Supplementary Material. Increased heterocyst frequency by patn disruption in Anabaena leads to enhanced photobiological

Transcription

1 Supplementary Material Increased heterocyst frequency by patn disruption in Anabaena leads to enhanced photobiological hydrogen production at high light intensity and high cell density Applied Microbiology and Biotechnology Hajime Masukawa 1 Hidehiro Sakurai 2 Robert P. Hausinger 3,4 Kazuhito Inoue 2,5 1 The OCU Advanced Research Institute for Natural Science and Technology (OCARINA), Osaka City University, Sugimoto, Sumiyoshi-ku, Osaka , Japan 2 Research Institute for Photobiological Hydrogen Production, Kanagawa University, Hiratsuka, Kanagawa , Japan 3 Department of Microbiology and Molecular Genetics, Michigan State University, East Lansing, MI 48824, USA 4 Department of Biochemistry and Molecular Biology, Michigan State University, East Lansing, MI 48824, USA 5 Department of Biological Sciences, Kanagawa University, Hiratsuka, Kanagawa , Japan Correspondence to H. Masukawa tel: ; fax: ; masukawa@ocarina.osaka-cu.ac.jp 1

2 References Black TA, Cai YP, Wolk CP (1993) Spatial expression and autoregulation of hetr, a gene involved in the control of heterocyst development in Anabaena. Mol Microbiol 9(1):77-84 doi: /j tb01670.x Elhai J, Vepritskiy A, MuroPastor AM, Flores E, Wolk CP (1997) Reduction of conjugal transfer efficiency by three restriction activities of Anabaena sp. strain PCC J Bacteriol 179(6): Masukawa H, Mochimaru M, Sakurai H (2002) Disruption of the uptake hydrogenase gene, but not of the bidirectional hydrogenase gene, leads to enhanced photobiological hydrogen production by the nitrogen-fixing cyanobacterium Anabaena sp. PCC Appl Microbiol Biotechnol 58(5): doi: /s Rippka R, Deruelles J, Waterbury JB, Herdman M, Stanier RY (1979) Generic assignments, strain histories and properties of pure cultures of cyanobacteria. J Gen Microbiol 111(Mar):1-61 doi: / Thomas MC, Smith CA (1987) Incompatibility of group P plasmids: Genetics, evolution, and use in genetic manipulation. Annu Rev Microbiol 41: doi: /annurev.mi

3 Table S1 Bacterial strains, plasmids, and primers used for construction of plasmids and verification of genotypes in this study Strain or plasmid or primer Relevant characteristics a source Reference or Anabaena sp. strains Anabaena sp. PCC 7120 ΔHup PN1 PN22 Wild-type Sm r Sp r ; insertion of an aada (Sm r /Sp r )-bearing cassette into the EcoRV site of hupl Sm r Sp r Nm r ; ΔHup patn::npt; the first isolate after sacb selection; capable of heterocyst formation but incapable of diazotrophic growth; replacement of an internal sequence of patn with a cassette bearing a similarly oriented npt gene conferring Km r Nm r Presumably spontaneous mutant isolated from the PN1; capable of heterocyst formation and diazotrophic growth (Rippka et al. 1979) (Masukawa et al. 2002) PN21, PN23, PN24, PN25, PN26 Generated in the same manner as the PN22 Strains of Escherichia coli HB101 (prl623) J53 (RP4) XL1-Blue MRF' Cm r (vector) Sm r (host); strain containing prl623; used in triparental matings Ap r Km r Tet r ; conjugal strain containing RP4; used in triparental mating Nx r Tc r ; Δ(mcrA)183 Δ(mcrCB-hsdSMR-mrr)173 enda1 supe44 thi-1 reca1 gyra96 rela1 lac [F' proab laci q ZΔM15 Tn10 (Tet r )] (Elhai et al. 1997) Stratagene Plasmids 3

4 pbluescript II SK(+) Ap r ; cloning vector Stratagene prl3724 Ap r ; 2272-bp PCR fragment (containing the alr4811-3', complete alr4812 (patn), and all4813-5' sequences) of Anabaena PCC 7120 was amplified with primers alr4812-f and alr4812-r, and cloned between SmaI and HincII sites of pbluescript II SK(+) prl3730 Ap r Km r Nm r ; 1283-bp EcoRI fragment of puc4k containing npt was ligated between the same sites within patn of prl3724 in the sense orientation, replacing an internal sequence of patn prl3736 Cm r Em r Km r Nm r ; 3.4-kb XbaI fragment of prl3730 containing alr4811-3', all4813-5', and npt-interrupted patn sequences was ligated into the SpeI site of prl271 (Black et al. prl271 Cm r Em r ; sacb (confers sucrose sensitivity), mobilizable vector for triparental mating 1993) (Elhai et al. prl623 Cm r ; Mob ColK, M.AvaI, M.Eco47II, M.EcoT22I helper plasmid 1997) puc4k Ap r Km r Nm r ; source of an npt-bearing cassette Pharmacia RP4 Ap r Km r Tc r ; broad-host-range conjugative plasmid, used for mobilization of other plasmids into (Thomas and Anabaena sp. Smith 1987) Primer pair Primer sequence (5' 3') alr4812-f, alr4812-r Construction of prl3724 and verification of disruption of patn: TCTAGAAGAGGCCGCAGGACTACT, TCTAGATGGCGCGGCTGCCTTAGTAGCTAA a Ap: ampicillin; Cm: chloramphenicol; Em: erythromycin; Km: kanamycin; Nm: neomycin; Sm: streptomycin, Sp: spectinomycin; Tc: tetracycline; r, resistant 4

5 Fig. S1 Insertional inactivation of patn (alr4812) (a) and PCR confirmation (b). The patn coding region was amplified by PCR using genomic DNA and the primer pair indicated by arrows (Table S1). The internal sequence of patn was deleted and replaced with the neomycin resistance gene (Nm r ). E, EcoRI site. The expected size of the amplified PCR fragments with the same primer pair (Fig. S1a, arrows) were verified in both isolated mutants, PN1 and PN22. 5

6 Fig. S2 Frequency of the number of vegetative cells between heterocysts (labeled inter-heterocyst intervals) when bubbled with air (left two columns) or 1% CO 2-enriched air (right two columns). Growth conditions are the same as in Fig. 2. The heterocyst pattern was determined at the days indicated after N step-down. Values are the means ± the standard deviation of six independent experiments. 6

7 Fig. S3 Ratios of the rates for H 2 production (a, b) and C 2H 2 reduction (c, d) relative to heterocyst frequency after N step-down. Growth conditions and the symbols are the same as in Fig. 2. The ratios were calculated by dividing the measured rates (Fig. 4) by the ratios of heterocysts to total cells (Fig. 2e, f) for corresponding samples. The ratios were significantly higher in the parental strain (open circles) than in the PN22 strain (closed circles) during high activity stages at 2-3 days and 3-4 days after N step-down, respectively (p < 0.01, t-test) Values are the means ± the standard deviation. 7