Transcription & post transcriptional modification
|
|
- Sydney Warren
- 6 years ago
- Views:
Transcription
1 Transcription & post transcriptional modification
2 Transcription The synthesis of RNA molecules using DNA strands as the templates so that the genetic information can be transferred from DNA to RNA
3 Similarity between replication and transcription Both processes use DNA as the template Phosphodiester bonds are formed in both cases Both synthesis directions are from 5 to 3
4 Differences between replication and transcription replication transcription template double strands single strand substrate dntp NTP primer yes no Enzyme DNA polymerase RNA polymerase product dsdna ssrna base pair A-T, G-C A-U, T-A, G-C
5 Section 1 Template and Enzymes
6 The whole genome of DNA needs to be replicated, but only small portion of genome is transcribed in response to the development requirement, physiological need and environmental changes DNA regions that can be transcribed into RNA are called structural genes
7 1.1 Template The template strand is the strand from which the RNA is actually transcribed. It is also termed as antisense strand The coding strand is the strand whose base sequence specifies the amino acid sequence of the encoded protein, Therefore, it is also called as sense strand
8 5' G C A G T A C A T G T C 3' coding strand 3' C G T C A T G T A C A G 5' template strand transcription 5' G C A G U A C A U G U C 3' RNA
9 Asymmetric transcription Only the template strand is used for the transcription Either strands can be used as a templates The transcription direction on different strands is opposite This feature is referred to as the asymmetric transcription
10 5' 3' 3' 5'
11 Organization of coding information in the adenovirus genome
12 1.2 RNA Polymerase The enzyme responsible for the RNA synthesis is DNA-dependent RNA polymerase The prokaryotic RNA polymerase is a multiple-subunit protein of ~480kD Eukaryotic systems have three kinds of RNA polymerases, each of which is a multiple-subunit protein and responsible for transcription of different RNAs
13 Holoenzyme The holoenzyme of RNA-pol in E.coli consists of 5 different subunits: α, αʹ β βʹ ωσ. holoenzyme core β σ βʹ ω α α
14 RNA-pol of E. Coli subunit MW function α Determine the DNA to be transcribed β Catalyze polymerization βʹ Bind & open DNA template σ Recognize the promoter for synthesis initiation
15 RNA-pol of E. Coli
16
17 Rifampicin, a therapeutic drug for tuberculosis treatment, can bind specifically to the β subunit of RNA-pol, and inhibit the RNA synthesis RNA-pol of other prokaryotic systems is similar to that of E. coli in structure and functions
18
19 RNA-pol of eukaryotes RNA-pol I II III products 45S rrna hnrna 5S rrna trna snrna Sensitivity to Amanitin No high moderate Amanitin is a specific inhibitor of RNA-pol.
20
21 1.3 Recognition of Origins Each transcriptable region is called operon One operon includes several structural genes and upstream regulatory sequences (or regulatory regions) The promoter is the DNA sequence that RNA-pol can bind. It is the key point for the transcription control
22 Promoter 5' 3' regulatory sequences promotor RNA-pol structural gene 3' 5'
23 Prokaryotic promoter 5' 3' region T T G A C A A A C T G T -10 region T A T A A T A T A T T A (Pribnow box) Consensus sequence start 3' 5'
24 Consensus Sequence
25 The -35 region of TTGACA sequence is the recognition site and the binding site of RNA-pol The -10 region of TATAAT is the region at which a stable complex of DNA and RNA-pol is formed
26
27 Section 2 Transcription Process
28 General concepts Three phases: initiation, elongation, and termination The prokaryotic RNA-pol can bind to the DNA template directly in the transcription process The eukaryotic RNA-pol requires cofactors to bind to the DNA template together in the transcription process
29 2.1 Transcription of Prokaryotes Initiation phase: RNA-pol recognizes the promoter and starts the transcription Elongation phase: the RNA strand is continuously growing Termination phase: the RNA-pol stops synthesis and the nascent RNA is separated from the DNA template
30 a. Initiation RNA-pol recognizes the TTGACA region, and slides to the TATAAT region, then opens the DNA duplex. Step for initiation Promoter binding DNA Unwinding RNA chain initiation
31
32
33
34
35
36 The first nucleotide on RNA transcript is always purine triphosphate; GTP is more often than ATP The pppgpn-oh structure remains on the RNA transcript until the RNA synthesis is completed The three molecules form a transcription initiation complex RNA-pol (α 2 ββʹ σ) - DNA - pppgpn- OH 3ʹ
37 No primer is needed for RNA synthesis. The σ subunit falls off from the RNApol once the first 3ʹ,5ʹ phosphodiester bond is formed. The core enzyme moves along the DNA template to enter the elongation phase.
38 b. Elongation The release of the σ subunit causes the conformational change of the core enzyme. The core enzyme slides on the DNA template toward the 3ʹ end. Free NTPs are added sequentially to the 3ʹ -OH of the nascent RNA strand. (NMP) n + NTP RNA strand substrate (NMP) n+1 + PPi elongated RNA strand
39 RNA-pol, DNA segment of ~40nt and the nascent RNA form a complex called the transcription bubble. The 3ʹ segment of the nascent RNA hybridizes with the DNA template, and its 5ʹ end extends out the transcription bubble as the synthesis is processing.
40 Transcription bubble
41 RNA-pol of E. Coli
42 c. Termination The RNA-pol stops moving on the DNA template. The RNA transcript falls off from the transcription complex. The termination occurs in either ρ - dependent or ρ -independent manner.
43 The termination function of ρ factor The ρ factor, a hexamer, is a ATPase and a helicase.
44 ρ-independent termination The termination signal is a stretch of nucleotides on the RNA transcript, consisting of many GC followed by a series of U. The sequence specificity of this nascent RNA transcript will form particular stem-loop structures to terminate the transcription.
45 DNA rpll protein 5ʹ TTGCAGCCTGACAAATCAGGCTGATGGCTGGTGACTTTTTAGGCACCAGCCTTTTT... 3ʹ 5ʹ TTGCAGCCTGACAAATCAGGCTGATGGCTGGTGACTTTTTAGTCACCAGCCTTTTT... 3ʹ RNA UUUU... UUUU...
46
47 Stem-loop disruption The stem-loop structure alters the conformation of RNA-pol, leading to the pause of the RNA-pol moving Then the competition of the RNA- RNA hybrid and the DNA-DNA hybrid reduces the DNA-RNA hybrid stability, and causes the transcription complex dissociated Among all the base pairings, the most unstable one is ru:da
48 2.2 Transcription of Eukaryotes a. Initiation Transcription initiation needs promoter and upstream regulatory regions. The cis-acting elements are the specific sequences on the DNA template that regulate the transcription of one or more genes.
49 Cis-acting element cis-acting element GCGC CAAT TATA exon structural gene intron exon start TATA box (Hogness box) enhancer CAAT box GC box
50 TATA box
51 Transcription factors RNA-pol does not bind the promoter directly. RNA-pol II associates with six transcription factors, TFII A - TFII H. The trans-acting factors are the proteins that recognize and bind directly or indirectly cis-acting elements and regulate its activity.
52 TF for eukaryotic transcription
53 Pre-initiation complex (PIC) TBP of TFII D binds TATA TFII A and TFII B bind TFII D TFII F-RNA-pol complex binds TFII B TFII F and TFII E open the dsdna TFII H: completion of PIC helicase and ATPase kinases (phosphorylation Of CTD)
54 Pre-initiation complex (PIC) RNA pol II TF II A TBP TAF TATA TF II F TF II B TF II E TF II H DNA
55
56
57 Phosphorylation of RNA-pol TF II H is of protein kinase activity to phosphorylate CTD of RNA-pol. (CTD is the C-terminal domain of RNA-pol) Only the RNA-pol can move toward the downstream, starting the elongation phase Most of the TFs fall off from PIC during the elongation phase
58 b. Elongation The elongation is similar to that of prokaryotes. The transcription and translation do not take place simultaneously since they are separated by nuclear membrane.
59 b. Elongation
60 c. Termination The termination sequence is AATAAA followed by GT repeats. The termination is closely related to the post-transcriptional modification.
61
62
63 Section 3 Post-Transcriptional Modification
64
65
66 3.1 Modification of hnrna Primary transcripts of mrna are called as heteronuclear RNA (hnrna). hnrna are larger than matured mrna by many folds. Modification includes Capping at the 5ʹ - end Tailing at the 3ʹ - end mrna splicing RNA edition
67 a. Capping at the 5ʹ - end OH OH O O O H N 2 N N H 2 C O P HN N 5' O O O P O O O P O O 5' CH 2 O N N N NH NH 2 O CH 3 Pi O O P O OH AAAAA-OH 3' O m 7 GpppGp----
68 ppp 5' NpNp pp 5' NpNp Pi removing g phosphate group G 5' ppp 5' NpNp GTP PPi forming 5'-5' triphosphate group methylating at G7 m 7 GpppNpNp m 7 Gpppm 2' Npm 2' Np methylating at C2' of the first and second nucleotides after G
69 The 5ʹ - cap structure is found on hnrna too. The capping process occurs in nuclei. The cap structure of mrna will be recognized by the cap-binding protein required for translation. The capping occurs prior to the splicing.
70 b. Poly-A tailing at 3ʹ - end
71
72 c. mrna splicing mrna DNA The matured mrnas are much shorter than the DNA templates.
73 Split gene The structural genes are composed of coding and non-coding regions that are alternatively separated bp L A B C D E F G A~G no-coding region 1~7 coding region
74 Exon and intron Exons are the coding sequences that appear on split genes and primary transcripts, and will be expressed to matured mrna. Introns are the non-coding sequences that are transcripted into primary mrnas, and will be cleaved out in the later splicing process.
75 mrna splicing
76 Splicing mechanism
77 lariat
78 Twice transesterification intron 5'exon 3'exon 5' U pa G pu 3' pg-oh pgpa 5' UOH first transesterification G pu 3' 5' U pu 3' second transesterification 5' pgpa GOH 3'
79
80
81
82
83
84
85
86 U1 AGGURAGU U2AF 65kDa 35kDa CURACU Y(n)NCAGG SF1 ESE ESE ISE ESS ISS Trans-acting factor Splicing coactivator Cis-acting factor U1 AGGURAGU U2 U2AF 65kDa 35kDa CURACU Y(n)NCAGG SF1 SR ESE Modified from Black 2003, Cartegni 2002, and Patel,AA 2003
87 Cis- ac3ng element Classical splice motif 5 prime splice site 3 prime splice site Branch point Polypyrimidine tract Auxiliary splice motif Exonic sequence enhancer Exonic sequence silencer Intronic sequence enhancer Intronic sequence silencer
88 U1 AGGURAGU U2AF 65kDa 35kDa CURACU Y(n)NCAGG SF1 Splicing coactivator SR U1 AGGURAGU U2 U2AF 65kDa 35kDa CURACU Y(n)NCAGG SF1 ESE Modified from Black 2003, Cartegni 2002, and Patel,AA 2003
89 Splicing coactivator U1 AGGURAGU U2 U2AF 65kDa 35kDa CURACU Y(n)NCAGG SF1 SR ESE Modified from Black 2003, Cartegni 2002, and Patel,AA 2003
90 U1 AGGURAGU U2AF 65kDa 35kDa CURACU Y(n)NCAGG SF1 hnrnp U1 AGGURAGU U2 U2AF 65kDa 35kDa CURACU Y(n)NCAGG SF1 ESS Modified from Black 2003, Cartegni 2002, and Patel,AA 2003
91 U1 AGGURAGU U2 U2AF 65kDa 35kDa CURACU Y(n)NCAGG SF1 hnrnp ESS Modified from Black 2003, Cartegni 2002, and Patel,AA 2003
92
93
Chapter 11. Transcription. The biochemistry and molecular biology department of CMU
Chapter 11 Transcription The biochemistry and molecular biology department of CMU Transcription The synthesis of RNA molecules using DNA strands as the templates so that the genetic information can be
More informationDNA Transcription. Dr Aliwaini
DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger
More informationRNA synthesis/transcription I Biochemistry 302. February 6, 2004 Bob Kelm
RNA synthesis/transcription I Biochemistry 302 February 6, 2004 Bob Kelm Overview of RNA classes Messenger RNA (mrna) Encodes protein Relatively short half-life ( 3 min in E. coli, 30 min in eukaryotic
More informationTranscription. By : Lucia Dhiantika Witasari M.Biotech., Apt
Transcription By : Lucia Dhiantika Witasari M.Biotech., Apt REGULATION OF GENE EXPRESSION 11/26/2010 2 RNA Messenger RNAs (mrnas) encode the amino acid sequence of one or more polypeptides specified by
More informationTRANSCRIPTION AND PROCESSING OF RNA
TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural
More informationSIBC504: TRANSCRIPTION & RNA PROCESSING Assistant Professor Dr. Chatchawan Srisawat
SIBC504: TRANSCRIPTION & RNA PROCESSING Assistant Professor Dr. Chatchawan Srisawat TRANSCRIPTION: AN OVERVIEW Transcription: the synthesis of a single-stranded RNA from a doublestranded DNA template.
More informationM1 - Biochemistry. Nucleic Acid Structure II/Transcription I
M1 - Biochemistry Nucleic Acid Structure II/Transcription I PH Ratz, PhD (Resources: Lehninger et al., 5th ed., Chapters 8, 24 & 26) 1 Nucleic Acid Structure II/Transcription I Learning Objectives: 1.
More informationRNA Expression of the information in a gene generally involves production of an RNA molecule transcribed from a DNA template. RNA differs from DNA
RNA Expression of the information in a gene generally involves production of an RNA molecule transcribed from a DNA template. RNA differs from DNA that it has a hydroxyl group at the 2 position of the
More informationBIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 12 Transcription
BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 12 Transcription 2 3 4 5 Are You Getting It?? Which are general characteristics of transcription? (multiple answers) a) An entire DNA molecule is transcribed
More informationChapter 3. DNA, RNA, and Protein Synthesis
Chapter 3. DNA, RNA, and Protein Synthesis 4. Transcription Gene Expression Regulatory region (promoter) 5 flanking region Upstream region Coding region 3 flanking region Downstream region Transcription
More informationChapters 31-32: Ribonucleic Acid (RNA)
Chapters 31-32: Ribonucleic Acid (RNA) Short segments from the transcription, processing and translation sections of each chapter Slide 1 RNA In comparison with DNA RNA utilizes uracil in place of thymine
More informationGENETICS - CLUTCH CH.10 TRANSCRIPTION.
!! www.clutchprep.com CONCEPT: OVERVIEW OF TRANSCRIPTION Transcription is the process of using DNA as a template to RNA RNA polymerase is the enzyme that transcribes DNA - There are many different types
More informationTranscription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
More informationThe discovery of the role of RNA RNA structure, synthesis and function
Central Dogma The discovery of the role of RNA RNA structure, synthesis and function! Fundamental observations in genetics!! Genes are located in nuclei (in eukaryotes)!! Polypeptides are synthesised in
More informationTranscription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
More information30 Gene expression: Transcription
30 Gene expression: Transcription Gene structure. o Exons coding region of DNA. o Introns non-coding region of DNA. o Introns are interspersed between exons of a single gene. o Promoter region helps enzymes
More informationGene Expression: Transcription, Translation, RNAs and the Genetic Code
Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a
More informationChapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics
Chapter 8 Lecture Outline Transcription, Translation, and Bioinformatics Replication, Transcription, Translation n Repetitive processes Build polymers of nucleotides or amino acids n All have 3 major steps
More informationTranscription. Manzur Ali PP, DBT,M.E.S College,Marampally
Transcription Manzur Ali PP, DBT,M.E.S College,Marampally manzursir@gmail.com RNA transcription is actively regulated Not all DNA is transcribed in a given cell (less than 50% even in prokaryotes) For
More informationExpression of the genome. Books: 1. Molecular biology of the gene: Watson et al 2. Genetics: Peter J. Russell
Expression of the genome Books: 1. Molecular biology of the gene: Watson et al 2. Genetics: Peter J. Russell 1 Transcription 1. Francis Crick (1956) named the flow of information from DNA RNA protein the
More informationMolecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code
Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)
More informationRNA metabolism. DNA dependent synthesis of RNA RNA processing RNA dependent synthesis of RNA and DNA.
RNA metabolism DNA dependent synthesis of RNA RNA processing RNA dependent synthesis of RNA and DNA http://www.youtube.com/watch?v=ovc8nxobxmq DNA dependent synthesis of RNA : production of an RNA molecule
More informationInformation Readout: Transcription and Post-transcriptional Processing Translation
Information Readout: Transcription and Post-transcriptional Processing Translation Copyright 2013 Pearson Canada Inc. 27-1 DNA as the Template for RNA Synthesis Enzymology of RNA Synthesis: RNA Polymerase
More informationLecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points?
BCH 401G Lecture 37 Andres Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? RNA processing: Capping, polyadenylation, splicing. Why process mammalian
More informationComputational Biology I LSM5191 (2003/4)
Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression I Flow of information: DNA to polypeptide DNA Start Exon1 Intron Exon2 Termination
More informationRNA: Structure & Synthesis. Amr S. Moustafa, M.D.; Ph.D.
RNA: Structure & Synthesis By Amr S. Moustafa, M.D.; Ph.D. Objectives The differences between DNA and RNA The structure and functions of RNAs RNA synthesis (Transcription) Post-transcriptional events (modifications)
More informationTranscription in Prokaryotes. Jörg Bungert, PhD Phone:
Transcription in Prokaryotes Jörg Bungert, PhD Phone: 352-273-8098 Email: jbungert@ufl.edu Objectives Understand the basic mechanism of transcription. Know the function of promoter elements and associating
More informationRNA : functional role
RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying
More informationBiochemistry Eukaryotic Transcription
1 Description of Module Subject Name Paper Name Module Name/Title Dr. Vijaya Khader Dr. MC Varadaraj 2 1. Objectives 1. Understand and have an overview of eucaryotic transcriptional regulation. 2. Explain
More informationTranscription steps. Transcription steps. Eukaryote RNA processing
Transcription steps Initiation at 5 end of gene binding of RNA polymerase to promoter unwinding of DNA Elongation addition of nucleotides to 3 end rules of base pairing requires Mg 2+ energy from NTP substrates
More informationTranscription is the first step of gene expression, in which a particular segment of DNA is copied into RNA by the enzyme, RNA polymerase.
Transcription in Bacteria Transcription in Bacteria Transcription in Bacteria Transcription is the first step of gene expression, in which a particular segment of DNA is copied into RNA by the enzyme,
More informationBCH 4054 Fall 2000 Chapter 31 Lecture Notes
BCH 4054 Fall 2000 Chapter 31 Lecture Notes 1 Chapter 31 Transcription and Regulation of Gene Expression 2 Messenger RNA Central Dogma (Francis Crick, 1958) DNA RNA Protein (Fig 31.1) Jacob-Monod Hypothesis:
More informationTranscription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.
Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally
More informationBasi s c i Fea e tu t re r s s of f R NA N Sy S nth t esi s s i s
Transcription Dr.H.B.Mahesha, Yuvaraja s College, University of Mysore, Mysuru. It is the process of transcribing or making a copy of Genetic information stored in a DNA strand into a Complementary strand
More informationI. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
More informationFeedback D. Incorrect! No, although this is a correct characteristic of RNA, this is not the best response to the questions.
Biochemistry - Problem Drill 23: RNA No. 1 of 10 1. Which of the following statements best describes the structural highlights of RNA? (A) RNA can be single or double stranded. (B) G-C pairs have 3 hydrogen
More informationProtein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
More informationProofreading, post-replication modification of DNA. Mitesh Shrestha
Proofreading, post-replication modification of DNA Mitesh Shrestha Proofreading During DNA replication (copying), most DNA polymerases can check their work with each base that they add. This process is
More informationMechanisms of Transcription. School of Life Science Shandong University
Mechanisms of Transcription School of Life Science Shandong University Ch 12: Mechanisms of Transcription 1. RNA polymerase and the transcription cycle 2. The transcription cycle in bacteria 3. Transcription
More informationChapter Fundamental Molecular Genetic Mechanisms
Chapter 5-1 - Fundamental Molecular Genetic Mechanisms 5.1 Structure of Nucleic Acids 5.2 Transcription of Protein-Coding Genes and Formation of Functional mrna 5.3 The Decoding of mrna by trnas 5.4 Stepwise
More informationTranscription and Post Transcript Modification
Transcription and Post Transcript Modification You Should Be Able To 1. Describe transcription. 2. Compare and contrast eukaryotic + prokaryotic transcription. 3. Explain mrna processing in eukaryotes.
More informationTRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long
Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double
More informationLecture 11. Initiation of RNA Pol II transcription. Transcription Initiation Complex
Lecture 11 *Eukaryotic Transcription Gene Organization RNA Processing 5 cap 3 polyadenylation splicing Translation Initiation of RNA Pol II transcription Consensus sequence of promoter TATA Transcription
More informationTranscription is the first stage of gene expression
Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the
More informationChromatographic Separation of the three forms of RNA Polymerase II.
Chromatographic Separation of the three forms of RNA Polymerase II. α-amanitin α-amanitin bound to Pol II Function of the three enzymes. Yeast Pol II. RNA Polymerase Subunit Structures 10-7 Subunit structure.
More informationThemes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
More informationDNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses.
Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Genetic information is encoded as a sequence of nucleotides (guanine,
More informationWe can now identify three major pathways of information flow in the cell (in replication, information passes from one DNA molecule to other DNA
1 We can now identify three major pathways of information flow in the cell (in replication, information passes from one DNA molecule to other DNA molecules; in transcription, information passes from DNA
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationEukaryotic & Prokaryotic Transcription. RNA polymerases
Eukaryotic & Prokaryotic Transcription RNA polymerases RNA Polymerases A. E. coli RNA polymerase 1. core enzyme = ββ'(α)2 has catalytic activity but cannot recognize start site of transcription ~500,000
More informationBIOLOGY - CLUTCH CH.17 - GENE EXPRESSION.
!! www.clutchprep.com CONCEPT: GENES Beadle and Tatum develop the one gene one enzyme hypothesis through their work with Neurospora (bread mold). This idea was later revised as the one gene one polypeptide
More informationThe 5' cap (red) is added before synthesis of the primary transcript is complete. A non coding sequence following the last exon is shown in orange.
RNA PROCESSING The 5' cap (red) is added before synthesis of the primary transcript is complete. A non coding sequence following the last exon is shown in orange. Splicing can occur either before or after
More informationCh. 10 From DNA to Protein. AP Biology
Ch. 10 From DNA to Protein Protein Synthesis Metabolism and Gene Expression n Inheritance of metabolic diseases suggests that genes coded for enzymes n Diseases (phenotypes) caused by non-functional gene
More informationDNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks.
DNA REPLICATION 5 4 Phosphate 3 DNA structure Nitrogenous base 1 Deoxyribose 2 Nucleotide DNA strand = DNA polynucleotide 2004 Biology Olympiad Preparation Program 2 2004 Biology Olympiad Preparation Program
More informationDNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
More informationChapter 11 Part A: Metabolism: The synthesis of nucleic acids and proteins
Chapter 11 Part A: Metabolism: The synthesis of nucleic acids and proteins I. Synthesis of DNA = REPLICATION A. Components of DNA (Fig. 11-1) 1. Composed of 4 different nucleotides that are joined by the
More informationNucleic Acids and the Encoding of Biological Information. Chapter 3
Nucleic Acids and the Encoding of Biological Information Chapter 3 GRIFFITH S EXPERIMENT ON THE NATURE OF THE GENETIC MATERIAL In 1928, Frederick Griffith demonstrated that molecules can transfer genetic
More informationYear III Pharm.D Dr. V. Chitra
Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves
More informationSCBC203 Gene Expression. Assoc. Prof. Rutaiwan Tohtong Department of Biochemistry Faculty of Science PR318
SCBC203 Gene Expression Assoc. Prof. Rutaiwan Tohtong Department of Biochemistry Faculty of Science PR318 Rutaiwan.toh@mahidol.ac.th 1 Gene Expression Gene expression is a process where by the genetic
More informationFermentation. Lesson Overview. Lesson Overview 13.1 RNA
13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationAnswers to Module 1. An obligate aerobe is an organism that has an absolute requirement of oxygen for growth.
Answers to Module 1 Short Answers 1) What is an obligate aerobe? An obligate aerobe is an organism that has an absolute requirement of oxygen for growth. What about facultative anaerobe? 2) Distinguish
More informationDIFFERENT ASPECTS OF GENE REGULATION
TARTU UNIVERSITY FACULTY OF BILOGY AND GEOGRAPHY DIFFERENT ASPECTS OF GENE REGULATION TARTU 2005 Sten Ilmjärv 2 TABLE OF CONTENT TABLE OF CONTENT...2 GLOSSARY...3 INTRODUCTION...4 1. THE GENE...5 2. GENE
More informationTranscription & RNA Processing
Chapter 10. Transcription & RNA Processing 1. Transfer of Genetic Information: the Central Dogma 2. The Process of Gene Expression 3. Transcription & RNA Processing in Eukaryotes 4. Interrupted Genes in
More informationThe Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot
The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino
More informationBEADLE & TATUM EXPERIMENT
FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in
More informationFigure A summary of spontaneous alterations likely to require DNA repair.
DNA Damage Figure 5-46. A summary of spontaneous alterations likely to require DNA repair. The sites on each nucleotide that are known to be modified by spontaneous oxidative damage (red arrows), hydrolytic
More informationChapter 2. An Introduction to Genes and Genomes
PowerPoint Lectures for Introduction to Biotechnology, Second Edition William J.Thieman and Michael A.Palladino Chapter 2 An Introduction to Genes and Genomes Lectures by Lara Dowland Chapter Contents
More informationDNA Prokaryote Transcription Steps (updated February 2013)
URS AACTGT ATATTA - 35-10 transcription Pribnow Box discriminator +1 AGGAGGT TTA TCCTCCA ATT Gene C TGA TAG ACT ATC rho or GC hairpin loop transcription termination DNA Prokaryote Transcription Steps (updated
More informationFrom RNA To Protein
From RNA To Protein 22-11-2016 Introduction mrna Processing heterogeneous nuclear RNA (hnrna) RNA that comprises transcripts of nuclear genes made by RNA polymerase II; it has a wide size distribution
More informationChapter 12: Molecular Biology of the Gene
Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,
More informationThere are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal.
1 2 Continuous genes - Intron: Many eukaryotic genes contain coding regions called exons and noncoding regions called intervening sequences or introns. The average human gene contains from eight to nine
More informationDNA Replication and Repair
DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands
More informationRNA Metabolism Chap 26, part I
RNA Metabolism Chap 26, part I mrna (selective and regulated) trna rrna other (specialized) RNAs (eukaryotes!!!) processing transcriptome (Surprisingly, much of your genome is transcribed!) RNA is the
More informationDNA Topoisomerases relieve the supercoiling stress ahead of the fork
DNA Topoisomerases relieve the supercoiling stress ahead of the fork Tw 1) T w : # of turns around the central axis 2) W r : # of times the double helix crosses itself 3) Linking Number: L k = T w + W
More informationGenes and How They Work. Chapter 15
Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central
More informationBIO 311C Spring Lecture 36 Wednesday 28 Apr.
BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through
More informationResources. This lecture Campbell and Farrell's Biochemistry, Chapter 11
Transcription Resources This lecture Campbell and Farrell's Biochemistry, Chapter 11 2 Definition of a gene The entire nucleic acid sequence that is necessary for the synthesis of a functional polypeptide
More informationA. Incorrect! This feature does help with it suitability as genetic material.
College Biology - Problem Drill 08: Gene Structures and Functions No. 1 of 10 1. Which of the statements below is NOT true in explaining why DNA is a suitable genetic material? #01 (A) Its double helix
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationGene function at the level of traits Gene function at the molecular level
Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines
More informationDNA Transcription. Visualizing Transcription. The Transcription Process
DNA Transcription By: Suzanne Clancy, Ph.D. 2008 Nature Education Citation: Clancy, S. (2008) DNA transcription. Nature Education 1(1) If DNA is a book, then how is it read? Learn more about the DNA transcription
More informationRegulation of bacterial gene expression
Regulation of bacterial gene expression Gene Expression Gene Expression: RNA and protein synthesis DNA ----------> RNA ----------> Protein transcription translation! DNA replication only occurs in cells
More informationDNA, RNA, Replication and Transcription
Harriet Wilson, Lecture Notes Bio. Sci. 4 - Microbiology Sierra College DNA, RNA, Replication and Transcription The metabolic processes described earlier (glycolysis, cellular respiration, photophosphorylation,
More informationBiochemistry 111. Carl Parker x A Braun
Biochemistry 111 Carl Parker x6368 101A Braun csp@caltech.edu Central Dogma of Molecular Biology DNA-Dependent RNA Polymerase Requires a DNA Template Synthesizes RNA in a 5 to 3 direction Requires ribonucleoside
More informationInitiation and termination of transcription, Post transcription modification of the RNA. Mitesh Shrestha
Initiation and termination of transcription, Post transcription modification of the RNA Mitesh Shrestha Transcription: overview In prokaryotes transcription and translation are coupled. Proteins are synthesized
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationChapter 11 DNA Replication and Recombination
Chapter 11 DNA Replication and Recombination Copyright Copyright 2009 Pearson 2009 Pearson Education, Education, Inc. Inc. 11.1 DNA is reproduced by Semiconservative Replication The complementarity of
More informationMolecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.
Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions
More informationBS 50 Genetics and Genomics Week of Oct 24
BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.
More informationUnit IX Problem 3 Genetics: Basic Concepts in Molecular Biology
Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated to synthesize
More informationBiological information flow
BCMB 3100 Chapters 36-38 Transcription & RNA Processing Definition of gene RNA Polymerase Gene coding vs template strand Promoter Transcription in E. coli Transcription factors mrna processing Biological
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationKey Area 1.3: Gene Expression
Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?
More informationCLEP Biology - Problem Drill 11: Transcription, Translation and The Genetic Code
CLEP Biology - Problem Drill 11: Transcription, Translation and The Genetic Code No. 1 of 10 1. Three types of RNA comprise the structural and functional core for protein synthesis, serving as a template
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationTranscription and Translation
Transcription and Translation Central Dogma of Molecular The flow of information in the cell starts at DNA, which replicates to form more DNA. Information is then transcribed into RNA, and then it is translated
More informationTranscription: Synthesis of RNA
Transcription: Synthesis of RNA The flow of information in the cells (the central dogma of molecular biology): Transcription = RNA synthesis on a DNA template. The mrna will provide the information for
More informationVideos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
More information