DNA Structure and Protein synthesis
|
|
- Sharyl Miller
- 6 years ago
- Views:
Transcription
1 DNA Structure and Protein synthesis
2 What is DNA? DNA = deoxyribonucleic acid Chromosomes are made of DNA It carries genetic information: controls the activities of cells by providing instructions for making proteins Every nucleated cell in your body contains DNA.
3 Alfred Hersey and Martha Chase Experiment (1952) protein coat and the DNA of bacteriophage (virus that attacks bacteria) were marked using radioactive sulphur ( 35 S) and phosphorus ( 32 P), bacteriophage DNA (radioactive) moved into the bacterial cells and directed them to produce new bacteriophages (radioactive) protein coating(radioactive) was left outside the cell, new bacteriophages were not radioactive conclusion: DNA, not protein, carries genetic information
4 Alfred Hersey and Martha Chase Experiment (1952)
5 Earlier work by a biochemist P.A. Levine DNA was made up of nucleotides. Each nucleotide is made up of three parts. 1) A sugar called deoxyribose 2) a phosphate group (phosphoric acid) 3) one of the four nitrogen containing bases (adenine, guanine, thymine and cytosine A, G, T, C) Levine found that each nitrogen base is attached to a sugar, and each sugar is attached to a phosphate group to form a single nucleotide. Each nucleotide is named for the base it contains.
6 Nucleotide
7 Nitrogen Bases
8 Other studies: nucleotides are joined together to form long chains. Erwin Chargaff: equal number of adenine and thymine as well as guanine and cytosine. (#A = #T, #G = #C)
9 Nucleotide Pairs Source of sample Percent of Each Base in DNA Samples A G C T Human Liver Human Thymus Wheat plant Bacterium
10 Discovering the Double Helix- Information scientists knew: DNA is made up of nucleotides Nucleotides are linked together in a string. In each DNA molecule there is an equal number of A T and an equal number of G-C If the nucleotides are strung in a straight line, a typical DNA molecule would be over 1 meter long. Somehow it must be compressed.
11 Rosalind Franklin (1953) British crystallographer, was able to photograph molecules using x-rays. (X-ray diffraction) These patterns indicated DNA was like a coil. The DNA molecule had a constant diameter of 2 nm. It did not get wider or narrower in some parts of the molecule.
12 James Watson and Francis Crick came up with the current model for DNA. They compared it to a spiral staircase. They called this shape a double helix. They also determined that nitrogen bases were always paired in the same manner. These paired nitrogen bases are called complementary base pairs. (A with T, G with C)
13 A and T by 2 H- bonds G and C by 3 H-bonds
14 Links DNA Structure DNA Replication RNA synthesis RNA to Protein
15 DNA Sequencing Unique genetic information is determined by the sequence of nucleotides. A sequence of A-T-C-G-G-A carries different information from the sequence C-A-G-T-T-A. The closer the relationship between two organisms, the greater the similarities in their DNA sequences. The order of base pairs in a DNA molecule makes up the genetic code of an organism to produce proteins.
16 Predicting the opposite base sequence What would be the opposite strand of DNA if the sequence was? A-T-C-G-A-G-T-T-G
17 A-T-C-G-A-G-T-T-G Opposite strand: T-A-G-C-T-C-A-A-C
18 What is DNA responsible for? DNA determines how amino acids are strung together and how proteins are made. The sequence of amino acids is determined by the sequence of NUCLEOTIDES in the DNA. A gene is a segment of DNA that controls the production of a protein. The genetic information on DNA must be transcribed to RNA to make proteins.
19 Protein
20 Polypeptide Chain Proteins are made up of 20 kinds of amino acids. For each protein, amino acids are linked together in a certain order. Linked amino acids form long chains called polypeptides, and two or more polypeptides are joined to make a particular protein. Examples of protein: Keratin - nails and hair Insulin hormone, controls sugar levels. Hemoglobin -in red blood cells Enzymes
21 Genetic Information must be transcribed from DNA to RNA RNA= ribonucleic acid - contains ribose sugar (one more oxygen than in DNA) - single stranded, - uracil replaces thymine, adenine pairs with uracil, guanine pairs with cytosine (A-U,G-C) - found in the nucleus and the cytoplasm of a cell
22
23 Three Types of RNA 1) messenger RNA (mrna): acts as a messenger that carries the DNA information from the nucleus to the ribosomes in the cytoplasm 2) transfer RNA (trna): delivers amino acids to ribosomes 3) ribosomal RNA (rrna): Binds with proteins to form the ribosomes
24 Summary 3 nitrogen bases (3 nucleotides) on DNA (ex. GAA) 3 nitrogen bases (3 nucleotides) or a codon on RNA (ex. CUU) 1 amino acid (ex. Leucine) 20 different types of amino acids a polypeptide chain many polypeptide chains protein
25
26 Steps from DNA to Protein: 1. An enzyme binds to DNA and unzips the two strands. DNA opens like a zipper. 2. Transcription: Another enzyme attaches nucleotides on one of the two open DNA strands as a template to make an mrna strand. Ex) DNA Strand GCGCGTATGCATTAGTCGTCACGT ACATGGTACTGATCA RNA Strand?
27 RNA sequence Ex) DNA Strand GCGCGTATGCATTAGTCGTCACGTACAT GGTACTGATCA RNA Strand? (U instead of T) CGCGCAUACGUAAUCAGCAGUGCAUGUA CCAUGACUAGU same as the opposite DNA strand (nontemplate strand)
28 Steps from DNA to Protein: 3. The mrna detaches from the DNA template and moves out of the nucleus. It travels to the ribosomes in the cytoplasm.
29 Steps from DNA to Protein 4. Translation: A ribosome attaches to the mrna. Each set of 3 bases, known as a CODON, codes for an amino acid. trna brings an amino acid to the ribosome according to the codon on the RNA. Amino acids make up a polypeptide chain. 5. The polypeptide chain leaves the ribosome and joins with other polypeptide chains. They fold and form a protein.
30
31 Codons on RNA Start codon - AUG (Methionine) This sequence indicates the FIRST amino acid in the chain that will grow to be a protein. Stop Codon (UAA, UAG, UGA) indicates that no more amino acids should be added and a particular protein is complete.
32 The RNA Genetic Code
33 Q1. What amino acid does this 3 base sequence (codon) code for? 1) ACU: threonine 2) CGA: arginine
34 Q2. What codon(s) code for 1)glycine? GGU, GGC, GGA, GGG 2)leucine? UUA, UUG, CUU, CUC, CUA, CUG
How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information
DNA: CH 13 How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information Discovering DNA s Function 1928: Frederick Griffith studied
More informationFrom Gene to Protein
8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More informationMacromolecule Review
DNA: CH 13 Macromolecule Review Nucleic acid Monomer = nucleotide Polymer = DNA, RNA Function = genetic information Protein Monomer = amino acid Polymer = polypeptide Function = structure and chemical
More informationUnit 5 DNA, RNA, and Protein Synthesis
1 Biology Unit 5 DNA, RNA, and Protein Synthesis 5:1 History of DNA Discovery Fredrick Griffith-conducted one of the first experiment s in 1928 to suggest that bacteria are capable of transferring genetic
More informationChapter 12 DNA & RNA
Chapter 12 DNA & RNA Experiments with Heredity Material Griffith s Experiments: injected mice with bacteria that cause pneumonia Concluded genetic info is transformed from one bacteria to another Avery
More informationDNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs.
DNA vs. RNA B-4.1 Compare DNA and RNA in terms of structure, nucleotides and base pairs. Key Concepts l Nucleic Acids: l deoxyribonucleic acid (DNA) l ribonucleic acid (RNA) l Nucleotides: l nitrogen base,
More informationDNA, RNA and protein synthesis
DNA, RNA and protein synthesis DNA is deoxyribonucleic acid DNA contains all the genetic instructions for making proteins within the cell. Each DNA molecule is made of repeating subunits called nucleotides.
More informationTo truly understand genetics, biologists first had to discover the chemical nature of genes
To truly understand genetics, biologists first had to discover the chemical nature of genes Identifying the structure that carries genetic information makes it possible to understand how genes control
More informationWhy are proteins important?
PROTEIN SYNTHESIS Why are proteins important? proteins help build cell structures some proteins are enzymes that promote biological reactions Proteins are found in muscles, blood, bones, etc.. RNA RNA
More informationDNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
More informationDNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base
DNA,, RNA,, AND PROTEIN SYNTHESIS DNA Deoxyribonucleic Acid Enables cells to have different forms and perform different functions Primary functions of DNA: Store and transmit genetic information that tells
More informationDNA, Replication and RNA
DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is
More informationBiology. DNA & the Language of Life
Biology DNA & the Language of Life Genes are Made of DNA Fredrick Griffith (1928) studied pneumonia strains (one was harmless while the other was pathogenic, or disease-causing) Made non-harmful strains
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your
More informationDeoxyribonucleic Acid DNA. Structure of DNA. Structure of DNA. Nucleotide. Nucleotides 5/13/2013
Deoxyribonucleic Acid DNA The Secret of Life DNA is the molecule responsible for controlling the activities of the cell It is the hereditary molecule DNA directs the production of protein In 1953, Watson
More informationUnit VII DNA to RNA to protein The Central Dogma
Unit VII DNA to RNA to protein The Central Dogma DNA Deoxyribonucleic acid, the material that contains information that determines inherited characteristics. A DNA molecule is shaped like a spiral staircase
More informationBiology Celebration of Learning (100 points possible)
Name Date Block Biology Celebration of Learning (100 points possible) Matching (1 point each) 1. Codon a. process of copying DNA and forming mrna 2. Genes b. section of DNA coding for a specific protein
More informationChapter 10 - Molecular Biology of the Gene
Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),
More informationChapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
More informationII. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes Frank Griffith- discovered DNA in 1928
HEREDITY = passing on of characteristics from parents to offspring I. DNA, Chromosomes, Chromatin, and Genes DNA = blueprint of life (has the instructions for making an organism) Chromatin= uncoiled DNA
More informationtranslation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus
More informationMarch 26, 2012 NUCLEIC ACIDS AND PROTEIN SYNTHESIS
NUCLEIC ACIDS AND PROTEIN SYNTHESIS MAIN MAIN TOPICS TOPICS TO TO BE BE COVERED COVERED THIS THIS UNIT: UNIT: I. I. EVIDENCE EVIDENCE OF OF DNA DNA AS AS THE THE GENETIC GENETIC CODE CODE II. II. DNA DNA
More informationNucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
More informationHow can something so small cause problems so large?
How can something so small cause problems so large? Objectives Identify the structural components of DNA and relate to its function Create and ask questions about a model of DNA DNA is made of genes. Gene
More informationUnit #5 - Instructions for Life: DNA. Background Image
Unit #5 - Instructions for Life: DNA Introduction On the following slides, the blue sections are the most important. Underline words = vocabulary! All cells carry instructions for life DNA. In this unit,
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 Section 12-1 DNA DNA Griffith and Transformation Frederick Griffith bacteriologist studying how certain types of bacteria produce pneumonia Isolated 2 strains of pneumonia from mice
More informationDNA, RNA and Protein Synthesis
By the end of this lesson, I can Relate how Griffith s bacterial experiments showed that a hereditary factor was involved in transformation. Summarize how Avery s experiments led his group to conclude
More informationChapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein)
Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein) I. Review A. Cells copy their DNA (in S phase of Interphase)-Why? Prepare for Cell Division (Mitosis & Cytokinesis) Genes
More informationSections 12.3, 13.1, 13.2
Sections 12.3, 13.1, 13.2 Background: Watson & Crick recognized that base pairing in the double helix allows DNA to be copied, or replicated Each strand in the double helix has all the information to remake
More information1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
More informationDNA - DEOXYRIBONUCLEIC ACID
DNA - DEOXYRIBONUCLEIC ACID blueprint of life (has the instructions for making an organism) established by James Watson and Francis Crick codes for your genes shape of a double helix made of repeating
More informationWhat happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
More information6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA
6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA DNA mrna Protein DNA is found in the nucleus, but making a protein occurs at the ribosome
More informationDNA, RNA, and Protein. The Whole Story
DNA, RNA, and Protein The Whole Story They didn t always know DNA was the Genetic Material. But they did know that the genetic material needed to do four things. The Master Molecule Contains Information
More informationDNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.
Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray
More informationwhat are proteins? what are the building blocks of proteins? what type of bond is in proteins? Molecular Biology Proteins - review Amino Acids
Molecular Biology The Study of Proteins and Nucleic Acids what are proteins? what are the building blocks of proteins? what type of bond is in proteins? Proteins - review functions include: catalysts for
More information3/10/16 DNA. Essential Question. Answer in your journal notebook/ What impact does DNA play in agriculture, science, and society as a whole?
DNA Essential Question. Answer in your journal notebook/ What impact does DNA play in agriculture, science, and society as a whole? 1 Benchmark SC.912.N.1.3, SC912.L16.9 Explain how & why the genetic code
More information8.1. KEY CONCEPT DNA was identified as the genetic material through a series of experiments. 64 Reinforcement Unit 3 Resource Book
8.1 IDENTIFYING DNA AS THE GENETIC MATERIAL KEY CONCEPT DNA was identified as the genetic material through a series of experiments. A series of experiments helped scientists recognize that DNA is the genetic
More informationRNA & PROTEIN SYNTHESIS
RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by
More informationNucleic Acids: DNA and RNA
Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,
More information12 1 DNA. Slide 1 of 37. End Show. Copyright Pearson Prentice Hall:
12 1 DNA 1 of 37 http://www.biologyjunction.com/powerpoints_dragonfly_book_prent.htm 12 1 DNA Griffith and Transformation Griffith and Transformation In 1928, Fredrick Griffith was trying to learn how
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationCh 10.4 Protein Synthesis
Ch 10.4 Protein Synthesis I) Flow of Genetic Information A) DNA is made into RNA which undergoes transcription and translation to be made into a protein. II) RNA Structure and Function A) RNA contains
More informationDNA: The Molecule of Heredity
1 DNA: The Molecule of Heredity DNA Deoxyribonucleic acid Is a type of nucleic acid What chromosomes (and genes) are made of Made up of repeating nucleotide subunits 1 nucleotide looks like: Phosphate
More informationCh 12.DNA and RNA.Biology.Landis
Identity Section 12 1 DNA (pages 287 294) This section tells about the experiments that helped scientists discover the relationship between genes and DNA. It also describes the chemical structure of the
More informationGriffith and Transformation (pages ) 1. What hypothesis did Griffith form from the results of his experiments?
Section 12 1 DNA (pages 287 294) This section tells about the experiments that helped scientists discover the relationship between genes and DNA. It also describes the chemical structure of the DNA molecule.
More informationVocabulary: DNA (Deoxyribonucleic Acid) RNA (Ribonucleic Acid) Gene Mutation
STUDENTS WILL: Identify the parts of a DNA molecule and its structure. Explain how DNA copies itself. Describe the structure and function of each kind of RNA. Vocabulary: DNA (Deoxyribonucleic Acid) RNA
More informationUnit 6 Molecular Genetics
Unit 6 Molecular Genetics I. DNA and RNA structure pages 2-6 II. DNA replication pages 6-7 III. Protein Synthesis pages 7-10 South Dakota State Standard 9-12.L.1.1 Students are able to relate cellular
More informationProtein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
More informationDNA Structure and Replication, and Virus Structure and Replication Test Review
DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks
More informationDNA- THE MOLECULE OF LIFE
DNA- THE MOLECULE OF LIFE STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,
More informationWarm-Up: Check your Answers
Warm-Up 1. What are the 3 components of a nucleotide? 2. What are the 4 nitrogen bases that are found in DNA? 3. What type of bonds are found between 2 nitrogen bases? 4. During DNA replication, what breaks
More informationWrite: Unit 5 Review at the top.
Warm-up Take out a sheet of paper: Write: Unit 5 Review at the top. As each question goes on the board, write that question down and answer it. When answers come up, either write correct next to what you
More informationResources. How to Use This Presentation. Chapter 10. Objectives. Table of Contents. Griffith s Discovery of Transformation. Griffith s Experiments
How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or
More informationChapter 6. Genes and DNA. Table of Contents. Section 1 What Does DNA Look Like? Section 2 How DNA Works
Genes and DNA Table of Contents Section 1 What Does DNA Look Like? Section 1 What Does DNA Look Like? Objectives List three important events that led to understanding the structure of DNA. Describe the
More informationDo you think DNA is important? T.V shows Movies Biotech Films News Cloning Genetic Engineering
DNA Introduction Do you think DNA is important? T.V shows Movies Biotech Films News Cloning Genetic Engineering At the most basic level DNA is a set of instructions for protein construction. Structural
More informationDNA is the MASTER PLAN. RNA is the BLUEPRINT of the Master Plan
Sec. 12-3 RNA and Protein Synthesis Roles of DNA and RNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 1 RNA uses the information from DNA to make proteins Differs from DNA: 1. Ribose
More informationDNA- THE MOLECULE OF LIFE. Link
DNA- THE MOLECULE OF LIFE Link STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,
More informationRoute to DNA discovery
Unit 6 All living things use DNA to pass genetic information to the next generation. Genetic information directs the development and homeostasis of organism through a process of translating the genetic
More informationA nucleotide consists of: an inorganic phosphate group (attached to carbon 5 of the sugar) a 5C sugar (pentose) a Nitrogenous (N containing) base
Nucleic Acids! Nucleic acids are found in all living cells and viruses and the two main types are DNA and RNA. They are macromolecules made of chains of nucleotides bonded together. They carry genetic
More informationLesson 8. DNA: The Molecule of Heredity. Gene Expression and Regulation. Introduction to Life Processes - SCI 102 1
Lesson 8 DNA: The Molecule of Heredity Gene Expression and Regulation Introduction to Life Processes - SCI 102 1 Genes and DNA Hereditary information is found in discrete units called genes Genes are segments
More informationUNIT 3 GENETICS LESSON #41: Transcription
UNIT 3 GENETICS LESSON #41: Transcription Objective: Explain how transcription converts a gene into a singlestranded RNA molecule. Suppose you want to play a game but you need tokens and you only have
More informationThe Genetic Material. Unit 6: DNA & Protein Synthesis
Unit 6: DNA & Protein Synthesis The Genetic Material How was DNA discovered to be the chemical unit of heredity? Scientists already knew that chromosomes played a role in heredity, but the chemical composition
More informationUNIT I RNA AND TYPES R.KAVITHA,M.PHARM LECTURER DEPARTMENT OF PHARMACEUTICS SRM COLLEGE OF PHARMACY KATTANKULATUR
UNIT I RNA AND TYPES R.KAVITHA,M.PHARM LECTURER DEPARTMENT OF PHARMACEUTICS SRM COLLEGE OF PHARMACY KATTANKULATUR RNA, as previously mentioned, is an acronym for ribonucleic acid. There are many forms
More informationDNA, RNA, and PROTEIN SYNTHESIS
DNA, RNA, and PROTEIN SYNTHESIS 1 DNA DNA contains genes, sequences of nucleotide bases The genes code for polypeptides (proteins) Proteins are used to build cells and do much of the work inside cells
More informationChapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins
KEY CONCEPT Section 1 DNA was identified as the genetic material through a series of experiments. Griffith finds a transforming principle. Griffith experimented with the bacteria that cause pneumonia.
More informationBacteriophage = Virus that attacks bacteria and replicates by invading a living cell and using the cell s molecular machinery.
Hershey-Chase Bacteriophage Experiment - 1953 Bacteriophage = Virus that attacks bacteria and replicates by invading a living cell and using the cell s molecular machinery. Bacteriophages are composed
More informationThe Central Dogma: This explains how the information to make proteins is carried: DNA RNA proteins
7.1 DNA and RNA The Central Dogma: This explains how the information to make proteins is carried: DNA RNA proteins Discovering DNA It was not always known that DNA contains all of the genetic material.
More informationGene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
More informationDNA and the Production of Proteins Course Notes. Cell Biology. Sub-Topic 1.3 DNA and the Production of Proteins
Cell Biology Sub-Topic 1.3 DNA and the Production of Proteins On completion of this subtopic I will be able to state that: Chromosomes contain genetic information that gives rise to an organism s characteristics.
More information4/22/2014. Interest Grabber. Section Outline. Today s Goal. Percentage of Bases in Four Organisms. Figure 12 2 Griffith s Experiment
Order! Order! Genes are made of, a large, complex molecule. is composed of individual units called nucleotides. Three of these units form a code. The order, or sequence, of a code and the type of code
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationDNA & Protein Synthesis. Chapter 8
DNA & Protein Synthesis Chapter 8 State Standards SPI: 3210.4.1 Investigate how genetic information is encoded in nucleic acids SPI: 3210.4.2 Describe the relationship among genes, chromosomes, proteins,
More information(deoxyribonucleic acid)
1 The Central Dogma of Molecular Biology Mark Mayo Cypress College 2 The Central Dogma of Molecular Biology 3 Importance of Proteins There are three main kinds: structural - make up most body parts hormone
More informationProteins and Protein Synthesis body structures, hormones, enzymes & antibodies amino acids sequence number DNA chemical code codon 'initiator'
Proteins and Protein Synthesis - Proteins : large complex molecules that make up body structures, hormones, enzymes & antibodies : are composed of subunits called amino acids : there are 20 different amino
More informationMolecular Genetics. Before You Read. Read to Learn
12 Molecular Genetics section 3 DNA,, and Protein DNA codes for, which guides protein synthesis. What You ll Learn the different types of involved in transcription and translation the role of polymerase
More informationProtein Synthesis Foldable
Ameoba Sisters Protein Synthesis Foldable Transcription What? How? What are the steps? Location? Why? Draw a picture to represent this. Translation What? How? What are the steps? Location? Why? Draw a
More informationNUCLEIC ACIDS AND PROTEIN SYNTHESIS
NUCLEIC ACIDS AND PROTEIN SYNTHESIS DNA Cell Nucleus Chromosomes is a coiled double helix carrying hereditary information of the cell Contains the instructions for making from 20 different amino acids
More informationNUCLEIC ACID METABOLISM. Omidiwura, B.R.O
NUCLEIC ACID METABOLISM Omidiwura, B.R.O Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid
More informationDo you remember. What is a gene? What is RNA? How does it differ from DNA? What is protein?
Lesson 1 - RNA Do you remember What is a gene? What is RNA? How does it differ from DNA? What is protein? Gene Segment of DNA that codes for building a protein DNA code is copied into RNA form, and RNA
More informationWhat does DNA stand for?
DNA and RNA What does DNA stand for? DNA = deoxribonucleic acid NOTE: the DNA from one cell would stretch 3 metre DNA are coiled and folded. DNA has two strands. What four bases are used in DNA? The four
More informationDNA and RNA 2/14/2017. What is a Nucleic Acid? Parts of Nucleic Acid. DNA Structure. RNA Structure. DNA vs RNA. Nitrogen bases.
DNA and RNA Nucleic Acids What is a Nucleic Acid? Nucleic Acids are organic molecules that carry information needed to make proteins Remember: proteins carry out ALL cellular activity There are two types
More informationRNA and Protein Synthesis
RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and
More informationFrederick Griffith. Dead Smooth Bacteria. Live Smooth Bacteria. Live Rough Bacteria. Live R+ dead S Bacteria
Frederick Griffith Live Smooth Bacteria Live Rough Bacteria Dead Smooth Bacteria Live R+ dead S Bacteria Live Smooth Bacteria Frederick Griffith Live Rough Bacteria Dead Smooth Bacteria Live R+ dead S
More informationI. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
More informationReplication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?
Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?
More informationSummary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date
Chapter 12 Summary DNA and RNA 12 1 DNA To understand genetics, biologists had to learn the chemical structure of the gene. Frederick Griffith first learned that some factor from dead, disease-causing
More informationDNA & RNA. Chapter Twelve and Thirteen Biology One
DNA & RNA Chapter Twelve and Thirteen Biology One I. DNA Structure A. DNA monomers = nucleotides *1. sugar bonded to PO4 & one of four possible nitrogen bases 2. bases = Adenine, Guanine, Cytosine, Thymine
More informationChapter 12 Reading Questions
Chapter 12 Reading Questions Name Section 11 In Frederick Griffith s experiment, what four substances were given to laboratory mice, and what was the result of each? 4. Which result was surprising, and
More informationReplication Transcription Translation
Replication Transcription Translation A Gene is a Segment of DNA When a gene is expressed, DNA is transcribed to produce RNA and RNA is then translated to produce proteins. Genotype and Phenotype Genotype
More informationChapter 12 Notes DNA
Chapter 12 Notes DNA What makes up Genes? 3 teams of scientists answered this question. 1. Griffith Transformation 2. Avery DNA destroying protein 3. Hershey-Chase -- virus Griffith used bacteria 2 types
More informationUnit 1. DNA and the Genome
Unit 1 DNA and the Genome Gene Expression Key Area 3 Vocabulary 1: Transcription Translation Phenotype RNA (mrna, trna, rrna) Codon Anticodon Ribosome RNA polymerase RNA splicing Introns Extrons Gene Expression
More informationDNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.
Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray
More information11/17/14. Why would scientist want to make a mouse glow?
11/17/14 Why would scientist want to make a mouse glow? 11/20 Your test today has ten words please use this time wisely. Chapter 8 Vocabulary Review Bacteriophage Viruses that infect bacteria, makes the
More informationReview? - What are the four macromolecules?
Review? - What are the four macromolecules? Lipids Carbohydrates Protein Nucleic Acids What is the monomer of nucleic acids and what do nucleic acids make up? Nucleotides; DNA and RNA 12-1 DNA DNA Stands
More information2015 Biology Unit 4 PRACTICE TEST DNA, Structure, Function, Replication Week of December
Name: Class: Date: 2015 Biology Unit 4 PRACTICE TEST DNA, Structure, Function, Replication Week of 14-18 December 1. Which scientists figured out the three-dimensional structure of DNA by using a model
More information