3. INHERITED MUTATIONS

Transcription

1 THE CENTRAL DOGMA OF BIOLOGY

2 1. DNA B4.2 The genetic information encoded in DNA molecules provides instructions for assembling protein molecules. Genes are segments of DNA molecules. Inserting, deleting, or substituting DNA segments can alter genes. An altered gene may be passed on to every cell that develops from it. The resulting features may help, harm, or have little or no effect on the offspring s success in the environment.

3 2.DNA TERMS 1. DNA deoxyribonucleic acid, genetic material for almost all living things 2.Nucleotide monomer of nucleic acid, made up of a five carbon sugar, a phosphate group, and a nitrogenous base 3. Nitrogenous bases adenine, guanine, cytosine, thymine, and uracil 4.Double-helix twisted double ladder, shape of DNA 5. Genes unit of heredity, located on chromosome

4 DNA TERMS 6. Amino acid - strung together to make protein 7. Polypeptide polymer of many amino acids linked together by peptide bond 8. Transcription process of mrna being made from DNA template 9. Translation process of ribosomes using the sequence of mrna to create a sequence of amino acids that will form a protein 10. Mutation change in DNA sequence that affects the genetic information

5 3. INHERITED MUTATIONS When mutations occur in sex cells, they can be passed on to offspring (inherited mutations), but if they occur in other cells, they can be passed onto descendant cells only (noninherited mutations). (B4.2A)

6 1. GAMETES (SEX CELLS) a. Made by meiosis for the sole purpose of sexual reproduction. b. Sperm and egg will fuse to form an entire new living organism. c. So if a mutation occurs to the chromosomes in a gamete cell then the mutation will be passed onto the offspring. 2. SOMATIC CELLS (NORMAL BODY CELLS) a. Made by mitosis for the purpose to making cells that are identical b. Daughter cells are identical parent cells c. If a mutation occurs to the chromosomes in a normal body cell all the cells that descend from it will have the mutation, not the entire organism.

7 CHARACTERISTIC DNA SEQUENCE. (B4.2B) 1. Each species has its own specific DNA sequence that determines all the special characteristics of the species. **the base pair can occur in any order **total possible nucleotide sequences is The Human Genome Project a. constructed a map that showed the sequence of base pairs along our chromosomes and b. showed the sequence of genes along the human chromosome

8 FUNCTION OF DNA. (B4.2C) 1. Structure i. Double-helix DNA is a twisted ladder ii. Sugar(Deoxyribose) phosphate backbone make up the sides iii. Hydrogen bonded bases make up the rungs or steps of the ladder 1.Nitrogenous bases: adenine, guanine, cytosine, and thymine 2.In each species the amount of A=T, and C=G

9 2. Function i. Stores information to be passed from one generation to the next ii. Is replicated iii. And undergo mutations

10 6. DNA REPLICATION 1. Replication making a copy of DNA -- occurs during S-phase of the cell cycle before cell division unzips --parent DNA molecule unwinds and --each old strand acts as template for a new strand --semiconservative = each new strand contains an old and a new strand

11 DNA REPLICATION A. PROKARYOTES B. EUKARYOTES 1. single DNA loop 2. replication can take place in either a single direction or both directions around the loop, depending bacteria type 3. able to replicate in 20 minutes 1. DNA replication begins at numerous origins of replication along the length of the chromosomes creating a replication fork that brings the strand back together 2. takes a few hours to copy all 6 billion base pairs found in humans

12 REPLICATION i. Unwinding the old stands that make up the parent DNA molecule are unwound and unzipped 1. Helicase is the enzyme that breaks the hydrogen bonds between bases

13 REPLICATION ii. Complementary base pairing new complementary nucleotides, always present in the nucleus, are positioned by the process of complementary base pairing 1.DNA polymerase enzyme that joins bases together

14 REPLICATION iii. Joining The complementary nucleotides join to form new strands. 1.Each daughter DNA molecule has one and one new strand a. Semiconservative each new strand has one old strand and new strand. strand

15 REPLICATION **For the DNA sequences create the replicated DNA strands, using complementary base pairs ATCGACCTAACCGGAGTACCTTAATTAAGCATCT TAGCTGGATTGGCCTCATGGAATTAATTCGTAGA

16 PROTEIN SYNTHESIS B4.2X Protein synthesis begins with the information in a sequence of DNA bases being copied onto messenger RNA. This molecule moves from the nucleus to the ribosome in the cytoplasm where it is read. Transfer RNA brings amino acids to the ribosomes, where they are connected in the correct sequence to form a specific protein.

17 PROTEIN SYNTHESIS TERMS Protein synthesis process of making proteins using mrna and trna to join together amino acids in peptide bonds RNA ribonucleic acid, sugar(ribose), phosphate, and nitrogenous bases (guanine, adenine, cytosine, and Uracil instead of thymine), and single stranded mrna serve as messengers from DNA, acts template for protein

18 PROTEIN SYNTHESIS TERMS trna brings amino acid that matches mrna rrna holds the mrna-trna complex together at the ribosome codon three consecutive nucleotides

19 8. THE CENTRAL DOGMA OF BIOLOGY A. Says that the genetic information in DNA molecules provides instructions for assembling protein molecules and that this is virtually the same mechanism for all life forms. (B4.2f) B. Describes the processes of replication, transcription, and translation and how they relate to each other in molecular biology. (B4.2g)

20 CENTRAL DOGMA OF BIOLOGY **Central Dogma of Biology --Proteins come from RNA and RNA comes from DNA --So DNA specifies the production of proteins!!! --Genetic code is universal --Each codon is made of three DNA nucleotides --Except for stop codons all codons code for amino acids

21 9. TRANSCRIPTION a. Transcription making mrna from a strand of DNA i. Occurs in nucleus ii. Complementary RNA is made from DNA iii. Uses the enzyme RNA polymerase 1.Breaks the hydrogen bonds between bases of DNA at the promoter (origin of transcription) 2.Unwinds, unzips, and complementary RNA nucleotides are joined together

22 TRANSCRIPTION iv. after RNA polymerase (at the terminator stops transcriptions) passes the original DNA retakes its shape v. The mrna is modified after its production to optimize its production of proteins 1. Introns segments of DNA that never get expressed a. Get cut out 2. Exons segments of DNA that get expressed 3. Spliceosomes result of the clipping and splicing of introns and exons to produce mature mrna

23 10. TRANSLATION A. Translation mrna is involved in protein synthesis i. Takes place in the cytoplasm ii. Sequence of mrna at a ribosomes directs the sequence of amino acids iii. trna bind with one particular amino (anticodon) acid

24 TRANSLATION iv. trna is complementary to mrna v. at least one trna molecule for each of the amino acids vi. carried out by amino acid activating enzymes trna synthases

25 TRANSLATION vii. peptide bonds form between amino acids that have been strung together at the ribosome by matching codons of mrna and anticodons of trna viii. start codon is always AUG methionine ix. stop codons do not specify an amino acids --UAA, UGA, UAG

26 **Using the following original DNA sequence TAC TTT TGG --Transcribe the mrna codons --state the amino acids --Translate the trna anticodons

27 11. TRANSPOSONS = JUMPING GENES 1. Groups of genes that move and can alter the expression of surrounding genes, to either increase or decrease normal function. a. May cause uncontrolled cell growth indicative of cancer b. Cause localized mutations c. Carry genes that lead to translocation, deletions, and inversions of genes on chromosomes d. Leave copies of themselves behind that can cause chromosomal duplication e. Contain genes that may make a bacterium become resistant to antibiotics ** may be source of evolution

28 12. MUTATIONS i. Spontaneous happen for no apparent reason 1.ONLY ONE MISTAKE IN ONE BILLION NULCEOTIDES is due to problems with DNA replication

29 THAT INCREASES THE CHANCES OF MUTATION 1. Carcinogens cancer causing agents a. Tobacco b. Radiation i. X-rays ii. UV light iii. Radon c. Alcohol d. Asbestos e. Vinyl chloride f. Formaldehyde g. Hormone therapy h. Nitrites in food (hotdogs, beef jerky, etc) i. Smoked foods j. Salt-cured foods k. Viral infection i. HPV changes the cells of the cervix leading to increase chances of cervical cancer

30 (E.G. SICKLE CELL ANEMIA, OTHER). (B4.2D) 1. Genes specify a polypeptide 2. If the gene is changed then the polypeptide is changed 3. One gene one polypeptide hypothesis

31 15. THE EFFECTS (ON THE GENES) OF EXPOSING AN ORGANISM TO RADIATION AND TOXIC CHEMICALS. (B4.2E) 1. Mutation change in DNA -Due to a change in base sequences -Changes lead to malfunctioning proteins -Effect on phenotype of organism can be dramatic or even lead to the development of cancer

32 16. MUTATIONS CHANGES IN THE GENETIC MATERIAL 1. Gene mutations -- change in a single gene A. Point mutation -- changes in one or a few nucleotides *Substitution-- one base is changed to another acid --Usually one affects one amino

33 --By inserting, deleting, or substituting DNA segments can gene can be altered. --An altered gene may be passed on to every cell that develops from it and that the resulting features may help, harm, or have little or no effect on the offspring s success in its environment. (B4.4a) -- Mutations in the DNA sequence of a gene may be silent or result in phenotypic change in an organism. (B4.4c)

34 2. Chromosomal mutations -- changes in the number or structure of chromosomes **Deletion -- removes all or part of **Duplication -- extra copies of parts of a chromosome chromosome **Inversion --reverse the direction of part of the chromosome **Translocation -- part of one chromosome breaks off and attaches to another chromosome

35 B. Frameshift mutation 1. Insertion -- one base is inserted 2. Deletion -- one base is deleted **Can be much more dramatic -- changes the codon read --Changes every amino acid made after mutation **Can alter the protein so much it cannot function

36 17. SIGNIFICANCE OF GENETIC MUTATIONS A. most mutation are neutral = have no effect on phenotype B. some can cause harm = disrupt normal biological function by making wrong proteins --genetic disorders --cancer C. SOURCE OF GENETIC VARIABILITY --Produce new alleles --Humans can make extra copies of genes in some plants to increase their size = polyploid

37 18. GENETIC VARIATION B4.4X Genetic variation is essential to biodiversity and the stability of a population. Genetic variation is ensured by the formation of gametes and their combination to form a zygote. Opportunities for genetic variation also occur during cell division when chromosomes exchange genetic material causing permanent changes in DNA sequences of the chromosomes. Random mutations in DNA structure caused by the environment are another source of genetic variation.

38 **READ 330 IN YOUR BOOK AND CONDUCT THE RESEARCH AND DECIDE

39 **Draw an example of each type of gene and chromosome mutation. Explain how the effect of each.

40 19. RECOGNIZE THAT GENETIC ENGINEERING TECHNIQUES PROVIDE GREAT POTENTIAL AND RESPONSIBILITIES. (B4.2H) (B4.R5B) -- bacteria, plants, and animals are genetically engineered (transgenic organisms)

41 20. TRANSGENIC BACTERIA 1. Bacteria A. recombinant DNA allows bacteria to be large groups for the sole purpose of harvesting specific proteins -- used to make insulin, human growth hormone, and hepatitis B vaccine B. eat oil and clean up toxic waste C. make Nutrasweet D. extract metals from mining operations

42 21. TRANSGENIC PLANTS 2. Plants A. insert genes from insect toxins have been inserted into cotton and soybean seeds to create pest resistant variants B. use plants to create human proteins such as hormones, clotting factor, and antibodies.

43 22. TRANSGENIC ANIMALS 3. Animals sheep A. inserting growth hormone from cows has been used to increase the size of fish, cows, pigs, rabbits, and B. Cloning C. Animal organs as transplant organs D. Gene therapy insertion of genetic material into human cells for the treatment of a disorder possibly future o No ill effects have been detected yet from manipulating genes o However the field is still very young it may have health and ecological effects in the

44 23. RECOMBINANT DNA Recombinant DNA B4.r5x Recombinant DNA technology allows scientists in the laboratory to combine genes from different sources, sometimes different species, into a single DNA molecule. This manipulation of genes using bacterial plasmids has been used for many practical uses including the mass production of chemicals and drugs.

45 D. EXPLAIN HOW RECOMBINANT DNA TECHNOLOGY ALLOWS SCIENTISTS TO ANALYZE THE STRUCTURE AND FUNCTION OF GENES. (B4.R2I) (B4.R5A) 1. Recombinant DNA contains DNA from two or more different sources a. restriction enzymes are used to cut specific points in the DNA sequence. b. then DNA ligase can be used to insert the DNA segment into a plasmid (small piece of bacterial DNA). c. the plasmid then forces the bacteria to produce the proteins created by that section of DNA d. a gene is just a segment of DNA!!! e. used to make insulin