OLIGONUCLEOTIDE ANALOGUES: FROM SUPRAMOLECULAR PRINCIPLES TO BIOLOGICAL PROPERTIES

Size: px
Start display at page:

Download "OLIGONUCLEOTIDE ANALOGUES: FROM SUPRAMOLECULAR PRINCIPLES TO BIOLOGICAL PROPERTIES"

Transcription

1 PL1 Oligonucleotide Analogues 21 OLIGONUCLEOTIDE ANALOGUES: FROM SUPRAMOLECULAR PRINCIPLES TO BIOLOGICAL PROPERTIES Damian ITTIG, Dorte RENNEBERG, David VONLANTHEN, Samuel LUISIER and Christian J. LEUMANN* Department of Chemistry & Biochemistry, University of Bern, Freiestrasse 3, CH-3012 Bern, Switzerland; Chemically modified oligonucleotides show great potential for applications in DNA diagnostics, as tools in molecular biology and as antisense agents and gene silencers in functional genomics and in human therapy. Among the promising analogues is tricyclo-dna, a conformationally constrained DNA analogue. We show here recent improvements in the synthesis of the tricyclo-dna building blocks for automated oligonucleotide synthesis. Furthermore we show that also tc-dna gapmers can efficiently be synthesized. We found that a tc-gap-18-mer with a window of 8 DNA-units in the center, in complex with complementary RNA, efficiently elicits RNaseH activity. In addition such gapmers are completely stable in human or murine serum over a time period of at least 24 h. INTRODUCTION Oligonucleotides have found widespread interest and applications in DNA and RNA diagnostics, as tools in molecular biology, and as antisense agents and gene silencers in functional genomics and human therapy. For many of these applications, however, unmodified oligonucleotides are of limited use due to their insufficient biostability, bioavailability and due to the fact that their affinity to complementary DNA and RNA is in many instances not sufficient to generate a biological response. Some of these drawbacks can be overcome by chemical modification of oligonucleotides 1. All of the three components of the repetitive structural unit of DNA or RNA, namely the sugar, the phosphate and the nucleobase, are equally amenable for chemical modifications to address the mentioned drawbacks. For example replacement of the phosphate unit by a thiophosphate group leads to increased biostability and has been widely investigated in the past as first generation antisense agents in functional genomics and therapy 2. Chemical modification of the 2 -OH function of ribonucleosides as an example for sugar modification has been of interest as a means to increase biostability and RNA affinity, and has lead to the second generation of antisense oligonucleotides 3. In recent years, more complex structural variations of the underlying nucleoside unit were investigated which lead to third generation antisense oligonucleotides displaying very high RNA affinity, biostability and in some cases also improved bioavailability compared to

2 22 Ittig, Renneberg, Vonlanthen, Luisier, Leumann: unmodified DNA or RNA. Selected third generation antisense oligonucleotides are displayed in Fig. 1. FIG. 1 Selected third generation antisense oligonucleotides with improved RNA binding properties and increased biostability In our own work we concentrated in the last years on the development of tricyclo (tc)-dna (Fig. 1). As LNA, tc-dna belongs to the class of conformationally constrained oligonucleotide analogues. These were specifically designed to increase complementary RNA or DNA affinity by reducing the entropy change upon duplex formation via structural preorganization of the single strand. We reported in the past on the synthesis and duplex formation properties of tricyclo-dna 4,5 as well as on its use as antisense oligonucleotide in cellular assays. Here we report now on recent advances in the synthesis of tricyclo-dna as well as on the chemical and biochemical properties of tc-dna/dna/tc-dna gapmers. RESULTS AND DISCUSSION We recently improved the original synthesis of tricyclo-dna by developing a new route to the central intermediate 1 from D-mannose in 10 steps (Fig. 2) 6. In a subsequent set of transformations the furanose ring is elaborated onto 1 yielding 2 in 46% over 5 steps. Bicyclo sugar 2 is then transformed in a further string of three steps into tricyclo sugar 3 in 43% yield overall, which serves as the central intermediate for the synthesis of the nucleosides and the corresponding phosphoramidite building blocks for oligonucleotide synthesis. Key step in this reaction sequence is the stereospecific Simmons Smith cyclopropanation of the corresponding silyl-enol ether which is obtained from the 5 -keto bicyclonucleoside. With

3 Oligonucleotide Analogues 23 this methodology we can now produce intermediate 3 in g quantities in a standard laboratory setup. FIG. 2 Improved synthetic route to tricyclo sugar 3 One of the drawbacks in 2 -deoxynucleoside synthesis in general and in tricyclo-nucleoside synthesis in particular is the lack of stereoselectivity in the nucleosidation step under Vorbrüggen conditions. In the reaction of the tricyclo sugar 3 with the N/O-protected, in situ silylated nucleobases we observe in all cases anomeric mixtures with α/β ratios of ca. 3:2, irrespective of the nature of the base. Besides the loss of material in a late step of the synthesis, there are often difficulties associated in the chromatographic separation of the anomeric mixtures posing a further technical obstacle. To circumvent these difficulties we decided to embark on a two step nucleoside synthesis starting from the enol ether 4 via NIS mediated base addition (Fig. 3). We reasoned that NIS attack from the α-face would be favored for sterical reasons. FIG. 3 Improved two-step nucleoside synthesis starting from enol ether 4 Indeed, using the persilylated pyrimidine bases thymine and N-benzoylcytosine the 2 -iodonucleosides 5 were obtained in yields of up to 81% in a remarkable stereospecificity. Only β- and no α-isomers were isolated in both cases. Subsequent removal of iodine with Bu 3 SnH went smoothely and

4 24 Ittig, Renneberg, Vonlanthen, Luisier, Leumann: resulted in the pure tricyclo-deoxynucleosides 6 again in high yield. We found that this two-step procedure leads to higher yields of 6 than the Vorbrüggen procedure in the case of the pyrimidine nucleosides. Unfortunately we were unable so far to extent this method also to the synthesis of the purine tricyclonucleosides. Further work in this area is, however, in progress. As indicated in Fig. 1, tricyclo-dna is a strong RNA binder. tc-dna/rna duplexes are thermally stabilized by 3 5 C per tc-unit relative to DNA. Thus it seemed adequate to investigate into the antisense properties of tricyclo-dna. In biological experiments we showed previously that fully modified tricyclo-dna is remarkably stable against nuclease mediated degradation with pure 3 -exonucleases and in human or murine sera. We further showed that fully modified tricyclo-dna/rna duplexes were no substrates for RNase H. Consequently no RNA degradation was observed. Given these properties it was of interest to explore the potential of tc-dna to act as a splice site modulator in cellular assays. We investigated so far splice modulation in two different models. In a first assay we showed that aberrant splicing of a mutant β-globin gene can be corrected by covering the erroneously activated 3 -cryptic splice site by an antisense oligonucleotide 7. We found that splice correction of tc-dna was fold more efficent compared to a 2 -OMe phosphorothioate of the same sequence. In another experiment we showed efficient downregulation of cyclophilin A RNA and protein by targeting an exon/intron segment of the pre-mrna with an antisense oligonucleotide, leading to multiple exon skipping. A direct comparison of tc-dna with LNA showed in this case a slightly higher efficacy of tc-dna 8. The enhanced antisense effect can not be correlated alone with target affinity as LNA binds more strongly to RNA than tc-dna. Thus, other factors as e.g. differential cellular distribution of antisense oligonucleotides as a consequence of their individual chemistries seem to play also an important part. RNase H activity leading to the degradation of the RNA is an important antisense mechanism that increases the efficacy of antisense oligonucleotides when targeted to mature mrnas. A way out of the dilemma that many chemically modified oligonucleotide analogues are unable to activate RNase H consists in the use of so called gapmers, chimaeric oligonucleotides in which both ends consist of chemically modified units while the center of the sequence contains 6 10 unmodified DNA-residues (RNase H window). We therefore decided to explore whether the gapmer concept can also be applied to tc-dna.

5 Oligonucleotide Analogues 25 For this we prepared the tc-dna gap-18-mer indicated in Fig. 4, containing a DNA window of 8 nucleotides in the center, flanked by 5 tc-dna residues each on the 5 - and the 3 -side. As a negative control we used the fully modified tc-18mer and as a positive control the pure DNA/RNA duplex. These analogues were annealed with 32 P-radiolabeled complementary RNA and the corresponding duplexes incubated with RNase H. Samples were taken in regular time intervals and the degree of RNA cleavage was followed by PAGE. As can be seen from Fig. 4, the positive DNA/RNA control shows complete cleavage of the RNA already after 2 min. On the other hand the negative control with the fully modified tc-dna/rna duplex showed no cleavage even after 16 h. Interestingly, the bands with lower mobility compared to the pure RNA control are those of the duplex which does not completely denature under the conditions of the denaturing PAGE (7 M urea). This underlines the high thermal stability of tc-dna/rna duplexes. The RNA in the tc-gapmer/rna duplex is rapidly degraded by RNase H with a comparable rate to that of the positive control. This clearly shows that tc-dna gapmers are as competent as normal DNA in eliciting RNase H activity. FIG. 4 RNase H assay of a tc-dna gap-18-mer of the sequence indicated in duplex with complementary RNA. As positive and negative controls the corresponding pure DNA/RNA and the fully modified tc-dna/rna duplexes

6 26 Ittig, Renneberg, Vonlanthen, Luisier, Leumann: In order to test whether tc-dna gapmers are also resistant towards biodegradation we incubated the tc-gap-18-mer depicted in Fig. 4 in human and fetal calf serum. After given time intervals samples were taken, ethanol precipitated and the integrity of the oligonucleotides verified by PAGE. Figure 5 shows a time course of the degradation of the tc-dna gapmer and the unmodified DNA as a control. FIG. 5 Stability of the tc-gapmer shown in Fig. 4 as a function of time in human or fetal calf serum. As comparison the corresponding unmodified oligodeoxynucleotide From Fig. 5 it becomes clear that the gapmers largely resist degradation in both human and fetal calf serum while unmodified DNA is rapidly degraded under the same conditions. Thus all the advantages of the gapmer strategy, as serum stability, RNase H activity and higher thermal stability of the corresponding duplexes with RNA do also apply to the tc-dna scaffold. Given these prerequisites it becomes now of interest to study tc-dna gapmers as antisense agents for the downregulation of mature mrnas. Work into this direction is currently underway in our laboratory. REFERENCES 1. Kurreck J.: Eur. J. Biochem. 2003, 270, Dias N., Stein C. A.: Mol. Cancer Ther. 2002, 1, Altmann K.-H., Dean N. M., Fabbro D., Freier S. M., Geiger T., Häner R., Hüsken D., Martin P., Monia B. P., Müller M., Natt F., Nicklin P., Phillips J., Pieles U., Sasmor H., Moser H. E.: Chimia 1996, 50, Steffens R., Leumann C. J.: J. Am. Chem. Soc. 1999, 121, Renneberg D., Leumann C. J.: J. Am. Chem. Soc. 2002, 124, Vonlanthen D., Leumann C. J.: Synthesis 2003, Renneberg D., Schümperli D., Leumann C. J.: Nucleic Acids Res. 2002, 30, Ittig D., Liu S., Renneberg D., Schümperli D., Leumann C. J.: Nucleic Acids Res. 2004, 32, 346.

Feedback D. Incorrect! No, although this is a correct characteristic of RNA, this is not the best response to the questions.

Feedback D. Incorrect! No, although this is a correct characteristic of RNA, this is not the best response to the questions. Biochemistry - Problem Drill 23: RNA No. 1 of 10 1. Which of the following statements best describes the structural highlights of RNA? (A) RNA can be single or double stranded. (B) G-C pairs have 3 hydrogen

More information

MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription. Gene Organization. Genome. Objectives: Gene Organization

MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription. Gene Organization. Genome. Objectives: Gene Organization Overview & Recap of Molecular Biology before the last two sections MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription Gene Organization Joy Winuthayanon, PhD School of Molecular Biosciences

More information

CHAPTER 8 Nucleotides and Nucleic Acids

CHAPTER 8 Nucleotides and Nucleic Acids CHAPTER 8 Nucleotides and Nucleic Acids Key topics Biological function of nucleotides and nucleic acids Structures of common nucleotides Structure of double-stranded DNA Structures of ribonucleic acids

More information

Dmytro Honcharenko, Jharna Barman, Oommen P. Varghese, and J. Chattopadhyaya*

Dmytro Honcharenko, Jharna Barman, Oommen P. Varghese, and J. Chattopadhyaya* Comparison of the RNase H Cleavage Kinetics and Blood Serum Stability of the North-Conformationally Constrained and 2 -Alkoxy Modified Oligonucleotides Dmytro Honcharenko, Jharna Barman, Oommen P. Varghese,

More information

Bridged Nucleic Acids - BNA3 TM

Bridged Nucleic Acids - BNA3 TM Speed-up Discovery Bridged Nucleic Acids - 3 TM Superior hybridization - Enhanced biostability H Base H N R RNA DNA SYNTHESIS CMMITTED T BIMIC RESEARCH Third Generation Super Functional Bridged Nucleic

More information

Artificial Nucleic Acids -Their Developments and Recent Applications

Artificial Nucleic Acids -Their Developments and Recent Applications Artificial Nucleic Acids -Their Developments and Recent Applications Bioorganic Chemistry Laboratory D2 Kenichiro Ito Organic Seminar 2012/5/7 1 Nucleic acids play central roles in life Replication Transcription

More information

Videos. Lesson Overview. Fermentation

Videos. Lesson Overview. Fermentation Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast

More information

Nucleotide Metabolism

Nucleotide Metabolism Nucleotide Metabolism Nucleotide Synthesis De Novo Pathway Synthesize purine and pyrimidine nucleotides from low M.W. precursors Salvage Pathway synthesize nucleotides from nucleosides of nucleobases NB:

More information

Gene-silencing oligonucleotides: Innovative design of oligonucleotides with enhanced efficacy and RNAilike mechanism of action

Gene-silencing oligonucleotides: Innovative design of oligonucleotides with enhanced efficacy and RNAilike mechanism of action Gene-silencing oligonucleotides: Innovative design of oligonucleotides with enhanced efficacy and RNAilike mechanism of action Nicola La Monica, Ekambar R. Kandimalla, Sudhir Agrawal Idera Pharmaceuticals,

More information

}Nucleosides NUCLEIC ACIDS. Nucleic acids are polymers Monomer---nucleotides Nitrogenous bases Purines Pyrimidines Sugar Ribose Deoxyribose

}Nucleosides NUCLEIC ACIDS. Nucleic acids are polymers Monomer---nucleotides Nitrogenous bases Purines Pyrimidines Sugar Ribose Deoxyribose DNA STRUCTURE NUCLEIC ACIDS Nucleic acids are polymers Monomer---nucleotides Nitrogenous bases Purines Pyrimidines Sugar Ribose Deoxyribose Phosphates +nucleoside=nucleotide }Nucleosides The Sugars The

More information

EncycloPCRAmplificationKit 1 Mint-2cDNA SynthesisKit 2 DuplexSpecificNuclease 4 Trimmer-2cDNA NormalizationKit 6 CombinedMint-2/Trimmer-2Package

EncycloPCRAmplificationKit 1 Mint-2cDNA SynthesisKit 2 DuplexSpecificNuclease 4 Trimmer-2cDNA NormalizationKit 6 CombinedMint-2/Trimmer-2Package Contents Page EncycloPCRAmplificationKit 1 Mint-2cDNA SynthesisKit 2 DuplexSpecificNuclease 4 Trimmer-2cDNA NormalizationKit 6 CombinedMint-2/Trimmer-2Package References 8 Schematic outline of Mint cdna

More information

Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL

Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct

More information

Figure A summary of spontaneous alterations likely to require DNA repair.

Figure A summary of spontaneous alterations likely to require DNA repair. DNA Damage Figure 5-46. A summary of spontaneous alterations likely to require DNA repair. The sites on each nucleotide that are known to be modified by spontaneous oxidative damage (red arrows), hydrolytic

More information

Key Area 1.3: Gene Expression

Key Area 1.3: Gene Expression Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?

More information

Improved Performance of Anti-miRNA Oligonucleotides Using a Novel Non-Nucleotide Modifier

Improved Performance of Anti-miRNA Oligonucleotides Using a Novel Non-Nucleotide Modifier Citation: Molecular Therapy Nucleic Acids (13) 2, e117; doi:10.1038/mtna.13.46 13 The American Society of Gene & Cell Therapy All rights reserved 2162-2531/12 www.nature.com/mtna Improved Performance of

More information

Site directed mutagenesis, Insertional and Deletion Mutagenesis. Mitesh Shrestha

Site directed mutagenesis, Insertional and Deletion Mutagenesis. Mitesh Shrestha Site directed mutagenesis, Insertional and Deletion Mutagenesis Mitesh Shrestha Mutagenesis Mutagenesis (the creation or formation of a mutation) can be used as a powerful genetic tool. By inducing mutations

More information

Supporting Information. Multi-strand Structure Prediction of Nucleic. Acid Assemblies and Design of RNA Switches

Supporting Information. Multi-strand Structure Prediction of Nucleic. Acid Assemblies and Design of RNA Switches Supporting Information Multi-strand Structure Prediction of Nucleic Acid Assemblies and Design of RNA Switches Eckart Bindewald 1#, Kirill A. Afonin 2,3#, Mathias Viard 1, Paul Zakrevsky 2, Taejin Kim

More information

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino

More information

Functional Analysis. LNA longrna GapmeR

Functional Analysis. LNA longrna GapmeR Functional Analysis LNA longrna GapmeR Instruction manual v2.0 August 2013 Table of contents Product Summary............................................................ Content...................................................................

More information

Lecture Overview. Overview of the Genetic Information. Marieb s Human Anatomy and Physiology. Chapter 3 DNA & RNA Protein Synthesis Lecture 6

Lecture Overview. Overview of the Genetic Information. Marieb s Human Anatomy and Physiology. Chapter 3 DNA & RNA Protein Synthesis Lecture 6 Marieb s Human Anatomy and Physiology Marieb Hoehn Chapter 3 DNA & RNA Protein Synthesis Lecture 6 Lecture Overview The Genetic Information Structure of DNA/RNA DNA Replication Overview of protein synthesis

More information

Nucleic acids. How DNA works. DNA RNA Protein. DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology

Nucleic acids. How DNA works. DNA RNA Protein. DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology Nucleic acid chemistry and basic molecular theory Nucleic acids DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology Cell cycle DNA RNA Protein Transcription Translation

More information

Applicazioni biotecnologiche

Applicazioni biotecnologiche Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence

More information

Therapeutic & Prevention Application of Nucleic Acids

Therapeutic & Prevention Application of Nucleic Acids Therapeutic & Prevention Application of Nucleic Acids Seyed Amir Hossein Jalali Institute of Biotechnology and Bioengineering, Isfahan University Of Technology (IUT). 30.7.2015 * Plasmids * DNA Aptamers

More information

Videos. Bozeman Transcription and Translation: Drawing transcription and translation:

Videos. Bozeman Transcription and Translation:   Drawing transcription and translation: Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain

More information

RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds.

RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds. The Versatility of RNA Primary structure of RNA RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds. Each nucleotide subunit is composed of a ribose sugar,

More information

TRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long

TRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double

More information

Nucleotides & Nucleic Acids. Central Dogma of Biology

Nucleotides & Nucleic Acids. Central Dogma of Biology Roles: Energy currency (ATP, GTP) Chemical links in response of cells to hormones (camp) Involved in cofactors (NAD, FAD, CoA) Metabolic intermediates (acetyl CoA) Constituents of nucleic acids, DNA and

More information

Nucleic Acids. By Sarah, Zach, Joanne, and Dean

Nucleic Acids. By Sarah, Zach, Joanne, and Dean Nucleic Acids By Sarah, Zach, Joanne, and Dean Basic Functions Carry genetic information (DNA storing it) Protein synthesis Helps in cell division (DNA replicates itself) RNA- numerous functions during

More information

Polymerase Chain Reaction-361 BCH

Polymerase Chain Reaction-361 BCH Polymerase Chain Reaction-361 BCH 1-Polymerase Chain Reaction Nucleic acid amplification is an important process in biotechnology and molecular biology and has been widely used in research, medicine, agriculture

More information

Lesson Overview. Fermentation 13.1 RNA

Lesson Overview. Fermentation 13.1 RNA 13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA

More information

Molecular Genetics II - Genetic Engineering Course (Supplementary notes)

Molecular Genetics II - Genetic Engineering Course (Supplementary notes) 1 von 12 21.02.2015 15:13 Molecular Genetics II - Genetic Engineering Course (Supplementary notes) Figures showing examples of cdna synthesis (currently 11 figures) cdna is a DNA copy synthesized from

More information

Recombinant DNA recombinant DNA DNA cloning gene cloning

Recombinant DNA recombinant DNA DNA cloning gene cloning DNA Technology Recombinant DNA In recombinant DNA, DNA from two different sources, often two species, are combined into the same DNA molecule. DNA cloning permits production of multiple copies of a specific

More information

RNA Expression of the information in a gene generally involves production of an RNA molecule transcribed from a DNA template. RNA differs from DNA

RNA Expression of the information in a gene generally involves production of an RNA molecule transcribed from a DNA template. RNA differs from DNA RNA Expression of the information in a gene generally involves production of an RNA molecule transcribed from a DNA template. RNA differs from DNA that it has a hydroxyl group at the 2 position of the

More information

Appendix A DNA and PCR in detail DNA: A Detailed Look

Appendix A DNA and PCR in detail DNA: A Detailed Look Appendix A DNA and PCR in detail DNA: A Detailed Look A DNA molecule is a long polymer consisting of four different components called nucleotides. It is the various combinations of these four bases or

More information

Nucleic Acids. Information specifying protein structure

Nucleic Acids. Information specifying protein structure Nucleic Acids Nucleic acids represent the fourth major class of biomolecules (other major classes of biomolecules are proteins, carbohydrates, fats) Genome - the genetic information of an organism Information

More information

Information specifying protein structure. Chapter 19 Nucleic Acids Nucleotides Are the Building Blocks of Nucleic Acids

Information specifying protein structure. Chapter 19 Nucleic Acids Nucleotides Are the Building Blocks of Nucleic Acids Chapter 19 Nucleic Acids Information specifying protein structure Nucleic acids represent the fourth major class of biomolecules (other major classes of biomolecules are proteins, carbohydrates, fats)

More information

Concept 5.5: Nucleic acids store and transmit hereditary information

Concept 5.5: Nucleic acids store and transmit hereditary information Concept 5.5: Nucleic acids store and transmit hereditary information The amino acid sequence of a polypeptide is programmed by a unit of inheritance called a gene Genes are made of DNA, a nucleic acid

More information

What Are the Chemical Structures and Functions of Nucleic Acids?

What Are the Chemical Structures and Functions of Nucleic Acids? THE NUCLEIC ACIDS What Are the Chemical Structures and Functions of Nucleic Acids? Nucleic acids are polymers specialized for the storage, transmission, and use of genetic information. DNA = deoxyribonucleic

More information

Gene and DNA structure. Dr Saeb Aliwaini

Gene and DNA structure. Dr Saeb Aliwaini Gene and DNA structure Dr Saeb Aliwaini 2016 DNA during cell cycle Cell cycle for different cell types Molecular Biology - "Study of the synthesis, structure, and function of macromolecules (DNA, RNA,

More information

BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 12 Transcription

BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 12 Transcription BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 12 Transcription 2 3 4 5 Are You Getting It?? Which are general characteristics of transcription? (multiple answers) a) An entire DNA molecule is transcribed

More information

Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points?

Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? BCH 401G Lecture 37 Andres Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? RNA processing: Capping, polyadenylation, splicing. Why process mammalian

More information

Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.

Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA. Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally

More information

Gene Expression - Transcription

Gene Expression - Transcription DNA Gene Expression - Transcription Genes are expressed as encoded proteins in a 2 step process: transcription + translation Central dogma of biology: DNA RNA protein Transcription: copy DNA strand making

More information

DNA and RNA Structure Guided Notes

DNA and RNA Structure Guided Notes Nucleic acids, especially DNA, are considered as the key biomolecules that guarantee the continuity of life. DNA is the prime genetic molecule which carry all the hereditary information that's passed from

More information

Genetic Engineering & Recombinant DNA

Genetic Engineering & Recombinant DNA Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied

More information

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8 Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically

More information

Methods in virus diagnosis PCR techniques

Methods in virus diagnosis PCR techniques Methods in virus diagnosis PCR techniques 450 MBIO PRACTICAL LESSON 5 Molecular Methods Methods based on the detection of viral genome are also commonly known as molecular methods. It is often said that

More information

Fermentation. Lesson Overview. Lesson Overview 13.1 RNA

Fermentation. Lesson Overview. Lesson Overview 13.1 RNA 13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to

More information

Motivation From Protein to Gene

Motivation From Protein to Gene MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein

More information

9/3/2009. DNA RNA Proteins. DNA Genetic program RNAs Ensure synthesis of proteins Proteins Ensure all cellular functions Carbohydrates (sugars) Energy

9/3/2009. DNA RNA Proteins. DNA Genetic program RNAs Ensure synthesis of proteins Proteins Ensure all cellular functions Carbohydrates (sugars) Energy Structure Properties Functions of the cell Chemical organization of the cell Based on molecular substrate : DNA contains information RNA ensures protein synthesis Proteins ensure vitality Relations between

More information

Genes to Proteins. Nucleic Acid Structure

Genes to Proteins. Nucleic Acid Structure Genes to Proteins Pratt & Cornely Chapter 3 Nucleobase Nucleoside Nucleotide Nucleic acid Chromatin Chromosome Nucleic Acid Structure 1 Base Structure Purines and pyrimidines Aromatic Tautomers Nucleosides

More information

Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology

Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated to synthesize

More information

Quick Review of Protein Synthesis

Quick Review of Protein Synthesis Collin College BIOL. 2401 Quick Review of Protein Synthesis. Proteins and Protein Synthesis Proteins are the molecular units that do most of the work in a cell. They function as molecular catalysts, help

More information

What is an Aptamer? smallest unit of repeating structure

What is an Aptamer? smallest unit of repeating structure What is an Aptamer? apto: mer: to fit smallest unit of repeating structure Aptamers are single stranded folded oligonucleotides that bind to molecular (protein) targets with high affinity and specificity

More information

Basics of Recombinant DNA Technology Biochemistry 302. March 5, 2004 Bob Kelm

Basics of Recombinant DNA Technology Biochemistry 302. March 5, 2004 Bob Kelm Basics of Recombinant DNA Technology Biochemistry 302 March 5, 2004 Bob Kelm Applications of recombinant DNA technology Mapping and identifying genes (DNA cloning) Propagating genes (DNA subcloning) Modifying

More information

Central Dogma. 1. Human genetic material is represented in the diagram below.

Central Dogma. 1. Human genetic material is represented in the diagram below. Central Dogma 1. Human genetic material is represented in the diagram below. 4. If 15% of a DNA sample is made up of thymine, T, what percentage of the sample is made up of cytosine, C? A) 15% B) 35% C)

More information

Syllabus for GUTS Lecture on DNA and Nucleotides

Syllabus for GUTS Lecture on DNA and Nucleotides Syllabus for GUTS Lecture on DNA and Nucleotides I. Introduction. DNA is the instruction manual for how to build a living organism here on earth. The instructions in DNA are propagated to future generations

More information

Molecular Biology. IMBB 2017 RAB, Kigali - Rwanda May 02 13, Francesca Stomeo

Molecular Biology. IMBB 2017 RAB, Kigali - Rwanda May 02 13, Francesca Stomeo Molecular Biology IMBB 2017 RAB, Kigali - Rwanda May 02 13, 2017 Francesca Stomeo Molecular biology is the study of biology at a molecular level, especially DNA and RNA - replication, transcription, translation,

More information

وراثة األحياء الدقيقة Microbial Genetics

وراثة األحياء الدقيقة Microbial Genetics وراثة األحياء الدقيقة Microbial Genetics د. تركي محمد الداود مكتب 2 ب 45 أساسيات في علم الوراثة Fundamentals of Genetics Lecture 4 Physical Chemistry of Nucleic Acids DNA and RNA molecules can appear in

More information

Fundamentals of Organic Chemistry. CHAPTER 10: Nucleic Acids

Fundamentals of Organic Chemistry. CHAPTER 10: Nucleic Acids Fundamentals of Organic Chemistry CHEM 109 For Students of Health Colleges Credit hrs.: (2+1) King Saud University College of Science, Chemistry Department CHEM 109 CHAPTER 10: Nucleic Acids 2 o Nucleic

More information

DNA and RNA Structure. Unit 7 Lesson 1

DNA and RNA Structure. Unit 7 Lesson 1 Unit 7 Lesson 1 Students will be able to: Explain the structure and function of the DNA and RNA. Illustrate the structure of nucleotide. Summarize the differences between DNA and RNA. Identify the different

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

Lecture Overview. Overview of the Genetic Information. Chapter 3 DNA & RNA Lecture 6

Lecture Overview. Overview of the Genetic Information. Chapter 3 DNA & RNA Lecture 6 Visual Anatomy & Physiology First Edition Martini & Ober Chapter 3 DNA & RNA Lecture 6 Lecture Overview What is the cell s genetic information? How/where is the genetic information stored in eukaryotic

More information

AGRO/ANSC/BIOL/GENE/HORT 305 Fall, 2017 Recombinant DNA Technology (Chpt 20, Genetics by Brooker) Lecture outline: (#14)

AGRO/ANSC/BIOL/GENE/HORT 305 Fall, 2017 Recombinant DNA Technology (Chpt 20, Genetics by Brooker) Lecture outline: (#14) AGRO/ANSC/BIOL/GENE/HORT 305 Fall, 2017 Recombinant DNA Technology (Chpt 20, Genetics by Brooker) Lecture outline: (#14) - RECOMBINANT DNA TECHNOLOGY is the use of in vitro molecular techniques to isolate

More information

Molecular Biology (1)

Molecular Biology (1) Molecular Biology (1) DNA structure and basic applications Mamoun Ahram, PhD Second semester, 2017-2018 Resources This lecture Cooper, pp. 49-52, 118-119, 130 What is molecular biology? Central dogma

More information

I. Gene Expression Figure 1: Central Dogma of Molecular Biology

I. Gene Expression Figure 1: Central Dogma of Molecular Biology I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases

More information

Nucleic Acids: How Structure Conveys Information 1. What Is the Structure of DNA? 2. What Are the Levels of Structure in Nucleic Acids? 3.

Nucleic Acids: How Structure Conveys Information 1. What Is the Structure of DNA? 2. What Are the Levels of Structure in Nucleic Acids? 3. Fig. 9-CO, p.215 Nucleic Acids: How Structure Conveys Information 1. What Is the Structure of DNA? 2. What Are the Levels of Structure in Nucleic Acids? 3. What Is the Covalent Structure of Polynucleotides?

More information

Structural Bioinformatics (C3210) DNA and RNA Structure

Structural Bioinformatics (C3210) DNA and RNA Structure Structural Bioinformatics (C3210) DNA and RNA Structure Importance of DNA/RNA 3D Structure Nucleic acids are essential materials found in all living organisms. Their main function is to maintain and transmit

More information

RNA Isolation and Technology Applications. Nadine Nassif Senior Research Scientist Promega Corporation

RNA Isolation and Technology Applications. Nadine Nassif Senior Research Scientist Promega Corporation RNA Isolation and Technology Applications Nadine Nassif Senior Research Scientist Promega Corporation verview Brief overview of basic RNA/DNA chemistry. verview of total and poly(a+) RNA isolation. Discuss

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by

More information

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1 CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing

More information

Gene therapy has gained significant attention over the past two decades as a potential method for treating genetic disorders such as severe combined

Gene therapy has gained significant attention over the past two decades as a potential method for treating genetic disorders such as severe combined Abstract Gene therapy has gained significant attention over the past two decades as a potential method for treating genetic disorders such as severe combined immunodeficiency, cystic fibrosis, and Parkinson

More information

Nucleotides: structure and functions. Prof. Dalė Vieželienė Biochemistry department Room No

Nucleotides: structure and functions. Prof. Dalė Vieželienė Biochemistry department Room No Nucleotides: structure and functions Prof. Dalė Vieželienė Biochemistry department Room No. 229 Email: daleveze@med.kmu.lt Composition of Nucleic Acids Nucleotide structure Two types of nucleic acids:

More information

Rapid Learning Center Presents. Teach Yourself High School Biology in 24 Hours. and Functions

Rapid Learning Center Presents. Teach Yourself High School Biology in 24 Hours. and Functions Rapid Learning Center Chemistry :: Biology :: Physics :: Math Rapid Learning Center Presents Teach Yourself High School Biology in 24 Hours Gene e Structures and Functions High School Biology Rapid Learning

More information

NUCLEIC ACIDS: DNA AND RNA. HLeeYu Jsuico Junsay Department of Chemistry School of Science and Engineering Ateneo de Manila University

NUCLEIC ACIDS: DNA AND RNA. HLeeYu Jsuico Junsay Department of Chemistry School of Science and Engineering Ateneo de Manila University NUCLEIC ACIDS: DNA AND RNA HLeeYu Jsuico Junsay Department of Chemistry School of Science and Engineering Ateneo de Manila University 1 BUILDING BLOCKS OF NUCLEIC ACIDS 2 Nucleic Acids are important for

More information

Blotting Techniques (Southern blot, Northern blot, Western blot, and Eastern blot)

Blotting Techniques (Southern blot, Northern blot, Western blot, and Eastern blot) Blotting Techniques (Southern blot, Northern blot, Western blot, and Eastern blot) Masheal Aljumaah SEP 2018 Learning Objectives: What is blotting? Blotting Techniques Types. Applications for each technique.

More information

DNA Structure & the Genome. Bio160 General Biology

DNA Structure & the Genome. Bio160 General Biology DNA Structure & the Genome Bio160 General Biology Lecture Outline I. DNA A nucleic acid II. Chromosome Structure III. Chromosomes and Genes IV. DNA vs. RNA I. DNA A Nucleic Acid Structure of DNA: Remember:

More information

Utility of Branched DNA Hybridization Methodology for the Quantitation of Oligonucleotides

Utility of Branched DNA Hybridization Methodology for the Quantitation of Oligonucleotides Utility of Branched DNA Hybridization Methodology for the Quantitation of Oligonucleotides Laboratory Sciences, MPI Research, A Charles River Company Amy Smith, BA, Senior Director, Bioanalytical/Analytical

More information

8 Nucleotides and Nucleic Acids W. H. Freeman and Company

8 Nucleotides and Nucleic Acids W. H. Freeman and Company 8 Nucleotides and Nucleic Acids 2013 W. H. Freeman and Company 1 Week 8 Nucleotides and Nucleic Acids 8.1 Some Basics 8.2 Nucleic Acid Structure 8.3 Nucleic Acid Chemistry 8.4 Other Functions of Nucleotides

More information

Transcription and Translation. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences

Transcription and Translation. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences Transcription and Translation DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences Protein Structure Made up of amino acids Polypeptide- string of amino acids 20 amino acids are arranged in different

More information

Protein Synthesis. OpenStax College

Protein Synthesis. OpenStax College OpenStax-CNX module: m46032 1 Protein Synthesis OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will

More information

American Society of Cytopathology Core Curriculum in Molecular Biology

American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 3 Molecular Techniques Alternatives to PCR, Part I

More information

* + * RecA * + + for RecA-dependent strand + + MIT Department of Biology 7.28, Spring Molecular Biology

* + * RecA * + + for RecA-dependent strand + + MIT Department of Biology 7.28, Spring Molecular Biology MIT Department of Biology 7.28, Spring 2005 - Molecular Biology 1) Question 1. 1A. You are studying the function of in vitro along with a lab partner. You run several reactions to examine the requirements

More information

Ch 10 Molecular Biology of the Gene

Ch 10 Molecular Biology of the Gene Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read

More information

Molecular Cloning. Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library:

Molecular Cloning. Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library: Molecular Cloning Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library: Made from mrna, and represents only protein-coding genes expressed by a cell at a given time.

More information

Structure and Function of Nucleic Acids

Structure and Function of Nucleic Acids Structure and Function of Nucleic Acids E T Nyahangare Class Assignment 1. Write notes and outline the role of the following in protein biosynthesis a. DNA replication b. Transcription c. Genetic code

More information

Biochemistry 302, February 11, 2004 Exam 1 (100 points) 1. What form of DNA is shown on this Nature Genetics cover? Z-DNA or left-handed DNA

Biochemistry 302, February 11, 2004 Exam 1 (100 points) 1. What form of DNA is shown on this Nature Genetics cover? Z-DNA or left-handed DNA 1 Biochemistry 302, February 11, 2004 Exam 1 (100 points) Name I. Structural recognition (very short answer, 2 points each) 1. What form of DNA is shown on this Nature Genetics cover? Z-DNA or left-handed

More information

Nucleic Acids: DNA and RNA

Nucleic Acids: DNA and RNA Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,

More information

Polymerase Chain Reaction

Polymerase Chain Reaction Polymerase Chain Reaction = multiple rounds of in vitro DNA replication = a region of DNA lying between two regions of known sequence is amplified hundreds of millions of time within a matter of several

More information

Chapter 3 Nucleic Acids, Proteins, and Enzymes

Chapter 3 Nucleic Acids, Proteins, and Enzymes 3 Nucleic Acids, Proteins, and Enzymes Chapter 3 Nucleic Acids, Proteins, and Enzymes Key Concepts 3.1 Nucleic Acids Are Informational Macromolecules 3.2 Proteins Are Polymers with Important Structural

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

Chapter 12: Molecular Biology of the Gene

Chapter 12: Molecular Biology of the Gene Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,

More information

BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 10 Nucleic Acids

BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 10 Nucleic Acids BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 10 Nucleic Acids 2 3 DNA vs RNA DNA RNA deoxyribose ribose A, C, G, T A, C, G, U 10 3 10 8 nucleotides 10 2 10 4 nucleotides nucleus cytoplasm double-stranded

More information

BIOB111 - Tutorial activity for Session 13

BIOB111 - Tutorial activity for Session 13 BIOB111 - Tutorial activity for Session 13 General topics for week 7 Session 13: Types of nucleic acids, DNA replication Useful links: 1. Visit this website and use its menu to locate information and practice

More information

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,

More information

Four levels of protein Structure

Four levels of protein Structure Proteins (polypeptides) Four levels of protein Structure Primary Structure (1 structure): Secondary Structure (2 structure): Tertiary Structure (3 structure): Quaternary Structure (4 structure): Proteins

More information

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how

More information

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen

More information

NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses)

NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses) NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses) Consist of chemically linked sequences of nucleotides Nitrogenous base Pentose-

More information