Bioinformatics. Ingo Ruczinski. Some selected examples... and a bit of an overview

Size: px
Start display at page:

Download "Bioinformatics. Ingo Ruczinski. Some selected examples... and a bit of an overview"

Transcription

1 Bioinformatics Some selected examples... and a bit of an overview Department of Biostatistics Johns Hopkins Bloomberg School of Public Health July 19, EnviroHealth Connections

2 Bioinformatics and Computational Biology Wikipedia: Bioinformatics and computational biology involve the use of techniques including applied mathematics, informatics, statistics, computer science, artificial intelligence, chemistry, and biochemistry to solve biological problems usually on the molecular level. Major research efforts in the field include sequence alignment, gene finding, genome assembly, protein structure alignment, protein structure prediction, prediction of gene expression and protein-protein interactions, and the modeling of evolution.

3 Bioinformatics and Computational Biology Wikipedia: The terms bioinformatics and computational biology are often used interchangeably. However bioinformatics more properly refers to the creation and advancement of algorithms, computational and statistical techniques, and theory to solve formal and practical problems inspired from the management and analysis of biological data. Computational biology, on the other hand, refers to hypothesis-driven investigation of a specific biological problem using computers, carried out with experimental or simulated data, with the primary goal of discovery and the advancement of biological knowledge.

4 Bioinformatics and Computational Biology NIH definition of Bioinformatics and Computational Biology: Bioinformatics and computational biology are rooted in life sciences as well as computer and information sciences and technologies. Both of these interdisciplinary approaches draw from specific disciplines such as mathematics, physics, computer science and engineering, biology, and behavioral science. Bioinformatics applies principles of information sciences and technologies to make the vast, diverse, and complex life sciences data more understandable and useful. Computational biology uses mathematical and computational approaches to address theoretical and experimental questions in biology. Although bioinformatics and computational biology are distinct, there is also significant overlap and activity at their interface.

5 Bioinformatics and Computational Biology NIH definition of Bioinformatics and Computational Biology: The NIH Biomedical Information Science and Technology Initiative Consortium agreed on the following definitions of bioinformatics and computational biology recognizing that no definition could completely eliminate overlap with other activities or preclude variations in interpretation by different individuals and organizations. Bioinformatics: Research, development, or application of computational tools and approaches for expanding the use of biological, medical, behavioral or health data, including those to acquire, store, organize, archive, analyze, or visualize such data. Computational Biology: The development and application of data-analytical and theoretical methods, mathematical modeling and computational simulation techniques to the study of biological, behavioral, and social systems.

6 The central dogma of biology Drawn by Ebbe Sloth Andersen

7 Topics DNA RNA Protein DNA Sequence analysis, genome annotation, evolutionary biology, phylogeny, DNA alterations, comparative genomics, SNP association studies RNA Analysis of gene expression and regulation Proteins Analysis of protein expression, protein-protein docking, prediction of protein structure Systems Biology: modeling biological systems, gene/protein networks

8 Some selected examples 1 Chromosomal alterations 2 Protein structure prediction 3 2D gel electrophoresis

9 Some selected examples 1 Chromosomal alterations 2 Protein structure prediction 3 2D gel electrophoresis

10 Karyotypes

11 Trisomy

12 DNA changes

13 The data

14 Deletion

15 FISH

16 Amplification

17 Uniparental Isodisomy

18 Cancer samples

19 Mosaicism

20 SNPchip S4 classes and methods

21 Estimation 1 By SNP: Estimate genotype and copy number for each SNP. 2 Within a sample: Borrow strength between SNPs to infer regions of LOH and copy number changes. 3 Between samples: Comparison between normal and disease populations to find chromosomal alterations associated with disease.

22 Vanilla ICE Deletion Normal LOH Amplification A D B C E 2 1 Van ICE A D B E Van ICE Mb

23 A HapMap sample Deletion Normal LOH Amplification 1 Van ICE Van ICE Mb

24 Many HapMap samples

25 SNP Trio

26 HMM for SNP Trio chromosome 10 chromosome 22 BPI BPI UPI F UPI F UPI M UPI M MI D MI D MI S non BPI MI S non BPI BPI BPI position (Mb) position (Mb)

27 HMM for SNP Trio BPI UPI P UPI M MI D MI S HMM BPI UPI P UPI M MI D MI S HMM copy number child copy number child mother mother copy number copy number copy number father copy number father

28 Some selected examples 1 Chromosomal alterations 2 Protein structure prediction 3 2D gel electrophoresis

29 Proteins Amino acids are the building blocks of proteins.

30 Proteins Both figures show the same protein (the bacterial protein L). The right figure also highlights the secondary structure elements.

31 Proteins From Lehninger, Principles of Biochemistry

32 Functional Annotation

33 Genome Wide Annotation

34 Some selected examples 1 Chromosomal alterations 2 Protein structure prediction 3 2D gel electrophoresis

35 2D Gel Electrophoresis

36 2D Gel Electrophoresis

37 2D Gel Electrophoresis A B A:1 A:2 A:3 A:4 A:5 A:6 A:7 A:8 A:9 A:10 A:11 A:12 B:1 B:2 B:3 B:4 B:5 B:6 B:7 B:8 B:9 B:10 B:11 B:12

38 2D Gel Electrophoresis A B A:1 A:2 A:3 A:4 B:1 B:2 B:3 B:4

39 2D Gel Electrophoresis % reduction of concentration as compared to background st Trimester 3 rd Trimester 20 Folate Placebo

40 2D Gel Electrophoresis

41 2D Gel Electrophoresis

42 iruczins/

Approaches for the Assessment of Chromosomal Alterations using Copy Number and Genotype Estimates

Approaches for the Assessment of Chromosomal Alterations using Copy Number and Genotype Estimates Approaches for the Assessment of Chromosomal Alterations using Copy Number and Genotype Estimates Department of Biostatistics Johns Hopkins Bloomberg School of Public Health September 20, 2007 Karyotypes

More information

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005 Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of

More information

Computational methods in bioinformatics: Lecture 1

Computational methods in bioinformatics: Lecture 1 Computational methods in bioinformatics: Lecture 1 Graham J.L. Kemp 2 November 2015 What is biology? Ecosystem Rain forest, desert, fresh water lake, digestive tract of an animal Community All species

More information

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology. G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

Biology 644: Bioinformatics

Biology 644: Bioinformatics Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....

More information

1.1 What is bioinformatics? What is computational biology?

1.1 What is bioinformatics? What is computational biology? Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, October 16, 2006 3 1 Introduction 1.1 What is bioinformatics? What is computational biology? Bioinformatics and computational biology are multidisciplinary

More information

bioinformatica 6EF2F181AA1830ABC10ABAC56EA5E191 Bioinformatica 1 / 5

bioinformatica 6EF2F181AA1830ABC10ABAC56EA5E191 Bioinformatica 1 / 5 Bioinformatica 1 / 5 2 / 5 3 / 5 Bioinformatica Bioinformatics is the name given to these mathematical and computing approaches used to glean understanding of biological processes. Common activities in

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map

More information

Genetics and Bioinformatics

Genetics and Bioinformatics Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Dortmund, 16.-20.07.2007 Lectures: Sven Rahmann Exercises: Udo Feldkamp, Michael Wurst 1 Goals of this course Learn about Software tools Databases Methods (Algorithms) in

More information

BIOINFORMATICS IN BIOCHEMISTRY

BIOINFORMATICS IN BIOCHEMISTRY BIOINFORMATICS IN BIOCHEMISTRY Bioinformatics a field at the interface of molecular biology, computer science, and mathematics Bioinformatics focuses on the analysis of molecular sequences (DNA, RNA, and

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Alla L Lapidus, Ph.D. SPbSU St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as "the study of

More information

Grundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson

Grundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson Grundlagen der Bioinformatik, SoSe 11, D. Huson, April 11, 2011 1 1 Introduction Grundlagen der Bioinformatik Summer 2011 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a) 1.1

More information

CMSE 520 BIOMOLECULAR STRUCTURE, FUNCTION AND DYNAMICS

CMSE 520 BIOMOLECULAR STRUCTURE, FUNCTION AND DYNAMICS CMSE 520 BIOMOLECULAR STRUCTURE, FUNCTION AND DYNAMICS (Computational Structural Biology) OUTLINE Review: Molecular biology Proteins: structure, conformation and function(5 lectures) Generalized coordinates,

More information

Estimation problems in high throughput SNP platforms

Estimation problems in high throughput SNP platforms Estimation problems in high throughput SNP platforms Rob Scharpf Department of Biostatistics Johns Hopkins Bloomberg School of Public Health November, 8 Outline Introduction Introduction What is a SNP?

More information

Course Information. Introduction to Algorithms in Computational Biology Lecture 1. Relations to Some Other Courses

Course Information. Introduction to Algorithms in Computational Biology Lecture 1. Relations to Some Other Courses Course Information Introduction to Algorithms in Computational Biology Lecture 1 Meetings: Lecture, by Dan Geiger: Mondays 16:30 18:30, Taub 4. Tutorial, by Ydo Wexler: Tuesdays 10:30 11:30, Taub 2. Grade:

More information

BIOINFORMATICS THE MACHINE LEARNING APPROACH

BIOINFORMATICS THE MACHINE LEARNING APPROACH 88 Proceedings of the 4 th International Conference on Informatics and Information Technology BIOINFORMATICS THE MACHINE LEARNING APPROACH A. Madevska-Bogdanova Inst, Informatics, Fac. Natural Sc. and

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Dr. Taysir Hassan Abdel Hamid Lecturer, Information Systems Department Faculty of Computer and Information Assiut University taysirhs@aun.edu.eg taysir_soliman@hotmail.com

More information

Introduction to Algorithms in Computational Biology Lecture 1

Introduction to Algorithms in Computational Biology Lecture 1 Introduction to Algorithms in Computational Biology Lecture 1 Background Readings: The first three chapters (pages 1-31) in Genetics in Medicine, Nussbaum et al., 2001. This class has been edited from

More information

CENTER FOR BIOTECHNOLOGY

CENTER FOR BIOTECHNOLOGY CENTER FOR BIOTECHNOLOGY Keith A. McGee, Ph.D., Program Director Math and Science Building, 3 rd Floor 1000 ASU Drive #870 Phone: 601-877-6198 FAX: 601-877-2328 Degree Offered Required Admission Test M.

More information

BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM)

BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM) BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM) PROGRAM TITLE DEGREE TITLE Master of Science Program in Bioinformatics and System Biology (International Program) Master of Science (Bioinformatics

More information

SYLLABUS FOR BS BIOINFORMATICS (4-YEAR DEGREE PROGRAMME)

SYLLABUS FOR BS BIOINFORMATICS (4-YEAR DEGREE PROGRAMME) SYLLABUS FOR BS BIOINFORMATICS (4-YEAR DEGREE PROGRAMME) COURSE BREAKUP BNB-301 Cell Biology 3(2-1) BNB-303 Fundamentals of Genetics 4(3-1) BNB-305 General Chemistry 3(3-0) CSI-321 Introduction to Computing

More information

Scoring Alignments. Genome 373 Genomic Informatics Elhanan Borenstein

Scoring Alignments. Genome 373 Genomic Informatics Elhanan Borenstein Scoring Alignments Genome 373 Genomic Informatics Elhanan Borenstein A quick review Course logistics Genomes (so many genomes) The computational bottleneck Python: Programs, input and output Number and

More information

Computational Genomics ( )

Computational Genomics ( ) Computational Genomics (0382.3102) http://www.cs.tau.ac.il/ bchor/comp-genom.html Prof. Benny Chor benny@cs.tau.ac.il Tel-Aviv University Fall Semester, 2002-2003 c Benny Chor p.1 AdministraTrivia Students

More information

Introduction to Bioinformatics and Gene Expression Technology

Introduction to Bioinformatics and Gene Expression Technology Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA

More information

Perspectives on the Priorities for Bioinformatics Education in the 21 st Century

Perspectives on the Priorities for Bioinformatics Education in the 21 st Century Perspectives on the Priorities for Bioinformatics Education in the 21 st Century Oyekanmi Nash, PhD Associate Professor & Director Genetics, Genomics & Bioinformatics National Biotechnology Development

More information

Introduction. CS482/682 Computational Techniques in Biological Sequence Analysis

Introduction. CS482/682 Computational Techniques in Biological Sequence Analysis Introduction CS482/682 Computational Techniques in Biological Sequence Analysis Outline Course logistics A few example problems Course staff Instructor: Bin Ma (DC 3345, http://www.cs.uwaterloo.ca/~binma)

More information

Era with Computational Biology/Toxicology

Era with Computational Biology/Toxicology USM Seminar 1/22/2010 Embracing the Post-Omics Era with Computational Biology/Toxicology Ping Gong Environmental Genomics and Genetics (EGG) Team @ Environmental Laboratory Outline Introduction Bioinformatics

More information

9/19/13. cdna libraries, EST clusters, gene prediction and functional annotation. Biosciences 741: Genomics Fall, 2013 Week 3

9/19/13. cdna libraries, EST clusters, gene prediction and functional annotation. Biosciences 741: Genomics Fall, 2013 Week 3 cdna libraries, EST clusters, gene prediction and functional annotation Biosciences 741: Genomics Fall, 2013 Week 3 1 2 3 4 5 6 Figure 2.14 Relationship between gene structure, cdna, and EST sequences

More information

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS. !! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,

More information

2/19/13. Contents. Applications of HMMs in Epigenomics

2/19/13. Contents. Applications of HMMs in Epigenomics 2/19/13 I529: Machine Learning in Bioinformatics (Spring 2013) Contents Applications of HMMs in Epigenomics Yuzhen Ye School of Informatics and Computing Indiana University, Bloomington Spring 2013 Background:

More information

Applications of HMMs in Epigenomics

Applications of HMMs in Epigenomics I529: Machine Learning in Bioinformatics (Spring 2013) Applications of HMMs in Epigenomics Yuzhen Ye School of Informatics and Computing Indiana University, Bloomington Spring 2013 Contents Background:

More information

Computational Biology

Computational Biology 3.3.3.2 Computational Biology Today, the field of Computational Biology is a well-recognised and fast-emerging discipline in scientific research, with the potential of producing breakthroughs likely to

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What

More information

Molecular Biology. IMBB 2017 RAB, Kigali - Rwanda May 02 13, Francesca Stomeo

Molecular Biology. IMBB 2017 RAB, Kigali - Rwanda May 02 13, Francesca Stomeo Molecular Biology IMBB 2017 RAB, Kigali - Rwanda May 02 13, 2017 Francesca Stomeo Molecular biology is the study of biology at a molecular level, especially DNA and RNA - replication, transcription, translation,

More information

MATH 5610, Computational Biology

MATH 5610, Computational Biology MATH 5610, Computational Biology Lecture 1 Intro to Molecular Biology Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/14 Announcements Homework 1 due next Tuesday

More information

The Integrated Biomedical Sciences Graduate Program

The Integrated Biomedical Sciences Graduate Program The Integrated Biomedical Sciences Graduate Program at the university of notre dame Cutting-edge biomedical research and training that transcends traditional departmental and disciplinary boundaries to

More information

Machine Learning. HMM applications in computational biology

Machine Learning. HMM applications in computational biology 10-601 Machine Learning HMM applications in computational biology Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Biological data is rapidly

More information

Living Environment. Directions: Use Aim # (Unit 4) to complete this study guide.

Living Environment. Directions: Use Aim # (Unit 4) to complete this study guide. Name: Date: Period: Living Environment Living Environment Unit 4 Genetics Study Guide Due Date: Test Date: Unit 5 Important Topics: I. Aim # 20 DNA Structure and Function II. Aim # 21 DNA Replication III.

More information

Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls

Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls BMI/CS 776 www.biostat.wisc.edu/bmi776/ Mark Craven craven@biostat.wisc.edu Spring 2011 1. Understanding Human Genetic Variation!

More information

Computers in Biology and Bioinformatics

Computers in Biology and Bioinformatics Computers in Biology and Bioinformatics 1 Biology biology is roughly defined as "the study of life" it is concerned with the characteristics and behaviors of organisms, how species and individuals come

More information

BIMM 143: Introduction to Bioinformatics (Winter 2018)

BIMM 143: Introduction to Bioinformatics (Winter 2018) BIMM 143: Introduction to Bioinformatics (Winter 2018) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bimm143_w18/ DRAFT: 2017-12-02 (20:48:10 PST

More information

Big picture and history

Big picture and history Big picture and history (and Computational Biology) CS-5700 / BIO-5323 Outline 1 2 3 4 Outline 1 2 3 4 First to be databased were proteins The development of protein- s (Sanger and Tuppy 1951) led to the

More information

Bioinformatics. Dick de Ridder. Tuinbouw Digitaal, 12/11/15

Bioinformatics. Dick de Ridder. Tuinbouw Digitaal, 12/11/15 Bioinformatics Dick de Ridder Tuinbouw Digitaal, 12/11/15 Bioinformatics is not Bioinformatics is also not Bioinformatics Bioinformatics (2) Bioinformatics (3) US National Institutes of Health (NIH): Bioinformatics:

More information

BIOINFORMATICS Introduction

BIOINFORMATICS Introduction BIOINFORMATICS Introduction Mark Gerstein, Yale University bioinfo.mbb.yale.edu/mbb452a 1 (c) Mark Gerstein, 1999, Yale, bioinfo.mbb.yale.edu What is Bioinformatics? (Molecular) Bio -informatics One idea

More information

DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.

DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel. DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Changhui (Charles) Yan Old Main 401 F http://www.cs.usu.edu www.cs.usu.edu/~cyan 1 How Old Is The Discipline? "The term bioinformatics is a relatively recent invention, not

More information

Studying the Human Genome. Lesson Overview. Lesson Overview Studying the Human Genome

Studying the Human Genome. Lesson Overview. Lesson Overview Studying the Human Genome Lesson Overview 14.3 Studying the Human Genome THINK ABOUT IT Just a few decades ago, computers were gigantic machines found only in laboratories and universities. Today, many of us carry small, powerful

More information

Classification and Learning Using Genetic Algorithms

Classification and Learning Using Genetic Algorithms Sanghamitra Bandyopadhyay Sankar K. Pal Classification and Learning Using Genetic Algorithms Applications in Bioinformatics and Web Intelligence With 87 Figures and 43 Tables 4y Spri rineer 1 Introduction

More information

DOWNLOAD OR READ : UNDERSTANDING BIOINFORMATICS PDF EBOOK EPUB MOBI

DOWNLOAD OR READ : UNDERSTANDING BIOINFORMATICS PDF EBOOK EPUB MOBI DOWNLOAD OR READ : UNDERSTANDING BIOINFORMATICS PDF EBOOK EPUB MOBI Page 1 Page 2 understanding bioinformatics understanding bioinformatics pdf understanding bioinformatics Bioinformatics / ËŒ b aéª. oêš

More information

Introduction to 'Omics and Bioinformatics

Introduction to 'Omics and Bioinformatics Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current

More information

RESEARCH METHODOLOGY, BIOSTATISTICS AND IPR

RESEARCH METHODOLOGY, BIOSTATISTICS AND IPR MB 401: RESEARCH METHODOLOGY, BIOSTATISTICS AND IPR Objectives: The overall aim of the course is to deepen knowledge regarding basic concepts of Biostatistics, the research process in occupational therapy

More information

An Analytical Upper Bound on the Minimum Number of. Recombinations in the History of SNP Sequences in Populations

An Analytical Upper Bound on the Minimum Number of. Recombinations in the History of SNP Sequences in Populations An Analytical Upper Bound on the Minimum Number of Recombinations in the History of SNP Sequences in Populations Yufeng Wu Department of Computer Science and Engineering University of Connecticut Storrs,

More information

Challenging algorithms in bioinformatics

Challenging algorithms in bioinformatics Challenging algorithms in bioinformatics 11 October 2018 Torbjørn Rognes Department of Informatics, UiO torognes@ifi.uio.no What is bioinformatics? Definition: Bioinformatics is the development and use

More information

ELE4120 Bioinformatics. Tutorial 5

ELE4120 Bioinformatics. Tutorial 5 ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar

More information

College- and Career Readiness Standards for Science Genetics

College- and Career Readiness Standards for Science Genetics College- and Career Readiness Genetics Mississippi 2018 GEN.1 Structure and Function of DNA GEN.1A Students will demonstrate that all cells contain genetic material in the form of DNA. GEN.1A.1 Model the

More information

CSC 121 Computers and Scientific Thinking

CSC 121 Computers and Scientific Thinking CSC 121 Computers and Scientific Thinking Fall 2005 Computers in Biology and Bioinformatics 1 Biology biology is roughly defined as "the study of life" it is concerned with the characteristics and behaviors

More information

Evolutionary Genetics: Part 1 Polymorphism in DNA

Evolutionary Genetics: Part 1 Polymorphism in DNA Evolutionary Genetics: Part 1 Polymorphism in DNA S. chilense S. peruvianum Winter Semester 2012-2013 Prof Aurélien Tellier FG Populationsgenetik Color code Color code: Red = Important result or definition

More information

Crash-course in genomics

Crash-course in genomics Crash-course in genomics Molecular biology : How does the genome code for function? Genetics: How is the genome passed on from parent to child? Genetic variation: How does the genome change when it is

More information

BGEN Laboratory Methods in Human and Medical Genetics

BGEN Laboratory Methods in Human and Medical Genetics BMG COURSES BGEN 7000 - Research Seminar MSc Consists of presentations of the student's current research. For Master s students only. 1.0 credit hours. BGEN 7020 Proteins (Formerly 137.702) Three hours

More information

Ph.D. Program in Genetics, Genomics, and Cancer Biology

Ph.D. Program in Genetics, Genomics, and Cancer Biology Ph.D. Program in Genetics, Genomics, and Cancer Biology Program Requirements Required Courses Credits GE 501, 511, 521, 531 Experimental Methods Pre-entry, I, II, III (3 research rotations are usually

More information

Lecture 1. Bioinformatics 2. About me... The class (2009) Course Outcomes. What do I think you know?

Lecture 1. Bioinformatics 2. About me... The class (2009) Course Outcomes. What do I think you know? Lecture 1 Bioinformatics 2 Introduction Course Overview & Assessment Introduction to Bioinformatics Research Careers and PhD options Core topics in Bioinformatics the central dogma of molecular biology

More information

Imaging informatics computer assisted mammogram reading Clinical aka medical informatics CDSS combining bioinformatics for diagnosis, personalized

Imaging informatics computer assisted mammogram reading Clinical aka medical informatics CDSS combining bioinformatics for diagnosis, personalized 1 2 3 Imaging informatics computer assisted mammogram reading Clinical aka medical informatics CDSS combining bioinformatics for diagnosis, personalized medicine, risk assessment etc Public Health Bio

More information

Bioinformatics 2. Lecture 1

Bioinformatics 2. Lecture 1 Bioinformatics 2 Introduction Lecture 1 Course Overview & Assessment Introduction to Bioinformatics Research Careers and PhD options Core topics in Bioinformatics the central dogma of molecular biology

More information

ALGORITHMS IN BIO INFORMATICS. Chapman & Hall/CRC Mathematical and Computational Biology Series A PRACTICAL INTRODUCTION. CRC Press WING-KIN SUNG

ALGORITHMS IN BIO INFORMATICS. Chapman & Hall/CRC Mathematical and Computational Biology Series A PRACTICAL INTRODUCTION. CRC Press WING-KIN SUNG Chapman & Hall/CRC Mathematical and Computational Biology Series ALGORITHMS IN BIO INFORMATICS A PRACTICAL INTRODUCTION WING-KIN SUNG CRC Press Taylor & Francis Group Boca Raton London New York CRC Press

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Vocabulary Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 Gene: Genetics: Genome: Genomics: hereditary

More information

Prof. Clare Bates Congdon, PhD

Prof. Clare Bates Congdon, PhD Women in Bioinformatics Forum Ballroom D, Tuesday 12:15PM-1:15PM Open to EVERYONE! Lunch Provided! ACM BCB 2013 Bioinformatics: Translation Catalyst, Enabler, Hub Bio+Med Study Discovery & Development

More information

Complex Adaptive Systems Forum: Transformative CAS Initiatives in Biomedicine

Complex Adaptive Systems Forum: Transformative CAS Initiatives in Biomedicine Complex Adaptive Systems Forum: Transformative CAS Initiatives in Biomedicine January 18, 2013 Anna D. Barker, Ph.D. Director, Transformative Healthcare Networks C-Director, Complex Adaptive Systems Initiative

More information

Exome Sequencing Exome sequencing is a technique that is used to examine all of the protein-coding regions of the genome.

Exome Sequencing Exome sequencing is a technique that is used to examine all of the protein-coding regions of the genome. Glossary of Terms Genetics is a term that refers to the study of genes and their role in inheritance the way certain traits are passed down from one generation to another. Genomics is the study of all

More information

FUNCTIONAL BIOINFORMATICS

FUNCTIONAL BIOINFORMATICS Molecular Biology-2018 1 FUNCTIONAL BIOINFORMATICS PREDICTING THE FUNCTION OF AN UNKNOWN PROTEIN Suppose you have found the amino acid sequence of an unknown protein and wish to find its potential function.

More information

Algorithms for Genetics: Introduction, and sources of variation

Algorithms for Genetics: Introduction, and sources of variation Algorithms for Genetics: Introduction, and sources of variation Scribe: David Dean Instructor: Vineet Bafna 1 Terms Genotype: the genetic makeup of an individual. For example, we may refer to an individual

More information

Clinical and Translational Bioinformatics

Clinical and Translational Bioinformatics Clinical and Translational Bioinformatics An Overview Jussi Paananen Institute of Biomedicine September 4 th, 2015 Bioinformatics Bioinformatics combines statistics, computer science and information technology

More information

Genome 373: Genomic Informatics. Elhanan Borenstein

Genome 373: Genomic Informatics. Elhanan Borenstein Genome 373: Genomic Informatics Elhanan Borenstein Genome 373 This course is intended to introduce students to the breadth of problems and methods in computational analysis of genomes and biological systems,

More information

Short Course Instructors

Short Course Instructors Short Course Instructors Andrew Allen, Ph.D., Professor of Biostatistics and Bioinformatics and Director of the new Duke Center of Statistical Genetics and Genomics, Duke University, has expertise in statistical

More information

Two Mark question and Answers

Two Mark question and Answers 1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics IMBB 2017 RAB, Kigali - Rwanda May 02 13, 2017 Joyce Nzioki Plan for the Week Introduction to Bioinformatics Raw sanger sequence data Introduction to CLC Bio Quality Control

More information

Single Nucleotide Variant Analysis. H3ABioNet May 14, 2014

Single Nucleotide Variant Analysis. H3ABioNet May 14, 2014 Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide

More information

VALLIAMMAI ENGINEERING COLLEGE

VALLIAMMAI ENGINEERING COLLEGE VALLIAMMAI ENGINEERING COLLEGE SRM Nagar, Kattankulathur 603 203 DEPARTMENT OF COMPUTER SCIENCE AND ENGINEERING QUESTION BANK VII SEMESTER BM6005 BIO INFORMATICS Regulation 2013 Academic Year 2018-19 Prepared

More information

What is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases.

What is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases. What is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases. Bioinformatics is the marriage of molecular biology with computer

More information

Types of Databases - By Scope

Types of Databases - By Scope Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of

More information

Chapter 8 Data Analysis, Modelling and Knowledge Discovery in Bioinformatics

Chapter 8 Data Analysis, Modelling and Knowledge Discovery in Bioinformatics Chapter 8 Data Analysis, Modelling and Knowledge Discovery in Bioinformatics Prof. Nik Kasabov nkasabov@aut.ac.nz http://www.kedri.info 12/16/2002 Nik Kasabov - Evolving Connectionist Systems Overview

More information

ENGR 213 Bioengineering Fundamentals April 25, A very coarse introduction to bioinformatics

ENGR 213 Bioengineering Fundamentals April 25, A very coarse introduction to bioinformatics A very coarse introduction to bioinformatics In this exercise, you will get a quick primer on how DNA is used to manufacture proteins. You will learn a little bit about how the building blocks of these

More information

Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 4 - Polymerase Chain Reaction (PCR)

Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 4 - Polymerase Chain Reaction (PCR) Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 4 - Polymerase Chain Reaction (PCR) Progressing with the sequence of experiments, we are now ready to amplify the green

More information

Bioinformatics. Outline of lecture

Bioinformatics. Outline of lecture Bioinformatics Uma Chandran, MSIS, PhD Department of Biomedical Informatics University of Pittsburgh chandran@pitt.edu 412 648 9326 07/08/2014 Outline of lecture What is Bioinformatics? Examples of bioinformatics

More information

Hidden Markov Models. Some applications in bioinformatics

Hidden Markov Models. Some applications in bioinformatics Hidden Markov Models Some applications in bioinformatics Hidden Markov models Developed in speech recognition in the late 1960s... A HMM M (with start- and end-states) defines a regular language L M of

More information

Human Chromosomes Section 14.1

Human Chromosomes Section 14.1 Human Chromosomes Section 14.1 In Today s class. We will look at Human chromosome and karyotypes Autosomal and Sex chromosomes How human traits are transmitted How traits can be traced through entire families

More information

AC Algorithms for Mining Biological Sequences (COMP 680)

AC Algorithms for Mining Biological Sequences (COMP 680) AC-04-18 Algorithms for Mining Biological Sequences (COMP 680) Instructor: Mathieu Blanchette School of Computer Science and McGill Centre for Bioinformatics, 332 Duff Building McGill University, Montreal,

More information

Introduction to Molecular Biology

Introduction to Molecular Biology Introduction to Molecular Biology Bioinformatics: Issues and Algorithms CSE 308-408 Fall 2007 Lecture 2-1- Important points to remember We will study: Problems from bioinformatics. Algorithms used to solve

More information

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015 Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck

More information

TEACHING PLAN FOR. Genetics and Genomics. 1. Basic description

TEACHING PLAN FOR. Genetics and Genomics. 1. Basic description TEACHING PLAN FOR Genetics and Genomics 1. Basic description Name of the course: Genetics and Genomics Module: Life Science Academic year: 2016-2017 Year: 2017 Term: Third Degree / Course: Bioinformatics

More information

EUROPEAN PATENT OFFICE U.S. PATENT AND TRADEMARK OFFICE CPC NOTICE OF CHANGES 647 DATE: FEBRUARY 1, 2019 PROJECT RP0573 G06F 19/00

EUROPEAN PATENT OFFICE U.S. PATENT AND TRADEMARK OFFICE CPC NOTICE OF CHANGES 647 DATE: FEBRUARY 1, 2019 PROJECT RP0573 G06F 19/00 EUROPEAN PATENT OFFICE U.S. PATENT AND TRADEMARK OFFICE The following classification changes will be effected by this Notice of Changes: Action Subclass Group(s) SCHEME: Symbols Deleted: C40B 30/02 C40B

More information

Bioinformatics: Sequence Analysis. COMP 571 Luay Nakhleh, Rice University

Bioinformatics: Sequence Analysis. COMP 571 Luay Nakhleh, Rice University Bioinformatics: Sequence Analysis COMP 571 Luay Nakhleh, Rice University Course Information Instructor: Luay Nakhleh (nakhleh@rice.edu); office hours by appointment (office: DH 3119) TA: Leo Elworth (DH

More information

INTRODUCTION NEW GENETIC TECHNIQUES IN METABOLIC DISEASES 26/01/2016 FROM ONE GENERATION TO THE NEXT. Image challenge of the week D.

INTRODUCTION NEW GENETIC TECHNIQUES IN METABOLIC DISEASES 26/01/2016 FROM ONE GENERATION TO THE NEXT. Image challenge of the week D. NEW GENETIC TECHNIQUES IN METABOLIC DISEASES D. RYMEN, MD, PHD Pentalfa session Leuven, January 21 st 2016 INTRODUCTION Image challenge of the week 1 INTRODUCTION But what about Hypotonia Facial dysmorphism

More information

Rapid Transcriptome Characterization for a nonmodel organism using 454 pyrosequencing

Rapid Transcriptome Characterization for a nonmodel organism using 454 pyrosequencing Rapid Transcriptome Characterization for a nonmodel organism using 454 pyrosequencing "#$%&'()*+,"(-*."#$%&/.,"*01*0.,(%-*.&0("2*01*3,$,45,"-*4#66&*71** 3"#)(82,"-*2&9:)($*)1*"(03&"2-*#)66(*.(8$6#*;

More information

From Fossils to Phylogenies. Dane Besser and Baylee Goodwin In the laboratory of Stephen Ramsey

From Fossils to Phylogenies. Dane Besser and Baylee Goodwin In the laboratory of Stephen Ramsey From Fossils to Phylogenies Dane Besser and Baylee Goodwin In the laboratory of Stephen Ramsey Who are we? Professor Stephen Ramsey Ph.D. from University of Maryland, faculty in Biomedical Sciences. Baylee

More information

NGS Approaches to Epigenomics

NGS Approaches to Epigenomics I519 Introduction to Bioinformatics, 2013 NGS Approaches to Epigenomics Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Contents Background: chromatin structure & DNA methylation Epigenomic

More information