Galea GL et al, J Biol Chem Supplementary Figure 1
|
|
- Rosamond Stewart
- 6 years ago
- Views:
Transcription
1 Galea GL et al, J Biol Chem Supplementary Figure 1 Supplementary Figure 1: Characterisation of long bone osteoblastic cells derived from mouse long bone diaphyses. A) clbobs treated with or without differentiation medium were fixed at the indicated time points and their alkaline phosphatase (ALP) activity determined relative to protein content as described in the supplementary methods. Bars represent the mean ±SEM, n = 6. ** p < 0.01, *** p < versus the respective control group. B) ALP Fast Red staining of clbobs not treated with differentiation medium. C) Alizarin red staining of clbob cultures treated with or without differentiation medium for 21 days indicating the formation of mineralized nodules.
2 Supplementary Figure 2 Supplementary Figure 2: Confluence increases Saos-2 Sost expression. Sost expression was quantified by qrt-pcr in sub-confluent (~80% confluent) versus fully confluent cultures of Saos-2 cells. **p<0.01.
3 Supplementary Figure 3 Supplementary Figure 3: Saos-2 cells express and secrete sclerostin protein. Confluent Saos-2 cells were cultured as described in the methods, but for this experiment were not serum depleted. A) Sclerostin protein demonstrated by western blotting of cell lysates. Recombinant human sclerostin is shown as a positive control and actin as a loading control. B) Sclerostin levels in the cells supernatant was determined by ELISA as previously described (1), n = 6. Human serum sclerostin levels previously reported by Modder et al (2) in men and women are indicated.
4 Supplementary Fig 4 Supplementary Figure 4: The ERβ agonist ERB also down-regulates Sost expression. Saos-2 cells were treated with 0.1 μm ERB and harvested 8 hrs later. Sost expression was quantified by qrt-pcr. Bars represent means ± SEM. ***p<0.001.
5 Supplementary Figure 5 Supplementary Figure 5: Inhibition of ERα and ERβ prevents Sost down-regulation by E2. Saos-2 cells were treated with 0.1 μm following 16 hr pre-treatment with 1 μm ICI and harvested 8 hrs later. Bars represent the mean ± SEM. ** p < 0.01 versus vehicle control and ## p < 0.01 versus the E2-treated vehicle group.
6 Supplementary Figure 6 Figure 6: 10 μm PD98059 effectively inhibits ERK phosphorylation without altering Saos-2 viability. Saos-2 cells were treated with 10 μm PD98059 and fixed 24 hrs later to A) determine cell number and B) assess PI positivity as a measure of viability. Neither cell number nor the proportion of cells able to absorb PI (non-viable cells) was significantly altered by PD98059 treatment. In order to confirm that 10 μm PD98059 was able to inhibit ERK phosphorylation in our model, cells were treated with vehicle (veh.) or PD98059 and harvested 30 mins later. C,D) PD98059 significantly reduced ERK1/2 phosphorylation (p- ERK1/2) relative to total ERK as is illustrated by a representative western blot and quantified, n = 3. Tubulin is shown as a loading control. ** p < 0.01.
7 Supplementary methods: Characterisation of cortical long bone-derived mouse osteoblasts For characterisation studies, passage 1 clbobs were seeded at 25,000 cells/cm 2 and treated with or without 50 μm ascorbic acid and 10 mm β-glycerol phosphate in complete medium (differentiation medium). Cells were fixed in ice-cold methanol for 5 mins and alkaline phosphatase activity determined using the p-nitrophenyl phosphate Sigma Fast TM (Sigma, Dorset, UK) substrate conversion kit according to the manufacturer s instructions. Substrate conversion was normalized relative to total protein content using the crystal violet method following protocols previously-reported by other groups (3-4). Alkaline phosphatase activity was visualized using the naphthol AS-BI method with Fast Red (Sigma, Dorset, UK), as previously described by our group applied to similarly-derived rat cells (5), in cultures of mouse clbobs fixed in 4% paraformaldehyde solution, ph 7.4, for 20 mins at room temperature. Mineralized nodules in cultures treated with or without differentiation medium for 21 days were fixed in ice-cold methanol on ice for 5 mins, air dried, washed in phosphatebuffered saline, stained in 2% alizarin red solution (Sigma, Dorset, UK) ph 4.2 for 5 mins, and cleared under running water. Determining the effect of confluence on Saos-2 Sost expression Cells were seeded at 20,000 cells/cm2 or 40,000 cells/cm2 in 6-well dishes and cultured for 3 days so as to achieve different levels of confluence (sub-confluent or fully-confluent). Cells were harvested and RNA extracted for quantification of Sost expression by qrt-pcr. Determining the effect of the ERβ agonist ERB 041 on Sost expression ERB 041 (ERB) (6) was obtained from Tocris Bioscience (Bristol, UK) and reconstituted in ethanol. Saos-2 cells were cultured following the Sost regulation protocol, treated with 0.1 μm ERB and harvested 8 hrs later. Sost expression was quantified by qrt-pcr. Determining the effect of 24 hrs PD98059 treatment on cell viability and ERK phosphorylation Saos-2 cells were seeded at an initial density of 10,000 cells/well in 24-well plates and allowed to settle for 24 hrs before being serum-depleted in 2% charcoal-dextran stripped serum overnight. The next morning cells were treated with 10 μm PD98059 or vehicle and fixed 24 hrs later in buffered 4% paraformaldehyde, ph 7.6, which was then washed off in PBS. Cells were stained with DAPI such that cell number could be determined. Cell viability was determined by staining cells for with a 1:100 dilution of propidium iodide (PI), which stains non-viable cells (7), for 5 mins at room temperature. The number of cells and the proportion of cells stained positive for PI was determined using NIH Image J. To determine the effect of 10 μm PD98059 on ERK phosphorylation, Saos-2 cells were cultured following the protocol used to study Sost regulation. Cells were not serum-deprived in order to maintain detectable basal ERK phosphorylation, but instead were treated with PD98059 for 30 mins (the pre-treatment time normally used before exposure to strain or
8 treatment with agonists). Cells were then washed in glacial PBS and lysed in denaturing lysis buffer as previously described (8). ERK phosphorylation was analyzed by Western blotting with primary antibodies to phosphorylated (perk) and total ERK (Cell Signaling Technologies) using conventional resolution and transfer methods (8). Secondary, fluorescently labelled antibodies were from Li-Cor and the fluorescent signals were acquired and analyzed using Odyssey Fc dual-mode imaging system (Li-Cor) as recommended by the manufacturer. Band intensity of p-erk1/2 relative to total-erk1/2 was determined using NIH Image J.
9 Supplementary References: 1. Yu, L., der Valk, M. V., Cao, J., Han, C. Y., Juan, T., Bass, M. B., Deshpande, C., Damore, M. A., Stanton, R., and Babij, P. (2011) Sclerostin expression is induced by BMPs in human Saos-2 osteosarcoma cells but not via direct effects on the sclerostin gene promoter or ECR5 element, Bone, 2. Modder, U. I., Hoey, K. A., Amin, S., McCready, L. K., Achenbach, S. J., Riggs, B. L., Melton, L. J., 3rd, and Khosla, S. (2011) Relation of age, gender, and bone mass to circulating sclerostin levels in women and men, J Bone Miner Res, 26, Wang, L., Zhao, R., Shi, X., Wei, T., Halloran, B. P., Clark, D. J., Jacobs, C. R., and Kingery, W. S. (2009) Substance P stimulates bone marrow stromal cell osteogenic activity, osteoclast differentiation, and resorption activity in vitro, Bone, 45, Cao, J. J., Singleton, P. A., Majumdar, S., Boudignon, B., Burghardt, A., Kurimoto, P., Wronski, T. J., Bourguignon, L. Y., and Halloran, B. P. (2005) Hyaluronan increases RANKL expression in bone marrow stromal cells through CD44, J Bone Miner Res, 20, Zaman, G., Suswillo, R. F., Cheng, M. Z., Tavares, I. A., and Lanyon, L. E. (1997) Early responses to dynamic strain change and prostaglandins in bone-derived cells in culture, J Bone Miner Res, 12, Harris, H. A., Albert, L. M., Leathurby, Y., Malamas, M. S., Mewshaw, R. E., Miller, C. P., Kharode, Y. P., Marzolf, J., Komm, B. S., Winneker, R. C., Frail, D. E., Henderson, R. A., Zhu, Y., and Keith, J. C., Jr. (2003) Evaluation of an estrogen receptor-beta agonist in animal models of human disease, Endocrinology, 144, Darzynkiewicz, Z., Li, X., and Gong, J. (1994) Assays of cell viability: discrimination of cells dying by apoptosis, Methods Cell Biol, 41, Sunters, A., Armstrong, V. J., Zaman, G., Kypta, R. M., Kawano, Y., Lanyon, L. E., and Price, J. S. (2010) Mechano-transduction in osteoblastic cells involves strain-regulated estrogen receptor alpha-mediated control of insulin-like growth factor (IGF) I receptor sensitivity to Ambient IGF, leading to phosphatidylinositol 3-kinase/AKT-dependent Wnt/LRP5 receptorindependent activation of beta-catenin signaling, J Biol Chem, 285,
Marilyn G. Rimando, Hao-Hsiang Wu, Yu-An Liu, Chien-Wei Lee, Shu-Wen Kuo, Yin-
Supplementary Information Glucocorticoid receptor and Histone Deacetylase 6 mediate the differential effect of dexamethasone during osteogenesis of Mesenchymal stromal cells (MSCs) Marilyn G. Rimando,
More informationShort hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
More informationSupplementary Material
Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated
More informationB. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.
A. - Figure.S1,Li et al. B. : - + - + - + E-cadherin CK19 α-sma vimentin β -actin C. D. Apoptosis: 1.68% 2.99% 1.31% - : - + - + - + Apoptosis: 48.33% 45.32% 44.59% E. invaded cells number 400 300 200
More informationSupplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse
Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse tail DNA. Primers were designed to detect Gna13-WT/f (~400bp/470bp)
More informationHigh throughput screening: Huh-7 cells were seeded into 96-well plate (2000
1 SUPPLEMENTARY INFORMATION METHODS 6 7 8 9 1 11 1 1 1 1 16 17 18 19 High throughput screening: Huh-7 cells were seeded into 96-well plate ( cells/well) and infected with MOI of DENV-. One hour post-infection
More informationRNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the
Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the
More informationSupplementary Figure 1.
Supplementary Figure 1. Quantification of western blot analysis of fibroblasts (related to Figure 1) (A-F) Quantification of western blot analysis for control and IR-Mut fibroblasts. Data are expressed
More informationThis Document Contains:
This Document Contains: 1. In-Cell Western Protocol II. Cell Seeding and Stimulation Supplemental Protocol III. Complete Assay Example: Detailing the Seeding, Stimulation and Detection of the A431 Cellular
More informationab Hypoxic Response Human Flow Cytometry Kit
ab126585 Hypoxic Response Human Flow Cytometry Kit Instructions for Use For measuring protein levels by flow cytometry: hypoxia-inducible factor 1-alpha (HIF1A) and BCL2/adenovirus E1B 19 kda proteininteracting
More informationIn-Cell Western Kits I and II
Odyssey and Aerius Infrared Imaging Systems In-Cell Western Assay Kits I and II Published November, 2006. The most recent version of this protocol is posted at http://biosupport.licor.com/protocols.jsp
More informationFigure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationAdvanced phospho-erk1/2 (Thr202/Tyr204) 500 tests
Headquarters & Europe Office Cisbio Bioassays Phone: +33 (0)4 66 79 67 05 Fax: +33 (0)4 66 79 19 20 bioassays@cisbio.com cisbio_dd_pi_64aerpeg USA Office Cisbio US, Inc. Phone: +1 888 963 4567 Fax: +1
More informationMitoBiogenesis In-Cell ELISA Kit (Colorimetric)
PROTOCOL MitoBiogenesis In-Cell ELISA Kit (Colorimetric) DESCRIPTION 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 MS643 Rev.2 For identifying inhibitors and activators of mitochondrial biogenesis
More informationFor identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells.
ab110216 MitoBiogenesis TM In-Cell ELISA Kit (IR) Instructions for Use For identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells. This product is for research use
More informationAlphaScreen SureFire EGF Receptor (p-tyr1068) Assay Kits. Manual
AlphaScreen SureFire EGF Receptor (p-tyr1068) Assay Kits Manual Assay Points Catalog # 500 TGRERS500 10 000 TGRERS10K 50 000 TGRERS50K For Research Use Only Research Reagents for Research Purposes Only
More informationSupplementary Figure 1. Antigens generated for mab development (a) K9M1P1-mIgG and hgh-k9m1p1 antigen (~37 kda) expression verified by western blot
Supplementary Figure 1. Antigens generated for mab development (a) K9M1P1-mIgG and hgh-k9m1p1 antigen (~37 kda) expression verified by western blot (vector: ~25 kda). (b) Silver staining was used to assess
More informationSupplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured
Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured under static conditions. Cells were seeded in the chamber area of the device and cultured overnight without medium perfusion.
More informationAlpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by
Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by down-regulating PKA and CREB activation Sudha Saryu Malhotra 1, Pankaj Suman 2 and Satish Kumar Gupta 1 * 1 Reproductive
More informationAlphaScreen SureFire IKK β (p-ser177/181) Assay Kits. Quick Guide
AlphaScreen SureFire IKK β (p-ser177/181) Assay Kits Quick Guide Assay Points Catalog # 500 TGRKBS500 10 000 TGRKBS10K 50 000 TGRKBS50K For Research Use Only Research Reagents for Research Purposes Only
More informationAlbumin. MMP-9 (tertiary granules) Lactoferrin. MPO (U/ml) ctrl PMN-sec
Figure S1: Antibody cross-linking of CD18 induces release of primary, secondary, and tertiary granules as well as secretory vesicles. Freshly isolated PMN were incubated with primary anti-cd18 mab IB4
More informationApoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells
Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells Ryosuke Horie. Kagawa University of medecine, Kita-gun, Japan. Disclosures: R. Horie: None.
More informationAntibody used for FC Figure S1. Multimodal characterization of NIR dyes in vitro Figure S2. Ex vivo analysis of HL60 cells homing
Antibody used for FC The following antibodies were used following manufacturer s instructions: anti-human CD4 (clone HI3, IgG1, k - Becton Dickinson), anti-human CD33 (clone WM3, IgG1, k- Becton Dickinson),
More informationSUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells
SUPPLEMENTARY INFORMATION Small molecule activation of the TRAIL receptor DR5 in human cancer cells Gelin Wang 1*, Xiaoming Wang 2, Hong Yu 1, Shuguang Wei 1, Noelle Williams 1, Daniel L. Holmes 1, Randal
More informationSupplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1
Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1 a His-ORMDL3 ~ 17 His-ORMDL3 GST-ORMDL3 - + - + IPTG GST-ORMDL3 ~ b Integrated Density (ORMDL3/ -actin) 0.4 0.3 0.2 0.1
More informationLINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS.
Supplemental Data: LINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS. Scott Jepson, Bryan Vought, Christian H.
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More informationSpironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice
Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice Supplementary Material Supplementary Methods Materials Spironolactone, aldosterone and β-glycerophosphate were
More informationSUPPLEMENTARY INFORMATION
The Supplementary Information (SI) Methods Cell culture and transfections H1299, U2OS, 293, HeLa cells were maintained in DMEM medium supplemented with 10% fetal bovine serum. H1299 and 293 cells were
More informationAlphaScreen SureFire CASP9 (p-ser196) Assay Kits. Manual
AlphaScreen SureFire CASP9 (p-ser196) Assay Kits Manual Assay Points Catalog # 500 TGRC9S500 10 000 TGRC9S10K 50 000 TGRC9S50K For Research Use Only Research Reagents for Research Purposes Only TGRKVS13.7
More informationINOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807
INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended
More informationSarker et al. Supplementary Material. Subcellular Fractionation
Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged
More informationHuman/Mouse/Rat Phospho-CREB (S133) Immunoassay. An ELISA-based assay using fluorogenic substrates to measure phosphorylated CREB in whole cells.
Cell-Based ELISA Human/Mouse/Rat Phospho-CREB (S133) Immunoassay Catalog Number KCB2510 An ELISA-based assay using fluorogenic substrates to measure phosphorylated CREB in whole cells. This package insert
More informationSupplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.
Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Target Gene Non-target / Control BTG2 BRCA1 NFE2L2 Target Sequence ON-TARGET plus Non-targeting sirna # 1 (Cat# D-001810-01-05) sirna1: GAACCGACAUGCUCCCGGA
More informationCytoGLOW. IKK-α/β. Colorimetric Cell-Based ELISA Kit. Catalog #: CB5358
CytoGLOW IKK-α/β Colorimetric Cell-Based ELISA Kit Catalog #: CB5358 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only.
More informationAlphaScreen SureFire STAT3 Total Assay Kits. Manual
AlphaScreen SureFire STAT3 Total Assay Kits Manual Assay Points Catalog # 500 TGRTS3S500 10 000 TGRTS3S10K 50 000 TGRTS3S50K For Research Use Only Research Reagents for Research Purposes Only TGRKVS73.5
More informationPlease read manual carefully before starting experiment
RayBio Cell-Based Human/Mouse/Rat ERK1/2, JNK, p38 MAPK Phosphorylation ELISA Sampler Kit For the semi-quantitative detection of phosphorylated human, mouse, or rat ERK1/2 (Thr202/Tyr204), JNK (Thr183/Tyr185),
More informationAlphaScreen SureFire SMAD2 (p-ser465/467) Assay Kits. Manual
AlphaScreen SureFire SMAD2 (p-ser465/467) Assay Kits Manual Assay Points Catalog # 500 TGRSM2S500 10 000 TGRSM2S10K 50 000 TGRSM2S50K For Research Use Only Research Reagents for Research Purposes Only
More informationSUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION
SUPPLEMENTAL MATERIALS SIRTUIN PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF ACTIVATION Haranatha R. Potteti*, Subbiah Rajasekaran*, Senthilkumar B. Rajamohan*, Chandramohan R. Tamatam,
More informationSupplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide,
Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide, conjugated with either TAT or Myristic acid and biotin for
More informationAndrogen Receptor (Phospho-Tyr363) Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG02138
Androgen Receptor (Phospho-Tyr363) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02138 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research
More informationSingle cell resolution in vivo imaging of DNA damage following PARP inhibition. Supplementary Data
Single cell resolution in vivo imaging of DNA damage following PARP inhibition Katherine S. Yang, Rainer H. Kohler, Matthieu Landon, Randy Giedt, and Ralph Weissleder Supplementary Data Supplementary Figures
More informationT ECHNICAL MANUAL. Culture of Human Mesenchymal Stem Cells Using MesenCult -XF Medium
T ECHNICAL MANUAL Culture of Human Mesenchymal Stem Cells Using MesenCult -XF Medium i Table of Contents 1.0 Materials... 1 1.1 MesenCult -XF Medium and Required Products... 1 1.2 Additional Required
More informationIgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only
IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only Introduction The IgG TrueBlot for mouse, rabbit, or goat-derived antibodies represents unique series of respective
More informationRayBio Phospho-ERK/JNK/P38α ELISA Kit
RayBio Phospho-ERK/JNK/P38α ELISA Kit For measuring ERK1/2 (T202/Y204), JNK (T183/Y185), P38α (T180/Y182) and Total ERK1/2, JNK, P38α in Human, Mouse and Rat Cell Lysates. User Manual (Revised Aug. 26
More informationCell death analysis using the high content bioimager BD PathwayTM 855 instrument (BD
Supplemental information Materials and Methods: Cell lines, reagents and antibodies: Wild type (A3) and caspase-8 -/- (I9.2) Jurkat cells were cultured in RPMI 164 medium (Life Technologies) supplemented
More informationAlphaScreen SureFire Histone H3 (p-ser10) Assay Kits. Manual
AlphaScreen SureFire Histone H3 (p-ser10) Assay Kits Manual Assay Points Catalog # 500 TGRH3S500 10 000 TGRH3S10K 50 000 TGRH3S50K For Research Use Only Research Reagents for Research Purposes Only TGRKVS22.7
More informationFor in vitro killing assays with lysed cells, neutrophils were sonicated using a 550 Sonic
Supplemental Information Cell Host & Microbe, Volume 8 Statins Enhance Formation of Phagocyte Extracellular Traps Ohn A. Chow, Maren von Köckritz-Blickwede, A. Taylor Bright, Mary E. Hensler, Annelies
More informationSegments of the obstructed intestinal loops were fixed in 4% paraformaldehyde
Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with
More informationEGFR (Phospho-Ser695)
Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 EGFR (Phospho-Ser695) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02090 Please read the provided manual entirely
More informationApplication Note. Introduction. Kerry Thompson, Jeff Partridge, Paula Flaherty, Susan Qian, and Deepa Saxena
Page 1 BD PureCoat ECM Mimetic Cultureware Fibronectin Peptide: Novel Synthetic, Animalfree Surface for Culture of Human Bone Marrow-derived Mesenchymal Stem Cells Kerry Thompson, Jeff Partridge, Paula
More informationSupplementary Online Material
Material and Methods Supplementary Online Material Reagents and antibodies Wortmannin, JNK inhibitor II (Anthra[1,9-cd]pyrazol-6(2H)-one 1,9-pyrazoloanthrone), SB 2358, and PD 9859 were purchased from
More informationHuman Bone Marrow Derived Mesenchymal Stem Cell (MSC) Care Manual
Human Bone Marrow Derived Mesenchymal Stem Cell (MSC) Care Manual INSTRUCTION MANUAL ZBM0101.001 SHIPPING CONDITIONS Human Bone Marrow Derived MSC (HBMMSC-F) Orders are delivered via Federal Express courier.
More information0.5% Triton X-100 for 5 min at room temperature. Fixed and permeabilized cells were
1 Supplementary Methods Immunohistochemistry EBC-1 cells were fixed in 4% paraformaldehyde for 15 min at room temperature, followed by 0.5% Triton X-100 for 5 min at room temperature. Fixed and permeabilized
More informationMatrix IGF-1 regulates bone mass by activation of mtor in. Mesenchymal Stem Cells
Supplemental information Matrix IGF-1 regulates bone mass by activation of mtor in Mesenchymal Stem Cells Lingling Xian, Xiangwei Wu, Lijuan Pang, Michael Lou, Clifford Rosen, Tao Qiu, Janet Crane, Frank
More informationIn-Cell Western Assay
In-Cell Western Assay Complete Sample Protocol for Measuring IC 50 of Inhibitor U0126 in NIH3T3 Responding to Acidic Fibroblast Growth Factor (afgf-1) Developed for: Aerius, Odyssey Classic, Odyssey CLx,
More informationM X 500 µl. M X 1000 µl
GeneGlide TM sirna Transfection Reagent (Catalog # M1081-300, -500, -1000; Store at 4 C) I. Introduction: BioVision s GeneGlide TM sirna Transfection reagent is a cationic proprietary polymer/lipid formulation,
More information. Viability of colonies was then assessed using the WST-1 reagent as described above, and normalized relative to untreated controls.
Cell viability analysis in the absence of disaggregation To assess cell viability in the absence of disaggregation, quintuplicate samples of cells at 5 x 1 5 /ml were treated with mab (1 µg/ml) for 24
More informationProtein A Agarose Immunoprecipitation Kit
Protein A Agarose Immunoprecipitation Kit Catalog Number KA0568 20 Reactions Version: 01 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information...
More informationNature Medicine doi: /nm.3554
SUPPLEMENTARY FIGURES LEGENDS Supplementary Figure 1: Generation, purification and characterization of recombinant mouse IL-35 (ril-35). High-Five insect cells expressing high levels of the bicistronic
More informationSupplementary Fig S1: Bone marrow macrophages and liver Kupffer cells increase IL-1 in response to adenosine signaling. (a) Murine bone marrow
Supplementary Fig S1: Bone marrow macrophages and liver Kupffer cells increase IL-1 in response to adenosine signaling. (a) Murine bone marrow derived macrophages (BMDM) were primed with LPS for 16 hrs,
More informationBeta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand
SUPPLEMENTAL FIGURES Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand C. Ravelli et al. FIGURE S. I Figure S. I: Gremlin
More informationTrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by
Supplemental Information Cell Culture TrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by transducing BBM1 or 361 cells with a lentivirus encoding shrna for TrkB. Transduction was
More informationCytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of
Supplementary Information Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of Syntaxin 1 and SNAP-25 in Neuron Survival Lisheng Peng, Huisheng Liu, Hongyu Ruan, William H. Tepp, William H. Stoothoff,
More informationOsteoblast Differentiation and Mineralization
Osteoblast Differentiation and Mineralization Application Note Background Osteoblasts (HOB) are specialized fibroblasts that secrete and mineralize the bone matrix. They develop from mesenchymal precursors.
More information3 P p25. p43 p41 28 FADD. cflips. PE-Cy5 [Fluorescence intensity]
L S p4 3 D3 76 N S L Ve ct or p4 3 D3 76 N S L Ve ct or A aspase 8 FADD TRAF2 D95-R - + Vector D95L TL I S L D376N T RAIL-R1 T RAIL-R2 D95-R E-y5 [Fluorescence intensity] Supplemental Fig. 1 Different
More informationReal-Time Vital Mineralization Detection and Quantification during In Vitro Osteoblast Differentiation
Serguienko et al. Biological Procedures Online (2018) 20:14 https://doi.org/10.1186/s12575-018-0079-4 METHODOLOGY Real-Time Vital Mineralization Detection and Quantification during In Vitro Osteoblast
More informationB. C. Staurosporine BEZ235 DMSO. -actin. Suppl. Fig. 1 BEZ235 and BGT226 inhibit phosphorylation of Akt and downstream targets of PI3K and mtor.
DMSO Staurosporine BGT226 A. B. C. BGT226 P-Akt 0 1 2 4 8 hrs. P-Akt 0 5 10 25 50 100 nm PS6 P-4E-BP1 -actin C-Caspase3 -actin PS6 P-4E-BP1 -actin Suppl. Fig. 1 and BGT226 inhibit phosphorylation of Akt
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/8/353/353ra113/dc1 Supplementary Materials for Thymidine phosphorylase exerts complex effects on bone resorption and formation in myeloma Huan Liu,
More informationwith Cell Surface-Compatible Universal Cell Capture Kit
MAN-10066-01 with Cell Surface-Compatible Universal Cell Capture Kit In this workflow, cells are collected and then bound to the Universal Cell Capture Beads; then the RNA and Protein samples are prepared
More informationNature Medicine doi: /nm.2558
Supplementary. Fig. 1. (a) Sirt1 and mutant HTT (detected by HTT 81-90 antibody) protein levels were detected by Western blotting in cerebral cortex of N171-82Q mice. (b) Sirt1 and mutant HTT (detected
More informationSupplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,
Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, respectively, and their mrnas were quantified by real time
More informationWT Day 90 after injections
Supplementary Figure 1 a Day 1 after injections Day 9 after injections Klf5 +/- Day 1 after injections Klf5 +/- Day 9 after injections BLM PBS b Day 1 after injections Dermal thickness (μm) 3 1 Day 9 after
More informationProtocols for Neural Progenitor Cell Expansion and Dopaminergic Neuron Differentiation
Protocols for Neural Progenitor Cell Expansion and Dopaminergic Neuron Differentiation In vitro neurological research presents many challenges due to the difficulty in establishing high-yield neuronal
More informationData Sheet. MAPK/ERK Signaling Pathway SRE Reporter HEK293 Cell Line Catalog #: 60406
Data Sheet MAPK/ERK Signaling Pathway SRE Reporter HEK293 Cell Line Catalog #: 60406 Description The MAPK/ERK signaling pathway is a major participant in the regulation of cell growth and differentiation.
More informationAlphaScreen SureFire IκBα Total Assay Kits. Manual
AlphaScreen SureFire IκBα Total Assay Kits Manual Assay Points Catalog # 500 TGRTIKS500 10 000 TGRTIKS10K 50 000 TGRTIKS50K For Research Use Only Research Reagents for Research Purposes Only TGRKVS71.5
More informationHuman/Mouse/Rat Phospho-Akt (S473) Immunoassay
Cell-Based ELISA Human/Mouse/Rat Phospho-Akt (S473) Immunoassay Catalog Number KCB887 An ELISA-based assay using fluorogenic substrates to measure phosphorylated Akt in the context of a whole cell. This
More informationTECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure
Cell-Based ELISA Sampler Kit for detecting phospho-erk1/2 (pthr 202 /ptyr 204 ), phospho-jnk (pthr 183 /ptyr 185 ), and phospho-p38 MAPK (pthr 180 /ptyr 182 ) in cultured cell lines adequate for 192 assays
More informationRapid and sensitive determination of recombinant protein expression
APPLIAION NOE Pro-Detect Rapid assays Rapid and sensitive determination of recombinant protein expression Introduction Recombinant protein expression and purification is a multistep process that includes:
More informationAlphaLISA SureFire Ultra
AlphaLISA SureFire Ultra p-erk 1/2 (Thr202/Tyr204) Assay Kit Manual Assay Points Catalog # 500 ALSU-PERK-A500 10 000 ALSU-PERK-A10K 50 000 ALSU-PERK-A50K For Research Use Only. Not for use in Diagnostic
More informationLSBio TM Mouse/Human/Rat Phospho-SMAD3 Cell-Based Phosphorylation ELISA Kit. Catalog No. LS-F1058. User Manual
LSBio TM Mouse/Human/Rat Phospho-SMAD3 Cell-Based Phosphorylation ELISA Kit Catalog No. LS-F1058 User Manual Please Read the Manual Carefully Before Starting your Experiment For research use only. Not
More informationBafilomycins Produced by an Endophytic Actinomycete Streptomyces sp. YIM56209
Bafilomycins Produced by an Endophytic Actinomycete Streptomyces sp. YIM56209 Zhiguo Yu, 1,2 Li-Xing Zhao, 3 Cheng-Lin Jiang, 3 Yanwen Duan, 2 Lily Wong, 4 Kristopher C. Carver, 4 Linda A. Schuler, 4 and
More information*Corresponding author. Tel: ;
1 SUPPLEMENTARY DATA 2 3 4 5 6 7 8 9 10 11 Integrin 2 1 in nonactivated conformation can induce focal adhesion kinase signaling Maria Salmela 1, Johanna Jokinen 1,2, Silja Tiitta 1, Pekka Rappu 1, Holland
More informationSupplementary Information
Supplementary Information Supplementary Figures Supplementary Figure 1. MLK1-4 phosphorylate MEK in the presence of RAF inhibitors. (a) H157 cells were transiently transfected with Flag- or HA-tagged MLK1-4
More informationAntibodies against PCNA were previously described [1]. To deplete PCNA from Xenopus egg
Supplementary information Supplementary methods PCNA antibody and immunodepletion Antibodies against PCNA were previously described [1]. To deplete PCNA from Xenopus egg extracts, one volume of protein
More informationUsing Sapphire700 Stain and DRAQ5 Stain for Cell Number Normalization
Using Sapphire700 Stain and DRAQ5 Stain for Cell Number Normalization Developed for: Aerius, Odyssey Classic, Odyssey CLx, and Odyssey Sa Infrared Imaging Systems Please refer to your manual to confirm
More informationCell Lysis Kit Product Insert For use with Bio-Plex phosphoprotein assays and Bio-Plex total target assays. Bio-Plex TM
Bio-Plex TM Cell Lysis Kit Product Insert For use with Bio-Plex phosphoprotein assays and Bio-Plex total target assays Now Includes Protocol for Bio-Plex Phospho-Histone H3 Lysate Peparation! For technical
More informationSupplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered
Supplementary Information: Materials and Methods Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered saline (PBS) and lysed in TNN lysis buffer (50mM Tris at ph 8.0, 120mM NaCl
More informationTumor tissues or cells were homogenized and proteins were extracted using
SUPPLEMENTAL MATERIALS AND METHODS Western Blotting Tumor tissues or cells were homogenized and proteins were extracted using T-PER tissue protein extraction buffer. Protein concentrations were determined
More informationEngineering tumors with 3D scaffolds
Engineering tumors with 3D scaffolds Claudia Fischbach, Ruth Chen, Takuya Matsumoto, Tobias Schmelzle, Joan S Brugge, Peter J Polverini & David J Mooney Supplementary figures and text: Supplementary Figure
More informationTechnical Note. Housekeeping Protein Validation Protocol
Technical Note Housekeeping Protein Validation Protocol Published March 2017. The most recent version of this Technical Note is posted at licor.com/bio/support. Visit us on protocols.io! Explore an interactive
More informationPKA α/β CAT (Phospho-Thr197)
Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 PKA α/β CAT (Phospho-Thr197) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG01634 Please read the provided manual
More information(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower
Supplementary Figures S1. (A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: ; lower arrow: KO) and (B) q-pcr analysis with Lin- cells, The white vertical line in panel A indicates that
More informationUser Manual. OriCell TM Mesenchymal Stem Cell Osteogenic Differentiation Medium. Cat. No. GUXMX-90021
User Manual OriCell TM Mesenchymal Stem Cell Osteogenic Differentiation Cat. No. GUXMX-90021 PRODUCT DESCRIPTION: OriCell TM Mesenchymal Stem Cell Osteogenic Differentiation consists of optimized Mesenchymal
More informationQuantiSir General Gene Knockdown Quantification Kit
QuantiSir General Gene Knockdown Quantification Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The QuantiSir General Gene Knockdown Quantification Kit is suitable for quantifying gene
More informationWestern Blot Tool Box
Western Blot Tool Box BOX12/BOX12-03 V1.1 Store at 2-8 C For research use only Introduction The Western Blot Tool Box is designed to conveniently provide reagents/buffers needed for Western blotting, from
More informationCELL-BASED OSTEOGENIC ASSAYS FOR DRUG DISCOVERY AND METASTATIC DISEASES
CELL-BASED OSTEOGENIC ASSAYS FOR DRUG DISCOVERY AND METASTATIC DISEASES Tiana Tonrey MS Jim Musick Ph.D Abstract A cell-based assay for human osteogenesis is described. The assay is based on the differentiation
More informationCOLORIMETRIC GAPDH ASSAY KIT
REF: P40116 CELL-BASED ASSAY KITS COLORIMETRIC GAPDH ASSAY KIT Product Type: Catalog Number: Assay Type: Format: GAPDH Assay Kit P40116 Colorimetric 100 Tests Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH)
More informationCell viability. Cell viability was examined by MTT assay (Sigma-Aldrich).
Supplementary Materials Supplementary materials and methods Cell culture. Primary human dermal fibroblasts (DFs) were isolated from full-thickness skin samples. Tissue samples were dissected into small
More information