Robert. D. Simon, Room ISC 358 Office Hours: W 10:00-12:00,
More informationCourse Outcome Guide (COG)
Course Outcome Guide (COG) Course: MICR 202 Lab Course Description: Concepts and Issues 1. Scientific method scientific notation and metric system. 2. Use of equipment and instruments. 3. Bacterial identification
More informationBIMM 121 Letter Grade by Practicum. Student Information Sheet
BIMM 121 Letter Grade by Practicum Student Information Sheet BIMM 121 Laboratory in Microbiology is a course that combines intensive training in microbiology and physiology content with training and practice
More informationATCC Microbiology Best Practices for Stock Maintenance. C a r o l H o r t o n M a r ke t i n g M a n a g e r, AT C C
ATCC Microbiology Best Practices for Stock Maintenance C a r o l H o r t o n M a r ke t i n g M a n a g e r, AT C C About ATCC Founded in 1925, ATCC is a non-profit organization with headquarters in Manassas,
More informationMicroSEQ Rapid Microbial Identification System
MicroSEQ Rapid Microbial Identification System Giving you complete control over microbial identification using the gold-standard genotypic method The MicroSEQ ID microbial identification system, based
More informationUnit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms
Unit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms Duncanrig Secondary JHM&MHC 2015 Page 1 of 18 On completion of this
More informationUniversity Medical Microbiology
Madison College 20806273 University Medical Microbiology Outline of Instruction Course Information Description Instructional Level Total Credits 5.00 Total Hours 116.00 University Medical Microbiology
More informationBIMM 121 Learning Goals, Outcomes, Assessments, Practice
BIMM 121 Learning Goals, Outcomes, Assessments, Practice Learning Goals: tudents will: A. General cientific/lab kills and Competencies 1. Learn the importance of designing and using the right controls
More informationSuperior accuracy and speed MicroSEQ Rapid Microbial Identification System
Superior accuracy and speed MicroSEQ Rapid Microbial Identification System Featuring the 3500 Genetic Analyzer Achieve right-the-fi rst-time microbial identifi cation Next-generation, high-throughput comparative
More informationDr. Sabri M. Naser Department of Biology and Biotechnology An-Najah National University Nablus, Palestine
Molecular identification of lactic acid bacteria Enterococcus, Lactobacillus and Streptococcus based on phes, rpoa and atpa multilocus sequence analysis (MLSA) Dr. Sabri M. Naser Department of Biology
More information-Is the process of manipulating genes and genomes
Genetic Engineering -Is the process of manipulating genes and genomes Biotechnology -Is the process of manipulating organisms or their components for the purpose of making useful products Restriction Enzymes
More informationDiscussion Items. Microbial Indicators of Water Quality
Discussion Items! Announcements! Group Project topics! Discuss previous lab (Microbes in food) Results Lab report Isolates streak isolate by Thursday.! Microbial analysis of water (Tuesday) MPN and MF!
More informationBIOL 270 Microbiology
South Central College BIOL 270 Microbiology Course Outcome Summary Course Information Description This course is an introduction to the general principles and methods used in the study of microorganisms.
More informationBIO 205 Microbiology with Lab (Title Change ONLY Oct. 2013) Course Package. Approved December 10, 2004 Effective Spring 2005
BIO 205 Microbiology with Lab (Title Change ONLY Oct. 2013) Course Package Approved December 10, 2004 Effective Spring 2005 Modified April 3, 2009 COURSE INFORMATION Title MICROBIOLOGY Number BIO 205 Catalog
More informationKickstart Biology. Year 11 and Year 12
Kickstart Biology Year 11 and Year 12 Year 11 workshops From 2019, we will be offering Kickstart Biology for Year 11 syllabus content. Building a strong foundation for students at this stage can encourage
More informationBachelor s Degree in Food Science and Technology. 2 nd YEAR Molecular Biology ECTS credits: 6 Semester: 1. Teaching aims
2 nd YEAR 5156 Molecular Biology The aim is to further the students' understanding of Biochemistry and particularly its links with Molecular Biology. Students will also acquire skills and knowledge related
More informationRapid Microbiological. PDA: A Global. Methods. Association. Gilberto Dalmaso Aseptic Processes Development Manager
Rapid Microbiological PDA: A Global Methods Association Gilberto Dalmaso Aseptic Processes Development Manager ARMM Presentation Outline A Rapid History of Microbiology The Fundamentals of Traditional
More informationHosted by Paul Webber page 1
A Webber Training Teleclass April 8, 24 Bacterial Typing Methods and Their Value in Infection Control Giles Edwards Consultant Microbiologist Stobhill Hospital, Glasgow, UK Scottish MRSA Reference Laboratory
More informationWhole Genome Sequencing for Enteric Pathogen Surveillance and Outbreak Investigations
Whole Genome Sequencing for Enteric Pathogen Surveillance and Outbreak Investigations Anne Maki, Manager, Enteric, Environmental, Molecular Surveillance and Bacterial Sexually Transmitted Infections, Public
More informationАquaphotomics in biotechnology - new tools and opportunities
Аquaphotomics in biotechnology - new tools and opportunities Prof. Albert Krastanov UNIVERSITY OF FOOD TECHNOLOGIES AQUAPHOTOMICS time-efficient allows rapid, chemical-free, noninvasive in vivo assessment
More informationThe Molecular Epidemiology of Infectious Disease. William R. Bishai, MD, PhD The Johns Hopkins University
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this
More informationExploring Genetic Variation in a Caffeine Metabolism gene LAB TWO: POLYMERASE CHAIN REACTION
Exploring Genetic Variation in a Caffeine Metabolism gene LAB TWO: POLYMERASE CHAIN REACTION Purpose: In this laboratory, we will set up a polymerase chain reaction to amplify the region of the caffeine
More informationLab 5/5a Transformation of E. coli with a Recombinant Plasmid
Lab 5/5a Transformation of E. coli with a Recombinant Plasmid Lab 2 Pre Lab Readiness Familiarity and Proper use of micropipettes Remember the 1 st and 2 nd stops Aseptic Technique Antibiotic Resistance
More informationOverview of a sterility assurance program for PET drugs
Coalition for PET Drug Approval Radiopharmaceutical Sciences Council Overview of a sterility assurance program for PET drugs Eric Webster, PETNET Solutions Disclosures Employee of PETNET Solutions, a Siemens
More informationApplication of Biotechnology in DNA Fingerprinting and Forensic Analysis. Copyright 2009 Pearson Education, Inc.
Application of Biotechnology in DNA Fingerprinting and Forensic Analysis Introduction to DNA Fingerprinting and Forensics Forensic science intersection of law and science Historic examples Early 1900s
More informationCharacterization of Bacterial Strains for Taxonomic Purposes Man Cai Sep 2014
Characterization of Bacterial Strains for Taxonomic Purposes Man Cai Sep 2014 Reference: B. J. Tindall, et al. 2010, IJSEM, 60, 249 Key elements for Taxonomy The tenet for novel taxa characterization:
More informationBiotechnolog y and DNA Technology
PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College C H A P T E R 9 Biotechnolog y and DNA Technology Introduction to Biotechnology Biotechnology: the use of microorganisms,
More informationDNA amplification and analysis: minipcr TM Food Safety Lab
Science for everyone, everywhere DNA amplification and analysis: minipcr TM Food Safety Lab Release date: 09 September 2014 Welcome Our goals for today: Review DNA amplification theory Solve a public health
More informationMarch 15, 2017 VIA . American Type Culture Collection (ATCC) Michelle Sherman University Blvd Manassas, VA 20110
March 15, 2017 VIA EMAIL Michelle Sherman 10801 University Blvd Manassas, VA 20110 Re: Extension for ISO/IEC 17025: 2005 accreditation Dear Michelle: This letter is to inform you that your accreditation
More informationMicrobiological Quality Control as Described in the Compendia. Scott Sutton, Ph.D.
Microbiological Quality Control as Described in the Compendia Scott Sutton, Ph.D. Microbiological Quality Control as Described in the Compendia Antimicrobial Effectiveness Test , ,
More informationSIO 126L MARINE MICROBIOLOGY LABORATORY Hubbs Hall 3300, Winter 2016
SIO 126L MARINE MICROBIOLOGY LABORATORY Hubbs Hall 3300, Winter 2016 This laboratory course will employ current microbiological techniques to explore the diversity of marine microorganisms. Students will
More information7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau
7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial
More informationPathogen Test Methods What s New in Methodology and Detection Limits
Pathogen Test Methods What s New in Methodology and Detection Limits Debbie Cherney Cherney Microbiological Services, Ltd WAFP Workshop June 12, 2013 I m going to take us on a trip Hold on tight, don t
More informationEnzyme that uses RNA as a template to synthesize a complementary DNA
Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have
More information