The Isolation and Sequence Analysis of the Cryptochrome (Cry1) Gene From a Petunia hybrida Plant. By Jenalyn Quevedo

Size: px

Start display at page:

Download "The Isolation and Sequence Analysis of the Cryptochrome (Cry1) Gene From a Petunia hybrida Plant. By Jenalyn Quevedo"

Steven Murphy
6 years ago
Views:

1 The Isolation and Sequence Analysis of the Cryptochrome (Cry1) Gene From a Petunia hybrida Plant By Jenalyn Quevedo Biology 115L June 6,

2 Abstract The blue-light photoreceptor cryptochrome (cry1) and Petunia hybrida are important for biological and agricultural study, but the Petunia hybrida cry1 gene is missing in the online nucleotide sequence database, GenBank. This gene could have possible implications in the study of light response and regulation in crops and household plants. Therefore, this experiment intended to find the nucleotide sequence for the Petunia hybrida cry1 gene plant by making a cdna library from its isolated RNA, targeting the sequence using Marge and Homer degenerate primers, and amplifying through PCR. The PCR product was then ligated into the pdrive Cloning Vector, which was then transformed into bacteria for further cloning to complete the isolation for sequence analysis. A consensus sequence was built and its closest match in the GenBank database was Lycopersicon esculentum (tomato) cry1. Since Lycopersicon esculentum and Petunia hybrida are both in the Solanaceae family, this shows that the sequence obtained has a high probability of being the Petunia hybrida cry1 gene. Introduction Cryptochrome was first identified in the 1990s in Arabidopsis thaliana mutants as one of the three different types of pigments used to detect blue light for the inhibition of hypocotyl elongation (Campbell, 2002). It makes up a family of flavoproteins along with photolyases and is found in plants, animals (distributed from insects to vertebrates), fungi, and bacteria (Daiyasu et al., 2004). Cryptochrome works together with phytochromes to regulate photomorphogenic responses, such as cell elongation 2

3 regulation, flowering season regulation (Lin, 2002), and circadian rhythm (Daiyasu et al., 2004). It is now known as a photolyase-like blue/uv-a light receptor (Lin et al., 2003). Cryptochrome is becoming a greater interest to scientists and farmers, because they believe that increasing the levels of blue-light photoreceptors in plants can enable their growth in dim light. This would lead to the development of optimal plant production even in places where the sun doesn t shine. Also, house plants would be able to grow just as green and lush as plants grown in high light intensities. However, the mechanism that cryptochrome uses to respond to light is still a mystery (Wasowicz, 1998). In order to study it in greater depth, cryptochrome must first be isolated. The nucleotide sequence for the cryptochrome gene (cry1) has already been found in many species and stored in online databases such as the GenBank on the National Center for Biotechnology Information website ( However, the sequence for cry1 in the Petunia hybrida is missing from the GenBank database. Petunia hybrida is an ornamental plant that is part of the Solanaceae Family. The Solanaceae Family is the most valuable plant taxon in terms of vegetable crops, especially since it has been subjected to intensive human selection. Other plants it includes are tomato, tobacco, potato, nightshade, eggplant, sweet peppers, and chili peppers. Petunia plants also play an important model system for biology as they are commonly studied for their anthocyanin (red and purple) pigments. The purpose of this experiment is to find the cry1 sequence in a Petunia hybrida plant to complete the void in the GenBank database, as both cryptochrome and Petunia hybrida are becoming more important to biological and agricultural studies. 3

4 Materials and Methods Isolation and Quantification of RNA From a Petunia hybrida plant, 106 mg of flower buds (using newly synthesized parts of the plant increases RNA yield) was cut up and grinded in liquid nitrogen with a mortar and pestle that was already pre-cooled with liquid nitrogen. The frozen plant tissue was then placed in pre-cooled 2 ml microcentrofuge tube. The RNeasy Mini Protocol for Isolation of Total RNA from Plant Cells and Tissues was then used to extract the RNA (QIAGEN, June 2001). 30 µl of RNase-free water was used for the first elution step and 40 µl was used for the second elution step, giving a total sample volume of 70 µl of RNA solution. All RNA solutions and reagents were kept on ice (4 C) at all times unless instructed otherwise. The eluted RNA solution was then quantified using a NanoDrop Spectrophotometer. 2.0 µl of the sample was scanned with the NanoDrop, and a RNA concentration of µl/ml was obtained (Figure 1). Reverse Transcription to Produce cdna Library Marge and Homer degenerate primers and an Omniscript Kit by QIAGEN were used for the 20.0 µl reverse transcription reaction. 1.5 µg of RNA was added to the Master Mix, which included 2.0 µl of 10X Buffer RT, 2.0 µl dntp Mix, 2.0 µl 10µM Marge, 2.0 µl 10µM Homer, 1.0 µl reverse transcriptase (RT), and enough RNase-free 4

5 water to make up the 20.0 µl reaction once the RNA is added. The reaction mixture was then incubated at 37 C for 60 min. PCR Amplification of Target Sequence A 20.0-µL test PCR reaction was run before for the large µL Preparative PCR reaction in order to make sure that the desired products were obtained. The Master Mix was prepared using 2.0 µl 10X PCR Buffer, 0.4 µl dntp (10µM), 1.0 µl Marge (10 µm), 1.0 µl Homer (10µM), 13.1 µl RNase-free water, and 0.5 µl Hot Star Taq Polymerase. 2.0 µl template DNA from the reverse transcription reaction was then added to the Master Mix, so that it made up10% of the total reaction volume. The thermal cycler was programmed so that the PCR reaction ran at: 1) 95 C for 15 min, 2) 95 C for 1 min, 50 C for 1 min, then 72 C for 1 min, and repeating 35 times total, and 3) 72 C for 15 min. After the PCR tube went through the PCR cycling program, it was held at 4 C. A 1.2% Agarose Electrophoresis Gel was loaded with the PCR test reaction plus 4 µl of 6X Loading Dye and a 100 bp ladder in order to see if the desired products were obtained (all electrophoresis gels used were made of 1.2% agarose) (Figure 2). If the proper PCR product was not obtain or if there were other products that were not desired, the amount of MgCl 2 in the PCR reaction was changed in order to alleviate those problems. The 10X PCR Buffer contained 1.5 mm. Magnesium concentrations of 0.8 mm, 1.3 mm, 1.8 mm, 2.3 mm, 2.8 mm, 3.3 mm, and 3.8 mm were tested for the best PCR product yield and loaded into an electrophoresis gel for analysis (Figure 3). The corresponding amounts of MgCl2 (25 mm) were added to the 5

6 above PCR test reaction, and the amount of RNase-free water was also changed accordingly to obtain 20.0-µL PCR reactions. A 100-µL Preparative PCR reaction was then carried out using the Magnesium concentration that produced the best results, which was 2.8 mm Mg in this experiment. The Master Mix for the Preparative PCR reaction contained 10.0 µl 10X PCR Buffer Mg, 2.0 µl dntp (10 µm), 5.0 µl Marge (10 µm), 5.0 µl Homer (10.0 µm), 1.0 µl Taq DNA polymerase, 11.2 µl MgCl2 (25 mm), and 55.8 µl RNase-free water µl template DNA from the reverse transcription reaction was then added to the Master Mix, so that it again made up10% of the total reaction volume. The PCR reaction mixture was split into 4 tubes (25 µl in each) to increase the efficiency of the reaction. The PCR tubes then went through the same cycling as described above for the test PCR reaction. All of the Preparative PCR reaction was then purified following the QIAquick PCR Purification Kit Protocol (QIAGEN, 2002). Gel electrophoresis was again used to determine if the desired product was obtained (Figure 4). Ligation of Purified PCR Product into Cloning Vector The Ligation reaction was performed using the QIAGEN PCR Cloning Kit Ligation Protocol (QIAGEN, April 2002). The PCR product was 250 bp in size and 5- times molar excess of PCR product was used, which was calculated to be 16.2 ng DNA using the Table 2 equation. The Ligation reaction mixture included 0.5 µl pdrive Cloning Vector (50 ng/µl) (Figure 5), 2.5 µl Ligation Master Mix, 16.2 ng PCR product, and 6

7 enough RNase-free water to make up the 5.0 µl reaction. The protocol was then followed to carry out the reaction. Transformation of Ligation Products into Bacteria 50 µl of competent cells was thawed on ice, while SOC medium was thawed to room temperature. For the transformation reaction, the 5 µl of the ligation reaction was mixed with 20 µl of the competent cells. The mixture incubated on ice for 5 min, heatshocked at 42 C in a water bath or heating block for 30 s without shaking, then incubated on ice again for 2 min. 275 µl of room temperature SOC medium was added to the transformation reaction mixture, giving a total volume of 300 µl. The mixture recovered for 30 min at 37 C. Then, the transformation reaction was plated on three LB + Amp + X-Gal plates (100 µl each) and incubated overnight at 37 C. They were plated on LB + Amp + X-Gal plates because the pdrive Cloning Vector contains an ampicillin resistance gene and a lacz gene, which produces blue colonies when it remains intact. White colonies signify colonies that contain a break in the lacz gene, and therefore, the PCR product insert. Six colonies, 5 white (successful transformants) and 1 blue (control), were inoculated from the plates into 6 separate tubes of 3 ml LB + Amp liquid medium overnight at 37 C. Each of the six cultures was then purified using the Wizard Plus Minipreps DNA Purification System protocol: Section III. A. Production of a Cleared Lysate From 1-3mL of Bacteria Culture and Section IV. B. Plasmid Purification Without a 7

8 Vacuum Manifold (Promega, 2002). The concentration of each Miniprep plasmid was then quantified using the NanoDrop Spectrophotometer. Isolation of Plasmid DNA Using EcoRI Restriction digests of 300 ng of each of the six purified plasmids was then carried out using EcoRI. Each digest required 2 µl Buffer H 10X, 0.5 µl EcoRI, 300 ng of DNA plasmid, and enough sterile water to account for the rest of the 20-µL reaction. The digests were incubated at 37C for 45 min. The reactions were visualized using Gel Electrophoresis. 4 µl of Loading Dye 6X was added to each of the digests, which were then loaded in a 1.2% Agarose Gel. 5 µl of each a BstEIIλ marker and a 100bp ladder were also loaded in order to measure the size of each DNA fragment. 500 ng of plasmid DNA was then put aside for sequencing after visualizing which of the six digests had the proper size insert, which was 250 kb in this case (Figure 6). Automated Sequencing and Analysis A forward and reverse sequence of the isolated DNA was found using the Auto Assembler 2.1 computer program. After the sequences was edited and cleaned up, a consensus sequence was built using the program. The identity of the consensus sequence was then found using the NCBI BLAST online database ( Inserting the sequence in the Nucleotidenucleotide BLAST (blastn) section revealed the closest matches to the identity of the isolated DNA sequence (Table 1). 8

9 Results Quantification with the NanoDrop Spectrophotometer obtained a total RNA concentration of ng/µl (Figure1). The PCR test products from the reverse transcription of this RNA showed that Marge and Homer degenerate primers were successful in amplifying the desired 250 bp product along with other ribosomal subunit products (Figure 2). Magnesium concentrations of 2.3 mm and 2.8 mm MgCl 2 were found to eliminate the ribosomal subunit products and give the best PCR products (Figure 3). Since the band for 2.8 mm MgCl 2 was brighter, that was the concentration used for the Preparative PCR reaction, which was successful in obtaining clean 250 bp products (Figure 4). Three of the five transformation cultures were able to produce good products for sequence analysis (Figure 5). The W3 (white #3) culture was chosen since it had the highest concentration obtained using the NanoDrop Spectrophotometer, which was of 104 ng/µl DNA. The consensus sequence built from Auto Assembler 2.1 was found to be: TGGTGAATCCATTCAGTTGGCAGTCTAGCAAGTTCAGGAAGCCATCGCCG AACATATTCCCCTTTAGGATCAAACTTGTATCCCTCAAACTGTGGATTATA GAATTGATCAAACTCACAACCATcAgGTAGGGTGCCGGTAATATATTGCCA ACCAAGAGCATCACTCTCAAGATCTGCATCTAA Submitting this sequence query into the BLAST online search database obtained top three matches of Lycopersicon esculentum cry1 (tomato), Orobanche minor cry1 (hell root), and Pisum sativum cry1 (pea), respectively. 9

Figure 2 Test PCR reaction with Marge and Homer degenerate primers.

10 Figure 1 NanoDrop Spectrophotometer quantification of total RNA concentration from Petunia hybrida (897.8 ng/µl). Figure 2 Test PCR reaction with Marge and Homer degenerate primers. The top two bright bands represent ribosomal DNA and the bottom bright band represents the desired 250 bp PCR product. 10

8 mm MgCl 2 concentrations produced the best 250 bp PCR products.

11 Figure 3 MgCl 2 Variation Tests of PCR reaction using Marge and Homer degenerate primers. 2.3 mm and 2.8 mm MgCl 2 concentrations produced the best 250 bp PCR products. Figure 4 Preparative PCR Products. 250 bp DNA products were obtained without any other ribosomal DNA residue. 11

Figure 5 Illustration of the pdrive Cloning Vector. Figure 6 Purified products from EcoRI digest of the transformation reaction. The length of the encircled product is 250 bp.

12 Figure 5 Illustration of the pdrive Cloning Vector. Figure 6 Purified products from EcoRI digest of the transformation reaction. The length of the encircled product is 250 bp. The top bright bands represent the 3.85 kb pdrive Cloning Vector. 500 ng DNA from the W3 product was used for sequence analysis. Consensus Sequence TGGTGAATCCATTCAGTTGGCAGTCTAGCAAGTTCAGG AAGCCATCGCCGAACATATTCCCCTTTAGGATCAAACT TGTATCCCTCAAACTGTGGATTATAGAATTGATCAAAC TCACAACCATcAgGTAGGGTGCCGGTAATATATTGCCAA 12 CCAAGAGCATCACTCTCAAGATCTGCATCTAA

13 BLAST Top Matches 1) Lycopersicon esculentum cry1 (tomato) 2) Orobanche minor cry1 (hell root) 3) Pisum sativum cry1 (pea) Table 1 Consensus sequence developed using Auto Assembler 2.1 computer program and the top three BLAST matches for the sequence. Discussion A higher MgCl 2 concentration for the PCR reaction was needed in order to obtain a better PCR product without any unwanted DNA residues such as from ribosomal subunits. This makes sense since the MgCl 2 concentration needs to exceed the dntp concentration in the reaction. The dntp kelate the Mg in order to become stabilized. But free Mg is still needed for enzyme activity. Therefore, a low Mg concentration will produce a lower yield of product, which was obtained. However, a really high Mg concentration produces more nonspecific products, which would also lower the yield of the specific product that is desired. The Mg concentration variation test was a good way to determine which middle concentration would obtain a clean, desired product. The top BLAST match of Lycopersicon esculentum cry1 (tomato) gives confidence that the experiment was successful in finding the nucleotide sequence for Petunia hybrida cry1. Tomatoes and petunias are part of the same family, Solanaceae, which means that they are similar in sequence to an extent. Repeating this experiment using different Petunia hybrida plants would be able to produce a more accurate consensus sequence for the gene that could possibly be submitted to the GenBank 13

14 database. Another way to test if the sequence is correct would be to develop biotinylated probes and see if they hybridize to the correct gene on a Northern Blot of Petunia hybrida RNA. Further isolation and study of Petunia hybrida cry1 could help the investigation of the mechanism that cryptochrome uses to regulate photomorphogenic responses and perhaps determine if light response and color pigments are related which would further the study of the anthocyanin pigments in petunia plants. References 14

15 Campbell, N., & Reece, J. (2002). Biology: Sixth Edition. San Francisco: Benjamin Cummings. Daiyasu, H., Ishikawa, T., Iwai, S., Kuma, K., Todo, T., & Toh, H. (2004). Identification of Cryptochrome DASH from Vertebrates [Electronic version]. Genes to Cells, 9, Lin, C. (2002). Blue Light Receptors and Signal Transduction [Electronic version]. The Plant Cell, 14, S207-S225. Lin, C., Mockler, T., Maymon, M., Shalitin, D., & Yu, X. (2003). Blue Light-Dependent in Vivo and in Vitro Phosphorylation of Arabidopsis Cryptochrome 1 [Electronic version]. The Plant Cell, 15, Promega. (2002). Wizard Plus Minipreps DNA Purification System. Madison: Promega Corporation. QIAGEN. (April 2001). QIAGEN PCR Cloning Handbook. Valencia: QIAGEN, Inc. QIAGEN. (June 2001). RNeasy Mini Handbook: Third Valencia: QIAGEN, Inc. Edition. QIAGEN. (2002). QIAquick Spin Handbook. Valencia: QIAGEN, Inc. Wasowicz, L. (1998, April). Why Plants Bend Towards Blue Light. Retrieved June 5, 2005, from 15

Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual

Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual Fusion Cloning technology Cold Fusion Cloning Kit Store the master mixture and positive controls at -20 C Store the competent cells at -80 C. (ver. 120909) A limited-use label license covers this product.