(C-D)(E-F) (C-D) (A-B)(C-D)(E-F) D. simulans. D. sechellia. D.melanogaster. D. yakuba. D. erecta. D. ananassae D. pseudoobscura.

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "(C-D)(E-F) (C-D) (A-B)(C-D)(E-F) D. simulans. D. sechellia. D.melanogaster. D. yakuba. D. erecta. D. ananassae D. pseudoobscura."

Transcription

1 ADDITIONAL FILE 1 Segmental duplication, microinversion and gene loss associated with a complex inversion breakpoint region in Drosophila Oriol Calvete; Josefa Gonzalez; Esther Betran; Alfredo Ruiz. Molecular Biology and Evolution 2012; doi: /molbev/mss067

2

3 D. simulans D. sechellia D.melanogaster D. yakuba (AB) [(C),CG6490] [(E),Syx18] [(D),CG1866] [(F),RhoL] (C-D)(E-F) D. erecta Sophophora (AB)(CD)(EF) (C-D) (A-B)(C-D)(E-F) D. ananassae D. pseudoobscura D. persimilis D. willistoni D. mojavensis D. buzzatii D. virilis (AB) (CD) (EF) [(C),CG6089] (AB) [(D),CG6966] (EF) (AB) (CD) (EF) (AC) (BE) (DF) Drosophila D. grimshawi (AB) (CD) (EF) mya

4 ΨCG exon L ΨCG exon 3 ΨCG exon L L 1 Kb 0,5 Kb 0,1Kb 1 Kb 0,5 Kb 0,1Kb 1 Kb 0,5 Kb 0,1Kb ΨCG UTR L 1 Kb 0,5 Kb 0,1Kb CG exons L 1 Kb 0,5 Kb 0,1Kb L: ladder 1: Egg 0-1,30h 2: Egg 0-2,15h 3: Egg 0-2,30h 4: Egg 0-22h 5: Larvae 6: Pupae 7: Adult female 8: Adult male 9: DNA

5 1 L L (bp) L L: RNA ladder : mrna Adult (Female) 2: mrna Adult (Male) 3: mrna Pupa 4: mrna Larva 955 5: mrna Egg 623 6: mrna (D. mojavensis) 281 Figure S4. Analysis of CG4673 expression by Northern blot. Molecular weight of the hybridized bands is showed in the marker between membranes 1 and 2. mrna loaded in each lane is shown in the legend.

6 ΨCG exon L ΨCG exon 3 ΨCG exon L Gapdh L 1 Kb 0,5 Kb 0,1 Kb 1 Kb 0,5 Kb 0,1 Kb 1 Kb 0,5 Kb 0,1 Kb 1: D+/RT+ 2: D+/RT- 3: D+/RT+( N) 4: D+/RT+(T) 5: D-/RT+ 6: D-/RT- 7: D-/RT+(T) L: ladder

7 A B C D A B C D A B C D A B C D A B C D A B C D A B C D A C B D

8 ADDITIONAL FILE 2 Segmental duplication, microinversion and gene loss associated with a complex inversion breakpoint region in Drosophila Oriol Calvete; Josefa Gonzalez; Esther Betran; Alfredo Ruiz. Molecular Biology and Evolution 2012; doi: /molbev/mss067

9 Additional file 2. Cloning and sequencing the inversion breakpoints To clone and sequence the breakpoints of inversions 2m and 2n we applied the following experimental approach: (i) Identification of D. buzzatii BAC clones encompassing the breakpoints. Three D. buzzatii BAC clones, 14B19, 20O19 and 16H04, encompassing the AC, BE and DF breakpoint regions, respectively, were identified by González et al (2007) For each inversion breakpoint, we used in situ hybridization to isolate from the BAC library two additional clones, overlapping the initial one, and also bearing the breakpoint regions (Figure S1 in Additional file 1). The names of the identified clones are given in Table 1 in the main text. (ii) BAC-end sequencing and localization of the sequences in the D. mojavensis genome. We successfully generated 14 BAC-end sequences (BES), out of the 18 possible, and mapped 10 of them by similarity searches onto unique sites within the D. mojavensis genome (Table S5 in additional file 3). All sequences were anchored in scaffold 6540 (~34 Mb long), corresponding to D. mojavensis chromosome 2 (Muller s element E; Schaeffer et al. 2008). The arrangement of BES on this scaffold allowed us to locate the AB, CD and EF breakpoints regions in three regions near coordinates 25.7 Mb, 16.8 Mb and 4.7 Mb respectively (Table S5 in additional file 3). In each of these region, the breakpoint was narrowed down to a specific segment with the aid of at least two BES (Figure 2 in main text): AB breakpoint region was located within the 152,933 bp-long region limited by BES 14B19-T7 and 22B03-T7 and; CD breakpoint region was located inside the 91,453 bp-long

10 region between BES 1N19-T7 and 14E21-SP6; and EF breakpoint region was located within the 111,770 bp-long region limited by BES 20O19-SP6 and 16H04-T7. (iii) Walking along the D. mojavensis genome and characterization of the breakpoint regions in the non-inverted genome. We carried out an in situ hybridization walk in order to locate precisely the breakpoint within the previously delimited regions of D. mojavensis scaffold 6540 (Figure 2 in main text). DNA probes were generated by PCR (Table S6 in additional file 3) along the region and then hybridized to D. buzzatii chromosomes to determine their location (Table S7 in additional file 3). In this way, the AB breakpoint region (inversion 2m distal breakpoint) was located within 10,256 bp-long region delimited by probes A5 and B2, designed downstream of gene msi (A5) and within the Ssadh (B2) coding sequence (Figure 2 in main text). An attempt to further narrow down the breakpoint region using probes B3 and B4, both of them designed in the CG4673 gene, failed (Figure 2 in main text). The CD breakpoint (2m/2n shared breakpoint) was located in the 1,551 bplong segment between probes C2 and D2 designed in the intergenic region upstream of the scrib gene (C2) and downstream of the Or98b gene (D2) (Figure 2 in main text). Finally, the EF breakpoint (2n proximal breakpoint) was located in the 2,138 bp-long segment between probes E3 and F4, downstream of genes Wsck (E3) and CG8147 (F4) (Figure 2 in main text). (iv) Isolation of the breakpoint regions in D. buzzatii by PCR. Once the breakpoint regions were pinpointed in the D. mojavensis genome, we attempted to isolate the three breakpoint regions in D. buzzati (AC, EB and DF) by PCR amplification using combinations of primers designed in the expected orientation according to Figure 1 (in main text). Primers were designed inside the probes used to narrow down the breakpoints

11 in D. mojavensis (Figure 2 in main text and Table S8 in additional file 3). Only the DF breakpoint could be successfully amplified. The DF PCR product was ~4.4 kb in size and correspond to the expected intergenic region between genes Or98b and CG8147. Comparison of this 4.4 kb region with the CD and EF regions of D. mojavensis allowed us to further narrow down the breakpoint region to a ~3 kb segment as follows. The first 1,050 bp of the 4.4 kb DF region show similarity with CD region and the last 165 bp of the DF sequence are homologous to the last exon and 3 UTR of gene CG8147 from D. mojavensis EF region. Thus the DF breakpoint is located in a 3,185 bp-long segment between coordinates 1,051 bp and 4,235 bp of D. buzzatii DF sequence (Figure 4 in main text). The AC and EB breakpoint regions could not be amplified although several attempts using different primers were made. We also attempted to locate in D. buzzatii the D. mojavensis region between A and B containing CG4673 (Figure 2 in main text). We combined primers A and B with primers from B3 and B4 probes but this region could not be amplified. (v) Sequencing and annotation of the BAC clones containing AC and EB breakpoints. To isolate and characterize the AC and EB breakpoint regions we sequenced and annotated BAC clones 1N19 and 20O19, respectively (Table S9 in additional file 3). Clone 1N19 has a 138,724-bp long insert and contains exons 1-5 of the gene scribbled (scrib, CG4562), genes CG5071, CG12250 and CG4582, and exons 2-5 of musashi (msi, CG5099) (Figure 3 in main text). In D. melanogaster, msi encodes two transcripts, RA and RB. D. buzzatii BAC 1N19 fully contains the three exons (3-5) encoding transcript RA and four of the five exons (1-5) encoding transcript RB (only exon 1 is lacking). The complex organization of the genes msi, CG12250 and CG4582 seems

12 conserved between D. buzzatii and D. mojavensis, with CG4582 fully nested within intron 2 of msi and CG12250 exons interleaved with those of msi. The short (63 bp) exon 1 of CG12250 is not present in the current annotation of the D. mojavensis genome (CG12250 lacks the ATG start codon) giving the false impression that this gene is fully nested within msi intron 2. However we have detected and annotated downstream of the msi stop codon the putative initial exon of CG12250 that is conserved between D. mojavensis and D. buzzatii. Therefore in D. buzzatii CG12250 is closest to the breakpoint than msi. Comparison of BAC clone 1N19 containing AC breakpoint region with AB and CD regions of D. mojavensis allowed us to further narrow down the breakpoint to a ~700 bp segment as follows. The similarity between D. buzzatii AC region and D. mojavensis AB region reaches 12,841 bp upstream of the CG12250 start codon. When the AC breakpoint region was compared to the D. mojavensis CD region, the similarity reached 1,808 bp upstream of scrib start codon. These observations place the D. buzzatii AC breakpoint in a 693 bp-long segment between coordinates 113,151 and 113,843 of BAC 1N19 (Figure 4 in main text). Clone 20O19 insert is 143,293 bp long and contains the complete coding sequences of 22 genes: CG4774, CG31258, Rpl27 (CG4743), CG5828, CG4743, CG5039, CG4730, Lgr3 (CG31096), CG5053, tankyrase (CG4719), jigr1 (CG17383), Ssadh (CG4585), CG4673, Wsck (CG31127), at1 (CG6668), CG8721, CG5794, ash2 (CG6677), CG31125, CG6695, CG31126 and Ppox (CG5796) (see Figure 3 in main text). In addition it contains the first 7 exons of the gene slowpoke (slo, CG10693) a 45,122 bp-long gene comprising 28 exons in D. mojavensis. Sequence comparison between D. buzzatii 20O19 BAC clone containing EB breakpoint and D. mojavensis AB and EF regions allowed us to narrow down the

13 breakpoint to a ~1.1 kb segment. D. mojavensis AB region extends 5,108 bp downstream from the Ssadh stop codon. On the other hand, the similarity with D. mojavensis EF region extends 2,019 downstream from the stop codon of Wsck. Thus the EB breakpoint is located in a 1,114 bp-long segment between coordinates 79,447 bp and 80,560 bp of BAC 20O19 (Figure 4 in main text). References cited in this file 1. Gonzalez J, Casals F, Ruiz A: Testing chromosomal phylogenies and inversion breakpoint reuse in Drosophila. Genetics 2007, 175: Schaeffer SW, Bhutkar A, McAllister BF, Matsuda M, Matzkin LM, O'Grady PM, Rohde C, Valente VL, Aguade M, Anderson WW, et al: Polytene chromosomal maps of 11 Drosophila species: the order of genomic scaffolds inferred from genetic and physical maps. Genetics 2008, 179:

14 ADDITIONAL FILE 3 Segmental duplication, microinversion and gene loss associated with a complex inversion breakpoint region in Drosophila Oriol Calvete; Josefa Gonzalez; Esther Betran; Alfredo Ruiz. Molecular Biology and Evolution 2012; doi: /molbev/mss067

15 Additional file 3. Table S1. Similarity blocks between the CG4673 gene region of D. mojavensis as query and the AC breakpoint region (BAC 1N19) of D. buzzatii as subject. Search was carried out using BLAST (Bl2seq). Only hits with a minimum size of 45 bp and E-value 1e-04 are included in this list. CG4673 region Coordinates in Coordinates Identity (%) E-value in D. mojavensis D. mojavensis scaffold in 6540 D. buzzatii BAC 1N19 Exon UTR 25,756,516-25,756,613 12,802-12,704 72/99 (72.7) 2e-07 Exon ,757,533-25,757,920 12,632-12, /393 (69.5) 2e-37 Intron 6 25,759,443-25,759,569 11,708-11,583 99/128 (77.3) 5e-21 Intron 6 25,759,465-25,759,577 10,089-9,966 91/124 (73.4) 7e-13 Intron 6 25,760,725-25,760,896 10,246-10, /196 (67.3) 3e-10 Intron 6 25,761,139-25,761,215 9,726-9,652 59/77 (76.6) 4e-09 Intron 6 25,761,270-25,761,379 9,643-9,549 79/110 (71.8) 3e-10 CG ,761,635-25,762,277 8,571-7, /643 (80.9) 1e-173 CG ,762,432-25,762,593 6,719-6, /168 (72.6) 2e-20 Intron 6 25,763,858-25,763,918 4,202-4,148 47/61 (77.0) 6e-07 Intron 6 a 25,766,399-25,766,446 3,679-3,726 39/48 (81.2) 2e-06 CG ,764,640-25,764,730 2,991-2,895 71/97 (73.2) 3e-10 Intron 6 25,765,297-25,765,341 2,490-2,446 39/45 (86.7) 4e-09 Intron 6 25,765,806-25,765,925 2,129-2,007 90/127 (70.9) 8e-12 Intron 6 25,767,941-25,768, /187 (65.2) 3e-10 Intron 6 25,768,145-25,768, /54 (88.9) 5e-14 Intron 6 25,768,279-25,768, /60 (75.0) 9e-05 Exon 7 25,768,450-25,768, /125 (78.4) 4e-22 3 UTR 25,769,034-25,769, /61 (86.9) 4e-15 a This fragment is inverted

16 Table S2. Structure and comparison of the CG4673 gene of D. buzzatii (EB breakpoint region) with D. mojavensis and D. melanogaster. Exons 1 to 8 encode RA transcript. Exons 0 and 2 to 8 encode transcript RB and RD. Dbuz Dmoj Dmel Dbuz/Dmoj Dbuz/Dmel Region (bp) (bp) (exon a ) Identity (%) Identity (%) Exon (11) Intron Exon (10) Intron Exon (8) Intron Exon (7) Intron Exon (6) Intron Exon (5) Intron Exon (4) Intron Exon (3) Intron Exon (2/1) a exon number according to FlyBase.

17 Table S3. PCR and sequences of primers designed for the analysis of CG4673 and ΨCG4673 of D. buzzatii. PCR Primer Sequence (5-3 ) Annotation 2 2R TTACAGCGTACAAAATGTGT Exon 2 of ΨCG4673 2L GAGTTCTGCCCACCAGCTCA Exon 2 of ΨCG R GCACGAGTACCACAGCCAAA Exon 3 of ΨCG4673 3L CCTGATTACTTCAATGTATT Exon 3 of ΨCG R GCCGCTGCAGCCGCACATTC Exon 7 of ΨCG4673 7L GATAGATGGCTGATCAACAC Exon 7 of ΨCG UTR 3 UTR-R TCCAACTGTCAGCTTGACAC 3 UTR of ΨCG UTR-L CATGCTTATTGAATCTTTAT 3 UTR of ΨCG R CTGACCGCTCAGGAGTGCAT Exon 5 of CG4673 6L GGTGCATCCTTGGTAGGTAT Exon 6 of CG RACE Outer 8R GACGACCAGCTATCCCAGTG Exon 8 of CG Outer Adapter GCGAGCACAGAATTAATACGACT * 3 RACE Inner 8Rint TGGACCTGCAACCACTGCAC Exon 8 of CG Inner Adapter CGCGGATCCGAATTAATACGACTCACTATAGG * 5 RACE Outer 1L GCAGACTGCACGCGTATTAG Exon 1 of CG Outer Adapter GCTGATGGCGATGAATGAACACTG * 5 RACE Inner 1Lint GAAGAGACGATGTCGCACAA Exon 1 of CG Inner Adapter CGCGGATCCGAACACTGCGTTTGCTGGCTTTGATG * 3 RACE Outer 7R GCCGCTGCAGCCGCACATTC Exon 7 of ΨCG4673

18 3 Outer Adapter GCGAGCACAGAATTAATACGACT * 3 RACE Inner 7Rint ACGAAAGACGCCAGCCATTG Exon 7 of ΨCG Inner Adapter CGCGGATCCGAATTAATACGACTCACTATAGG * 5 RACE Outer 2L GAGTTCTGCCCACCAGCTCA Exon 2 of ΨCG Outer Adapter GCTGATGGCGATGAATGAACACTG * 5 RACE Inner 2Lint CTTTAGCTCCGTGGCCAAGC Exon 2 of ΨCG Inner Adapter CGCGGATCCGAACACTGCGTTTGCTGGCTTTGATG * Gapdh H1 ATGTCGAAGATTGGTATTAATGG Gapdh H2 GTTCGACACGACCTTCATGT Gapdh *primers from the RLM-RACE kit of Ambion (AM1700).

19 Table S4. Functional information of the genes located nearby the 2mn inversion breakpoints (FlyBase r5.36). Gene CG12250 (A) Ssadh (B) CG4673 (AB) CG5079 (AB) CG5071 (AB) Scrib (C) Molecular Function - catalytic step 2 spliceosome - precatalytic spliceosome a succinatesemialdehyde dehydrogenase activity b - structural constituent of nuclear pore - zinc ion binding GO annotation Biological Process nuclear mrna splicing, via spliceosome - gammaaminobutyric acid catabolic process - oxidationreduction process InterPro domains Evidence of Cellular expresion component none none High expression level in 1-5 day-old adult males (not expressed in adult females) mitochondrion - Aldehyde dehydrogenase domain none nuclear pore - Zinc finger, RanBP2-type - NPL4, zincbinding putative - Polyubiquitintagged protein recognition complex, Npl4 component High expression in L2 and L3 larvae Very highly expressed in adult male and female none none none none Low expression in pupae - peptidyl-prolyl cis-trans isomerase activity - zinc ion binding Protein binding protein folding intracellular - Zinc finger, B- box and RINGtype - Peptidyl-prolyl cis-trans isomerase, cyclophilin-type - cell cycle process - olfactory behaviou r - plasma membrane f - PDZ/DHR/GLGF - Leucine-rich repeat Moderately high expressed in males (no expression in adult females) High expression in embryo Other information None None Nonsense-mediated mrna decay (NMD) down-regulates CG4673- RB transcript c RNAi generated by PCR using primers directed to this gene causes a cell growth and viability phenotype when assayed in Kc167 and S2R + cells d. None Essential for odour guided behaviou r

20 Or98b (D) Wsck (E) CG8147 (F) - odorant binding - olfactory receptor activity - ATP binding - protein tyrosine kinase activity - alkaline phosphatase activity - sensory perception of smell - protein phosphorylation - metabolic process a Inferred from direct assay (Herold et al. 2009) a Inferred from direct assay (Rothacker 2008) - integral to membrane - membrane - plasma membrane none - olfactory receptor, drosophila - Protein kinase, catalytic domain - Carbohydratebinding WSC - Fibronectin, type III - Serinethreonine/tyrosineprotein kinase - Immunoglobulinlike fold - Alkaline phosphatase Extremely low expression in larvae and pupae Moderately high in embryo High in L2 larvae none none Identified in S2/cycloheximide assay as a direct target of Clk (circadian regulation of gene expression) mediated transcriptional regulation c Hansen et al 2009 d Boutros et al e Infered from mutant phenotype f Inferred from direct assay g Ganguly et al. 2003

21 Table S5. Mapping of the D. buzzatii BAC ends by similarity search to the D. mojavensis genome sequence. All D. mojavensis coordinates belong to scaffold Note that in D. mojavensis scaffold 6540 numbering increases from centromere to telomere (Schaeffer et al. 2008). Breakpoint BAC End Read length (bp) Hit on D. mojavensis genome (scaffold 6540) Annotation Score E-value Identity (%) AC 14B19 T ,824,685-25,824,451 msi 339 2e /240 (94.1) AC 1N19 T ,861,094-16,861,229 scrib 150 7e /135 (85.9) AC 14B19 SP ,810,607-16,811,089 Intergenic (Twd1-CG5467) 335 2e /500 (81.6) AC 15L19 T ,761,866-16,762,001 Intergenic (beat-vii-twd1) 329 9e /219 (92.7) BE 22B03 T ,671,558-25,671,752 CG e /200 (84.5) BE 2N19 SP ,823,128-4,822,869 slo 183 7e /267 (82.4) BE 20O19 SP ,804,621-4,804,495 slo 220 4e /127 (96.8) DF 14E21 SP ,952,682-16,952,590 Intergenic (Cyp6d5-beat-VI) 90 1e-16 79/93 (84.9) DF 16H04 T ,692,135-4,692,725 CG /592 (90.4) DF 14E21 T ,644,326-4,6445,63 Intergenic (alpha-manii-ps) 361 3e /238 (94.1)

22 Table S6. Sequences of primers used to generate probes for the BAC walking (see Figure 2 in main text). PCR Forward (5 3 ) Reverse (5 3 ) A5 GCCGTACGCGTTCTCTATAA TGCCGAACTTGTTAGACGTA A4 CCGATTGACTAACGTTAAGA GTCTCACGTTTCGCATACCA A3 TGGTATGCGAAACGTGAGAC TTGACTGGAGCAGCATGTAC A2 GTTGTTGTCAGGCAGTTGCA TGGTCCAAGTAAAACACAC A1 ATATTGCAGGTTTCAGACAC TTGTCATTATCGCCGATTAC B1 GCGAGGATCCAGATTATGAA GCCATGCAGACCATCATAAC B2 GCTCGAGCAATTCATCTACA TTATCACGAACCAGAGCCAT B3 CCAGCACTTCGATACCATCA GCGATACTCCACAGCTATTG B4 GTGGAGTATCTGCTAGTTGA TATAGAGAACGCGTACGGCA C2 GCTTGCATGCTAACGAGTTG AAAAAGAGTTCCTCGAGGGT C1 TATGACAACGCGGAAATTGT CAGGTGGAATTCGTGGACAA D1 GGCATGGCCATCTACGATAT GGATCCGGGAAGTATTCCTC D2 GACAAGGCCAGAAGCATAAT GCTCTAATTAGGCGCACATA E3 TATTGTGCTAATCTGGCAAG TTACGTTCATCGCTAACAGA E2 TACTATTACGTTGGCTGCTA GAGGAGAGGTCATCAGCTGA E1 CTTACTCAATCTCATGTCCA TTGAAGTAGGTGTGCTCGAA F1 TACGACACACATCGGAACTC GCGCCAATACGAGTAGAGTA F2 GCTGATGAAGTGAAAGTCAA GATAGACACGCCTTGTAAGT F3 AAGGATAAACGTTGCCGAAG GACTTTTGGTTGGCTTGTCA F4 CGAATATGTCGTTCTTGCGA TATGGAACCGTGCTCGACTA

23 Table S7. In situ hybridization of PCR probes for the BAC walking along the breakpoint regions from anchored BAC ends. PCR reactions were carried out using DNA from D. buzzatii BAC clones as template. See Table S6 in this file for sequences of PCR primers used to produce the probes. (-): No amplification product obtained. *In situ hybridization using D. mojavensis probe due to lack of amplification in D. buzzatii. PCR Coordinates of Annotation Expected length of Length of PCR Length of PCR Location of the in primers in D. PCR product in D. in bp (BAC product in bp situ hybridization mojavensis mojavensis (bp) used as (BAC used as signal in D. template) template) buzzatii F CG ~2100 (16H04) - (20O19) F6h/F2a F Intergenic (CG16779-CG8147) 1697 ~1800 (16H04) - (20O19) F6h/F2a F Intergenic (CG16779-CG8147) 813 ~820 (16H04) - (20O19) F6h/F2a F CG ~1500 (16H04) - (20O19) F6h/F2a E Intergenic (CG8147- Wsck) (16H04) ~1200 (20O19) D3e/F6h E Wsck (16H04) - (20O19) D3e/F6h* E CG (16H04) ~2000 (20O19) D3e/F6h D Cyp6d (1N19) ~1500 (16H04) No signal D Or98b (1N19) ~2400 (16H04) F6h/F2a C scrib (1N19) - (16H04) D3e/F2a* C scrib (1N19) ~2100 (16H04) D3e/F2a B Intergenic (jigr1-ssadh) 1539 ~1500 (20O19) - (1N19) D3e/F6h

24 B Ssadh 1622 ~1850 (20O19) - (1N19) D3e/F6h B CG5071-CG (20O19) - (1N19) No signal* B CG ~750 (20O19) ~750 (1N19) no signal A CG (20O19) - (1N19) D3e/F2a* A CG (20O19) ~3500 (1N19) D3e/F2a A msi (20O19) ~2050 (1N19) D3e/F2a A msi (20O19) - (1N19) no signal* A msi (20O19) ~2000 (1N19) D3e/F2a

25 Table S8. Primers used to attempt to amplify the breakpoints of inversions 2m and 2n (AC, EB and DF) in D. buzzatii. All primers were designed in D. mojavensis. Only the DF breakpoint was successfully amplified. Breakpoint Primer Sequence (5 3 ) Annotation AC EB DF A GCAACAACAAGTCACAATGA Intergenic (msi-cg4673) C TGAATTAGAAACCACCGTCA scrib B GGCATACGTCAGCTGATGAC Ssadh E ATCAATATGGCAACGAGGTG CG31127 D TGTTCGAGCAGCACTACATA Or98b conserved downstream region F AATAAGCAGCAAGTGCACAG CG8147

26 Table S9. Details of the sequencing results of the 1N19 and 20O19 BAC clones. Note that the actual size of the BAC clones is similar to the original estimates (given in brackets) BAC clone 1N19 20O19 Corresponding breakpoint of D. buzzatii AC EB Size of BAC clone (bp) 138,724 (138,197) 143,293 (142,697) Size of fragments selected from the partial digestion to 2 to 5 2 to 5 construct the library (kb) Number of reads in shotgun sequencing 1,536 1,344 Number of reads excluded Trimmed Read length mean (std) bases 869± ±150 Coverage 8.47x 7.56x Number of contigs 2 3 Gaps 1 2 References cited in this file 1. Schaeffer SW, Bhutkar A, McAllister BF, Matsuda M, Matzkin LM, O'Grady PM, Rohde C, Valente VL, Aguade M, Anderson WW, et al: Polytene chromosomal maps of 11 Drosophila species: the order of genomic scaffolds inferred from genetic and physical maps. Genetics 2008, 179:

Outline. Annotation of Drosophila Primer. Gene structure nomenclature. Muller element nomenclature. GEP Drosophila annotation projects 01/04/2018

Outline. Annotation of Drosophila Primer. Gene structure nomenclature. Muller element nomenclature. GEP Drosophila annotation projects 01/04/2018 Outline Overview of the GEP annotation projects Annotation of Drosophila Primer January 2018 GEP annotation workflow Practice applying the GEP annotation strategy Wilson Leung and Chris Shaffer AAACAACAATCATAAATAGAGGAAGTTTTCGGAATATACGATAAGTGAAATATCGTTCT

More information

3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome

3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome Lectures 30 and 31 Genome analysis I. Genome analysis A. two general areas 1. structural 2. functional B. genome projects a status report 1. 1 st sequenced: several viral genomes 2. mitochondria and chloroplasts

More information

Fine scale structural variants distinguish the genomes of Drosophila melanogaster and D. pseudoobscura

Fine scale structural variants distinguish the genomes of Drosophila melanogaster and D. pseudoobscura RESEARCH Open Access Fine scale structural variants distinguish the genomes of Drosophila melanogaster and D. pseudoobscura Stuart J Macdonald * and Anthony D Long Abstract Background: A primary objective

More information

BENG 183 Trey Ideker. Genome Assembly and Physical Mapping

BENG 183 Trey Ideker. Genome Assembly and Physical Mapping BENG 183 Trey Ideker Genome Assembly and Physical Mapping Reasons for sequencing Complete genome sequencing!!! Resequencing (Confirmatory) E.g., short regions containing single nucleotide polymorphisms

More information

Construction of plant complementation vector and generation of transgenic plants

Construction of plant complementation vector and generation of transgenic plants MATERIAL S AND METHODS Plant materials and growth conditions Arabidopsis ecotype Columbia (Col0) was used for this study. SALK_072009, SALK_076309, and SALK_027645 were obtained from the Arabidopsis Biological

More information

Agenda. Annotation of Drosophila. Muller element nomenclature. Annotation: Adding labels to a sequence. GEP Drosophila annotation projects 01/03/2018

Agenda. Annotation of Drosophila. Muller element nomenclature. Annotation: Adding labels to a sequence. GEP Drosophila annotation projects 01/03/2018 Agenda Annotation of Drosophila January 2018 Overview of the GEP annotation project GEP annotation strategy Types of evidence Analysis tools Web databases Annotation of a single isoform (walkthrough) Wilson

More information

Chimp Sequence Annotation: Region 2_3

Chimp Sequence Annotation: Region 2_3 Chimp Sequence Annotation: Region 2_3 Jeff Howenstein March 30, 2007 BIO434W Genomics 1 Introduction We received region 2_3 of the ChimpChunk sequence, and the first step we performed was to run RepeatMasker

More information

Annotating 7G24-63 Justin Richner May 4, Figure 1: Map of my sequence

Annotating 7G24-63 Justin Richner May 4, Figure 1: Map of my sequence Annotating 7G24-63 Justin Richner May 4, 2005 Zfh2 exons Thd1 exons Pur-alpha exons 0 40 kb 8 = 1 kb = LINE, Penelope = DNA/Transib, Transib1 = DINE = Novel Repeat = LTR/PAO, Diver2 I = LTR/Gypsy, Invader

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

7 Gene Isolation and Analysis of Multiple

7 Gene Isolation and Analysis of Multiple Genetic Techniques for Biological Research Corinne A. Michels Copyright q 2002 John Wiley & Sons, Ltd ISBNs: 0-471-89921-6 (Hardback); 0-470-84662-3 (Electronic) 7 Gene Isolation and Analysis of Multiple

More information

CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES

CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES I. Introduction A. No operon structures in eukaryotes B. Regulation of gene expression is frequently tissue specific.

More information

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more

More information

ORTHOMINE - A dataset of Drosophila core promoters and its analysis. Sumit Middha Advisor: Dr. Peter Cherbas

ORTHOMINE - A dataset of Drosophila core promoters and its analysis. Sumit Middha Advisor: Dr. Peter Cherbas ORTHOMINE - A dataset of Drosophila core promoters and its analysis Sumit Middha Advisor: Dr. Peter Cherbas Introduction Challenges and Motivation D melanogaster Promoter Dataset Expanding promoter sequences

More information

Molecular Biology: DNA sequencing

Molecular Biology: DNA sequencing Molecular Biology: DNA sequencing Author: Prof Marinda Oosthuizen Licensed under a Creative Commons Attribution license. SEQUENCING OF LARGE TEMPLATES As we have seen, we can obtain up to 800 nucleotides

More information

Finishing Drosophila Ananassae Fosmid 2728G16

Finishing Drosophila Ananassae Fosmid 2728G16 Finishing Drosophila Ananassae Fosmid 2728G16 Kyle Jung March 8, 2013 Bio434W Professor Elgin Page 1 Abstract For my finishing project, I chose to finish fosmid 2728G16. This fosmid carries a segment of

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha

More information

Genome Sequencing-- Strategies

Genome Sequencing-- Strategies Genome Sequencing-- Strategies Bio 4342 Spring 04 What is a genome? A genome can be defined as the entire DNA content of each nucleated cell in an organism Each organism has one or more chromosomes that

More information

Learning Objectives :

Learning Objectives : Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in

More information

Genomes summary. Bacterial genome sizes

Genomes summary. Bacterial genome sizes Genomes summary 1. >930 bacterial genomes sequenced. 2. Circular. Genes densely packed. 3. 2-10 Mbases, 470-7,000 genes 4. Genomes of >200 eukaryotes (45 higher ) sequenced. 5. Linear chromosomes 6. On

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Using mutants to clone genes

Using mutants to clone genes Using mutants to clone genes Objectives 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype

More information

Lecture 20: Drosophila melanogaster

Lecture 20: Drosophila melanogaster Lecture 20: Drosophila melanogaster Model organisms Polytene chromosome Life cycle P elements and transformation Embryogenesis Read textbook: 732-744; Fig. 20.4; 20.10; 20.15-26 www.mhhe.com/hartwell3

More information

CHAPTER 21 LECTURE SLIDES

CHAPTER 21 LECTURE SLIDES CHAPTER 21 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.

More information

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can

More information

MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE?

MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE? MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE? Lesson Plan: Title Introduction to the Genome Browser: what is a gene? JOYCE STAMM Objectives Demonstrate basic skills in using the UCSC Genome

More information

Differential Gene Expression

Differential Gene Expression Biology 4361 Developmental Biology Differential Gene Expression June 19, 2008 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:

More information

Lesson 3 Gel Electrophoresis of Amplified PCR Samples and Staining of Agarose Gels

Lesson 3 Gel Electrophoresis of Amplified PCR Samples and Staining of Agarose Gels Lesson 3 Gel Electrophoresis of Amplified PCR Samples and Staining of Agarose Gels What Are You Looking At? Before you analyze your PCR products, let s take a look at the target sequence being explored.

More information

Chapter 15 Gene Technologies and Human Applications

Chapter 15 Gene Technologies and Human Applications Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect

More information

Chapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer

Chapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling

More information

Relationship of Gene s Types and Introns

Relationship of Gene s Types and Introns Chi To BME 230 Final Project Relationship of Gene s Types and Introns Abstract: The relationship in gene ontology classification and the modification of the length of introns through out the evolution

More information

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen

More information

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries

More information

CHAPTER 9 DNA Technologies

CHAPTER 9 DNA Technologies CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes

More information

Transcription Eukaryotic Cells

Transcription Eukaryotic Cells Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin)

More information

measuring gene expression December 5, 2017

measuring gene expression December 5, 2017 measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA

More information

Chapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi

Chapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi Chapter 17. PCR the polymerase chain reaction and its many uses Prepared by Woojoo Choi Polymerase chain reaction 1) Polymerase chain reaction (PCR): artificial amplification of a DNA sequence by repeated

More information

8/21/2014. From Gene to Protein

8/21/2014. From Gene to Protein From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information

More information

NAME TA SEC Problem Set 4 FRIDAY October 15, Answers to this problem set must be inserted into the box outside

NAME TA SEC Problem Set 4 FRIDAY October 15, Answers to this problem set must be inserted into the box outside MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel NAME TA SEC 7.012 Problem Set 4 FRIDAY October 15,

More information

TIGR THE INSTITUTE FOR GENOMIC RESEARCH

TIGR THE INSTITUTE FOR GENOMIC RESEARCH Introduction to Genome Annotation: Overview of What You Will Learn This Week C. Robin Buell May 21, 2007 Types of Annotation Structural Annotation: Defining genes, boundaries, sequence motifs e.g. ORF,

More information

MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.

MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. MIT Department of Biology 7.01: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel iv) Would Xba I be useful for cloning? Why or why not?

More information

Genome Annotation. What Does Annotation Describe??? Genome duplications Genes Mobile genetic elements Small repeats Genetic diversity

Genome Annotation. What Does Annotation Describe??? Genome duplications Genes Mobile genetic elements Small repeats Genetic diversity Genome Annotation Genome Sequencing Costliest aspect of sequencing the genome o But Devoid of content Genome must be annotated o Annotation definition Analyzing the raw sequence of a genome and describing

More information

Eukaryotic Transcription

Eukaryotic Transcription Eukaryotic Transcription I. Differences between eukaryotic versus prokaryotic transcription. II. (core vs holoenzyme): RNA polymerase II - Promotor elements. - General Pol II transcription factors (GTF).

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Number and length distributions of the inferred fosmids.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Number and length distributions of the inferred fosmids. Supplementary Figure 1 Number and length distributions of the inferred fosmids. Fosmid were inferred by mapping each pool s sequence reads to hg19. We retained only those reads that mapped to within a

More information

Bio 101 Sample questions: Chapter 10

Bio 101 Sample questions: Chapter 10 Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information

More information

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome. Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid

More information

Eukaryotic Gene Structure

Eukaryotic Gene Structure Eukaryotic Gene Structure Terminology Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Gene Basic physical and

More information

Next Gen Sequencing. Expansion of sequencing technology. Contents

Next Gen Sequencing. Expansion of sequencing technology. Contents Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND

More information

TRANSGENIC TECHNOLOGIES: Gene-targeting

TRANSGENIC TECHNOLOGIES: Gene-targeting TRANSGENIC TECHNOLOGIES: Gene-targeting Reverse Genetics Wild-type Bmp7 -/- Forward Genetics Phenotype Gene or Mutations First Molecular Analysis Second Reverse Genetics Gene Phenotype or Molecular Analysis

More information

Fig Ch 17: From Gene to Protein

Fig Ch 17: From Gene to Protein Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA

More information

Gene Expression: Transcription

Gene Expression: Transcription Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make

More information

Host : Dr. Nobuyuki Nukina Tutor : Dr. Fumitaka Oyama

Host : Dr. Nobuyuki Nukina Tutor : Dr. Fumitaka Oyama Method to assign the coding regions of ESTs Céline Becquet Summer Program 2002 Structural Neuropathology Lab Molecular Neuropathology Group RIKEN Brain Science Institute Host : Dr. Nobuyuki Nukina Tutor

More information

BEADLE & TATUM EXPERIMENT

BEADLE & TATUM EXPERIMENT FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in

More information

Trasposable elements: Uses of P elements Problem set B at the end

Trasposable elements: Uses of P elements Problem set B at the end Trasposable elements: Uses of P elements Problem set B at the end P-elements have revolutionized the way Drosophila geneticists conduct their research. Here, we will discuss just a few of the approaches

More information

Lecture #1. Introduction to microarray technology

Lecture #1. Introduction to microarray technology Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing

More information

7.17: Writing Up Results and Creating Illustrations

7.17: Writing Up Results and Creating Illustrations 7.17: Writing Up Results and Creating Illustrations A Results Exercise: Kansas and Pancakes Write a 5-sentence paragraph describing the results illustrated in this figure: - Describe the figure: highlights?

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

Functional Loss of Bmsei Causes Thermosensitive Epilepsy in Contractile Mutant

Functional Loss of Bmsei Causes Thermosensitive Epilepsy in Contractile Mutant Functional Loss of Bmsei Causes Thermosensitive Epilepsy in Contractile Mutant Silkworm, Bombyx mori Hong-Yi Nie 1,2,3,4, Ting-Cai Cheng 1,2,3, Xiao-Feng Huang 1, Meng-Ting Zhou 1, Yin-Xia Zhang 1, Fang-Yin

More information

Caenorhabditis elegans: The Heavyweight Champ of Gene Knockout Technology

Caenorhabditis elegans: The Heavyweight Champ of Gene Knockout Technology Caenorhabditis elegans: The Heavyweight Champ of Gene Knockout Technology Rachel Pan The nematode (worm) Caenorhabditis elegans was the first multicellular organism to have its genome, or complete DNA

More information

Recombinant DNA Technology

Recombinant DNA Technology History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

Concepts: What are RFLPs and how do they act like genetic marker loci?

Concepts: What are RFLPs and how do they act like genetic marker loci? Restriction Fragment Length Polymorphisms (RFLPs) -1 Readings: Griffiths et al: 7th Edition: Ch. 12 pp. 384-386; Ch.13 pp404-407 8th Edition: pp. 364-366 Assigned Problems: 8th Ch. 11: 32, 34, 38-39 7th

More information

Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype)

Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype) Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype) Question#1: One-Gene, One-Polypeptide The figure below shows the results of feeding trials with one auxotroph strain of Neurospora

More information

Concepts and Methods in Developmental Biology

Concepts and Methods in Developmental Biology Biology 4361 Developmental Biology Concepts and Methods in Developmental Biology June 16, 2009 Conceptual and Methodological Tools Concepts Genomic equivalence Differential gene expression Differentiation/de-differentiation

More information

Guided tour to Ensembl

Guided tour to Ensembl Guided tour to Ensembl Introduction Introduction to the Ensembl project Walk-through of the browser Variations and Functional Genomics Comparative Genomics BioMart Ensembl Genome browser http://www.ensembl.org

More information

2 Gene Technologies in Our Lives

2 Gene Technologies in Our Lives CHAPTER 15 2 Gene Technologies in Our Lives SECTION Gene Technologies and Human Applications KEY IDEAS As you read this section, keep these questions in mind: For what purposes are genes and proteins manipulated?

More information

UCSC Genome Browser. Introduction to ab initio and evidence-based gene finding

UCSC Genome Browser. Introduction to ab initio and evidence-based gene finding UCSC Genome Browser Introduction to ab initio and evidence-based gene finding Wilson Leung 06/2006 Outline Introduction to annotation ab initio gene finding Basics of the UCSC Browser Evidence-based gene

More information

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important! Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic

More information

Assessing De-Novo Transcriptome Assemblies

Assessing De-Novo Transcriptome Assemblies Assessing De-Novo Transcriptome Assemblies Shawn T. O Neil Center for Genome Research and Biocomputing Oregon State University Scott J. Emrich University of Notre Dame 100K Contigs, Perfect 1M Contigs,

More information

Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression

Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression Vol. 1:7-15 Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression Ji, Tom, Lu, Aneka, Wu, Kaylee Department of Microbiology and Immunology, University of British Columbia

More information

1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross?

1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross? Problem Set 5 answers 1. Whether or not the shanks of chickens contains feathers is due to two independently assorting genes. Individuals have unfeathered shanks when they are homozygous for recessive

More information

2012 GENERAL [5 points]

2012 GENERAL [5 points] GENERAL [5 points] 2012 Mark all processes that are part of the 'standard dogma of molecular' [ ] DNA replication [ ] transcription [ ] translation [ ] reverse transposition [ ] DNA restriction [ ] DNA

More information

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics

More information

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination

More information

Introduction to genome biology

Introduction to genome biology Introduction to genome biology Lisa Stubbs We ve found most genes; but what about the rest of the genome? Genome size* 12 Mb 95 Mb 170 Mb 1500 Mb 2700 Mb 3200 Mb #coding genes ~7000 ~20000 ~14000 ~26000

More information

Outline. Introduction to ab initio and evidence-based gene finding. Prokaryotic gene predictions

Outline. Introduction to ab initio and evidence-based gene finding. Prokaryotic gene predictions Outline Introduction to ab initio and evidence-based gene finding Overview of computational gene predictions Different types of eukaryotic gene predictors Common types of gene prediction errors Wilson

More information

Sept 2. Structure and Organization of Genomes. Today: Genetic and Physical Mapping. Sept 9. Forward and Reverse Genetics. Genetic and Physical Mapping

Sept 2. Structure and Organization of Genomes. Today: Genetic and Physical Mapping. Sept 9. Forward and Reverse Genetics. Genetic and Physical Mapping Sept 2. Structure and Organization of Genomes Today: Genetic and Physical Mapping Assignments: Gibson & Muse, pp.4-10 Brown, pp. 126-160 Olson et al., Science 245: 1434 New homework:due, before class,

More information

REAL TIME PCR USING SYBR GREEN

REAL TIME PCR USING SYBR GREEN REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM

More information

Mate-pair library data improves genome assembly

Mate-pair library data improves genome assembly De Novo Sequencing on the Ion Torrent PGM APPLICATION NOTE Mate-pair library data improves genome assembly Highly accurate PGM data allows for de Novo Sequencing and Assembly For a draft assembly, generate

More information

ALSO: look at figure 5-11 showing exonintron structure of the beta globin gene

ALSO: look at figure 5-11 showing exonintron structure of the beta globin gene S08 Biology 205 6/4/08 Reading Assignment Chapter 7: From DNA to Protein: How cells read the genome pg 237-243 on exons and introns (you are not responsible for the biochemistry of splicing: figures 7-15,16

More information

Next-Generation Sequencing. Technologies

Next-Generation Sequencing. Technologies Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062

More information

MATH 5610, Computational Biology

MATH 5610, Computational Biology MATH 5610, Computational Biology Lecture 2 Intro to Molecular Biology (cont) Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/24 Announcements Error on syllabus Class

More information

Chapter 17: From Gene to Protein

Chapter 17: From Gene to Protein Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master

More information

Temperature sensitive gene expression: Two rules.

Temperature sensitive gene expression: Two rules. 32 Research Notes Dros. Inf. Serv. 92 (2009) Temperature sensitive gene expression: Two rules. Gupta, Anand P. Johnson C. Smith University, Department of Science and Mathematics, 100 Beatties Ford Road,

More information

MOLECULAR BIOLOGY OF EUKARYOTES 2016 SYLLABUS

MOLECULAR BIOLOGY OF EUKARYOTES 2016 SYLLABUS 03-442 Lectures: MWF 9:30-10:20 a.m. Doherty Hall 2105 03-742 Advanced Discussion Section: Time and place to be announced Probably Mon 4-6 p.m. or 6-8p.m.? Once we establish who is taking the advanced

More information

Mapping strategies for sequence reads

Mapping strategies for sequence reads Mapping strategies for sequence reads Ernest Turro University of Cambridge 21 Oct 2013 Quantification A basic aim in genomics is working out the contents of a biological sample. 1. What distinct elements

More information

High-Resolution Oligonucleotide- Based acgh Analysis of Single Cells in Under 24 Hours

High-Resolution Oligonucleotide- Based acgh Analysis of Single Cells in Under 24 Hours High-Resolution Oligonucleotide- Based acgh Analysis of Single Cells in Under 24 Hours Application Note Authors Paula Costa and Anniek De Witte Agilent Technologies, Inc. Santa Clara, CA USA Abstract As

More information

Developmental Biology BY1101 P. Murphy

Developmental Biology BY1101 P. Murphy Developmental Biology BY1101 P. Murphy Lecture 7 Cellular differentiation and the regulation of gene expression. In this lecture we looked at two main questions: How is gene expression regulated? (revision

More information

Training materials.

Training materials. Training materials Ensembl training materials are protected by a CC BY license http://creativecommons.org/licenses/by/4.0/ If you wish to re-use these materials, please credit Ensembl for their creation

More information

Sequence Databases and database scanning

Sequence Databases and database scanning Sequence Databases and database scanning Marjolein Thunnissen Lund, 2012 Types of databases: Primary sequence databases (proteins and nucleic acids). Composite protein sequence databases. Secondary databases.

More information

Chapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics

Chapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics Chapter 8 Lecture Outline Transcription, Translation, and Bioinformatics Replication, Transcription, Translation n Repetitive processes Build polymers of nucleotides or amino acids n All have 3 major steps

More information

Chapter 14: Gene Expression: From Gene to Protein

Chapter 14: Gene Expression: From Gene to Protein Chapter 14: Gene Expression: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect

More information

Chapter 14 Active Reading Guide From Gene to Protein

Chapter 14 Active Reading Guide From Gene to Protein Name: AP Biology Mr. Croft Chapter 14 Active Reading Guide From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single

More information

Microarray Gene Expression Analysis at CNIO

Microarray Gene Expression Analysis at CNIO Microarray Gene Expression Analysis at CNIO Orlando Domínguez Genomics Unit Biotechnology Program, CNIO 8 May 2013 Workflow, from samples to Gene Expression data Experimental design user/gu/ubio Samples

More information

Protein Synthesis

Protein Synthesis HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is

More information

BOTH RNA on X (rox)1 and rox2 play an essential

BOTH RNA on X (rox)1 and rox2 play an essential Copyright Ó 2007 by the Genetics Society of America DOI: 10.1534/genetics.107.071001 An Evolutionarily Conserved Domain of rox2 RNA Is Sufficient for Induction of H4-Lys16 Acetylation on the Drosophila

More information