Bioinformatics. Ingo Ruczinski. Some selected examples... and a bit of an overview
|
|
- Kenneth Lawrence
- 6 years ago
- Views:
Transcription
1 Bioinformatics Some selected examples... and a bit of an overview Department of Biostatistics Johns Hopkins Bloomberg School of Public Health July 19, EnviroHealth Connections
2 Bioinformatics and Computational Biology Wikipedia: Bioinformatics and computational biology involve the use of techniques including applied mathematics, informatics, statistics, computer science, artificial intelligence, chemistry, and biochemistry to solve biological problems usually on the molecular level. Major research efforts in the field include sequence alignment, gene finding, genome assembly, protein structure alignment, protein structure prediction, prediction of gene expression and protein-protein interactions, and the modeling of evolution.
3 Bioinformatics and Computational Biology Wikipedia: The terms bioinformatics and computational biology are often used interchangeably. However bioinformatics more properly refers to the creation and advancement of algorithms, computational and statistical techniques, and theory to solve formal and practical problems inspired from the management and analysis of biological data. Computational biology, on the other hand, refers to hypothesis-driven investigation of a specific biological problem using computers, carried out with experimental or simulated data, with the primary goal of discovery and the advancement of biological knowledge.
4 Bioinformatics and Computational Biology NIH definition of Bioinformatics and Computational Biology: Bioinformatics and computational biology are rooted in life sciences as well as computer and information sciences and technologies. Both of these interdisciplinary approaches draw from specific disciplines such as mathematics, physics, computer science and engineering, biology, and behavioral science. Bioinformatics applies principles of information sciences and technologies to make the vast, diverse, and complex life sciences data more understandable and useful. Computational biology uses mathematical and computational approaches to address theoretical and experimental questions in biology. Although bioinformatics and computational biology are distinct, there is also significant overlap and activity at their interface.
5 Bioinformatics and Computational Biology NIH definition of Bioinformatics and Computational Biology: The NIH Biomedical Information Science and Technology Initiative Consortium agreed on the following definitions of bioinformatics and computational biology recognizing that no definition could completely eliminate overlap with other activities or preclude variations in interpretation by different individuals and organizations. Bioinformatics: Research, development, or application of computational tools and approaches for expanding the use of biological, medical, behavioral or health data, including those to acquire, store, organize, archive, analyze, or visualize such data. Computational Biology: The development and application of data-analytical and theoretical methods, mathematical modeling and computational simulation techniques to the study of biological, behavioral, and social systems.
6 The central dogma of biology Drawn by Ebbe Sloth Andersen
7 Topics DNA RNA Protein DNA Sequence analysis, genome annotation, evolutionary biology, phylogeny, DNA alterations, comparative genomics, SNP association studies RNA Analysis of gene expression and regulation Proteins Analysis of protein expression, protein-protein docking, prediction of protein structure Systems Biology: modeling biological systems, gene/protein networks
8 Some selected examples 1 Chromosomal alterations 2 Protein structure prediction 3 2D gel electrophoresis
9 Some selected examples 1 Chromosomal alterations 2 Protein structure prediction 3 2D gel electrophoresis
10 Karyotypes
11 Trisomy
12 DNA changes
13 The data
14 Deletion
15 FISH
16 Amplification
17 Uniparental Isodisomy
18 Cancer samples
19 Mosaicism
20 SNPchip S4 classes and methods
21 Estimation 1 By SNP: Estimate genotype and copy number for each SNP. 2 Within a sample: Borrow strength between SNPs to infer regions of LOH and copy number changes. 3 Between samples: Comparison between normal and disease populations to find chromosomal alterations associated with disease.
22 Vanilla ICE Deletion Normal LOH Amplification A D B C E 2 1 Van ICE A D B E Van ICE Mb
23 A HapMap sample Deletion Normal LOH Amplification 1 Van ICE Van ICE Mb
24 Many HapMap samples
25 SNP Trio
26 HMM for SNP Trio chromosome 10 chromosome 22 BPI BPI UPI F UPI F UPI M UPI M MI D MI D MI S non BPI MI S non BPI BPI BPI position (Mb) position (Mb)
27 HMM for SNP Trio BPI UPI P UPI M MI D MI S HMM BPI UPI P UPI M MI D MI S HMM copy number child copy number child mother mother copy number copy number copy number father copy number father
28 Some selected examples 1 Chromosomal alterations 2 Protein structure prediction 3 2D gel electrophoresis
29 Proteins Amino acids are the building blocks of proteins.
30 Proteins Both figures show the same protein (the bacterial protein L). The right figure also highlights the secondary structure elements.
31 Proteins From Lehninger, Principles of Biochemistry
32 Functional Annotation
33 Genome Wide Annotation
34 Some selected examples 1 Chromosomal alterations 2 Protein structure prediction 3 2D gel electrophoresis
35 2D Gel Electrophoresis
36 2D Gel Electrophoresis
37 2D Gel Electrophoresis A B A:1 A:2 A:3 A:4 A:5 A:6 A:7 A:8 A:9 A:10 A:11 A:12 B:1 B:2 B:3 B:4 B:5 B:6 B:7 B:8 B:9 B:10 B:11 B:12
38 2D Gel Electrophoresis A B A:1 A:2 A:3 A:4 B:1 B:2 B:3 B:4
39 2D Gel Electrophoresis % reduction of concentration as compared to background st Trimester 3 rd Trimester 20 Folate Placebo
40 2D Gel Electrophoresis
41 2D Gel Electrophoresis
42 iruczins/
Approaches for the Assessment of Chromosomal Alterations using Copy Number and Genotype Estimates
Approaches for the Assessment of Chromosomal Alterations using Copy Number and Genotype Estimates Department of Biostatistics Johns Hopkins Bloomberg School of Public Health September 20, 2007 Karyotypes
More informationFollowing text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005
Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of
More informationComputational methods in bioinformatics: Lecture 1
Computational methods in bioinformatics: Lecture 1 Graham J.L. Kemp 2 November 2015 What is biology? Ecosystem Rain forest, desert, fresh water lake, digestive tract of an animal Community All species
More informationThis place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.
G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic
More informationIntroduction to BIOINFORMATICS
COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationBiology 644: Bioinformatics
Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....
More information1.1 What is bioinformatics? What is computational biology?
Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, October 16, 2006 3 1 Introduction 1.1 What is bioinformatics? What is computational biology? Bioinformatics and computational biology are multidisciplinary
More informationbioinformatica 6EF2F181AA1830ABC10ABAC56EA5E191 Bioinformatica 1 / 5
Bioinformatica 1 / 5 2 / 5 3 / 5 Bioinformatica Bioinformatics is the name given to these mathematical and computing approaches used to glean understanding of biological processes. Common activities in
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map
More informationGenetics and Bioinformatics
Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Dortmund, 16.-20.07.2007 Lectures: Sven Rahmann Exercises: Udo Feldkamp, Michael Wurst 1 Goals of this course Learn about Software tools Databases Methods (Algorithms) in
More informationBIOINFORMATICS IN BIOCHEMISTRY
BIOINFORMATICS IN BIOCHEMISTRY Bioinformatics a field at the interface of molecular biology, computer science, and mathematics Bioinformatics focuses on the analysis of molecular sequences (DNA, RNA, and
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Alla L Lapidus, Ph.D. SPbSU St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as "the study of
More informationGrundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson
Grundlagen der Bioinformatik, SoSe 11, D. Huson, April 11, 2011 1 1 Introduction Grundlagen der Bioinformatik Summer 2011 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a) 1.1
More informationCMSE 520 BIOMOLECULAR STRUCTURE, FUNCTION AND DYNAMICS
CMSE 520 BIOMOLECULAR STRUCTURE, FUNCTION AND DYNAMICS (Computational Structural Biology) OUTLINE Review: Molecular biology Proteins: structure, conformation and function(5 lectures) Generalized coordinates,
More informationEstimation problems in high throughput SNP platforms
Estimation problems in high throughput SNP platforms Rob Scharpf Department of Biostatistics Johns Hopkins Bloomberg School of Public Health November, 8 Outline Introduction Introduction What is a SNP?
More informationCourse Information. Introduction to Algorithms in Computational Biology Lecture 1. Relations to Some Other Courses
Course Information Introduction to Algorithms in Computational Biology Lecture 1 Meetings: Lecture, by Dan Geiger: Mondays 16:30 18:30, Taub 4. Tutorial, by Ydo Wexler: Tuesdays 10:30 11:30, Taub 2. Grade:
More informationBIOINFORMATICS THE MACHINE LEARNING APPROACH
88 Proceedings of the 4 th International Conference on Informatics and Information Technology BIOINFORMATICS THE MACHINE LEARNING APPROACH A. Madevska-Bogdanova Inst, Informatics, Fac. Natural Sc. and
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Dr. Taysir Hassan Abdel Hamid Lecturer, Information Systems Department Faculty of Computer and Information Assiut University taysirhs@aun.edu.eg taysir_soliman@hotmail.com
More informationIntroduction to Algorithms in Computational Biology Lecture 1
Introduction to Algorithms in Computational Biology Lecture 1 Background Readings: The first three chapters (pages 1-31) in Genetics in Medicine, Nussbaum et al., 2001. This class has been edited from
More informationCENTER FOR BIOTECHNOLOGY
CENTER FOR BIOTECHNOLOGY Keith A. McGee, Ph.D., Program Director Math and Science Building, 3 rd Floor 1000 ASU Drive #870 Phone: 601-877-6198 FAX: 601-877-2328 Degree Offered Required Admission Test M.
More informationBIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM)
BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM) PROGRAM TITLE DEGREE TITLE Master of Science Program in Bioinformatics and System Biology (International Program) Master of Science (Bioinformatics
More informationSYLLABUS FOR BS BIOINFORMATICS (4-YEAR DEGREE PROGRAMME)
SYLLABUS FOR BS BIOINFORMATICS (4-YEAR DEGREE PROGRAMME) COURSE BREAKUP BNB-301 Cell Biology 3(2-1) BNB-303 Fundamentals of Genetics 4(3-1) BNB-305 General Chemistry 3(3-0) CSI-321 Introduction to Computing
More informationScoring Alignments. Genome 373 Genomic Informatics Elhanan Borenstein
Scoring Alignments Genome 373 Genomic Informatics Elhanan Borenstein A quick review Course logistics Genomes (so many genomes) The computational bottleneck Python: Programs, input and output Number and
More informationComputational Genomics ( )
Computational Genomics (0382.3102) http://www.cs.tau.ac.il/ bchor/comp-genom.html Prof. Benny Chor benny@cs.tau.ac.il Tel-Aviv University Fall Semester, 2002-2003 c Benny Chor p.1 AdministraTrivia Students
More informationIntroduction to Bioinformatics and Gene Expression Technology
Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA
More informationPerspectives on the Priorities for Bioinformatics Education in the 21 st Century
Perspectives on the Priorities for Bioinformatics Education in the 21 st Century Oyekanmi Nash, PhD Associate Professor & Director Genetics, Genomics & Bioinformatics National Biotechnology Development
More informationIntroduction. CS482/682 Computational Techniques in Biological Sequence Analysis
Introduction CS482/682 Computational Techniques in Biological Sequence Analysis Outline Course logistics A few example problems Course staff Instructor: Bin Ma (DC 3345, http://www.cs.uwaterloo.ca/~binma)
More informationEra with Computational Biology/Toxicology
USM Seminar 1/22/2010 Embracing the Post-Omics Era with Computational Biology/Toxicology Ping Gong Environmental Genomics and Genetics (EGG) Team @ Environmental Laboratory Outline Introduction Bioinformatics
More information9/19/13. cdna libraries, EST clusters, gene prediction and functional annotation. Biosciences 741: Genomics Fall, 2013 Week 3
cdna libraries, EST clusters, gene prediction and functional annotation Biosciences 741: Genomics Fall, 2013 Week 3 1 2 3 4 5 6 Figure 2.14 Relationship between gene structure, cdna, and EST sequences
More informationGENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.
!! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,
More information2/19/13. Contents. Applications of HMMs in Epigenomics
2/19/13 I529: Machine Learning in Bioinformatics (Spring 2013) Contents Applications of HMMs in Epigenomics Yuzhen Ye School of Informatics and Computing Indiana University, Bloomington Spring 2013 Background:
More informationApplications of HMMs in Epigenomics
I529: Machine Learning in Bioinformatics (Spring 2013) Applications of HMMs in Epigenomics Yuzhen Ye School of Informatics and Computing Indiana University, Bloomington Spring 2013 Contents Background:
More informationComputational Biology
3.3.3.2 Computational Biology Today, the field of Computational Biology is a well-recognised and fast-emerging discipline in scientific research, with the potential of producing breakthroughs likely to
More informationIntroduction to BIOINFORMATICS
Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What
More informationMolecular Biology. IMBB 2017 RAB, Kigali - Rwanda May 02 13, Francesca Stomeo
Molecular Biology IMBB 2017 RAB, Kigali - Rwanda May 02 13, 2017 Francesca Stomeo Molecular biology is the study of biology at a molecular level, especially DNA and RNA - replication, transcription, translation,
More informationMATH 5610, Computational Biology
MATH 5610, Computational Biology Lecture 1 Intro to Molecular Biology Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/14 Announcements Homework 1 due next Tuesday
More informationThe Integrated Biomedical Sciences Graduate Program
The Integrated Biomedical Sciences Graduate Program at the university of notre dame Cutting-edge biomedical research and training that transcends traditional departmental and disciplinary boundaries to
More informationMachine Learning. HMM applications in computational biology
10-601 Machine Learning HMM applications in computational biology Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Biological data is rapidly
More informationLiving Environment. Directions: Use Aim # (Unit 4) to complete this study guide.
Name: Date: Period: Living Environment Living Environment Unit 4 Genetics Study Guide Due Date: Test Date: Unit 5 Important Topics: I. Aim # 20 DNA Structure and Function II. Aim # 21 DNA Replication III.
More informationLinking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls
Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls BMI/CS 776 www.biostat.wisc.edu/bmi776/ Mark Craven craven@biostat.wisc.edu Spring 2011 1. Understanding Human Genetic Variation!
More informationComputers in Biology and Bioinformatics
Computers in Biology and Bioinformatics 1 Biology biology is roughly defined as "the study of life" it is concerned with the characteristics and behaviors of organisms, how species and individuals come
More informationBIMM 143: Introduction to Bioinformatics (Winter 2018)
BIMM 143: Introduction to Bioinformatics (Winter 2018) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bimm143_w18/ DRAFT: 2017-12-02 (20:48:10 PST
More informationBig picture and history
Big picture and history (and Computational Biology) CS-5700 / BIO-5323 Outline 1 2 3 4 Outline 1 2 3 4 First to be databased were proteins The development of protein- s (Sanger and Tuppy 1951) led to the
More informationBioinformatics. Dick de Ridder. Tuinbouw Digitaal, 12/11/15
Bioinformatics Dick de Ridder Tuinbouw Digitaal, 12/11/15 Bioinformatics is not Bioinformatics is also not Bioinformatics Bioinformatics (2) Bioinformatics (3) US National Institutes of Health (NIH): Bioinformatics:
More informationBIOINFORMATICS Introduction
BIOINFORMATICS Introduction Mark Gerstein, Yale University bioinfo.mbb.yale.edu/mbb452a 1 (c) Mark Gerstein, 1999, Yale, bioinfo.mbb.yale.edu What is Bioinformatics? (Molecular) Bio -informatics One idea
More informationDNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.
DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Changhui (Charles) Yan Old Main 401 F http://www.cs.usu.edu www.cs.usu.edu/~cyan 1 How Old Is The Discipline? "The term bioinformatics is a relatively recent invention, not
More informationStudying the Human Genome. Lesson Overview. Lesson Overview Studying the Human Genome
Lesson Overview 14.3 Studying the Human Genome THINK ABOUT IT Just a few decades ago, computers were gigantic machines found only in laboratories and universities. Today, many of us carry small, powerful
More informationClassification and Learning Using Genetic Algorithms
Sanghamitra Bandyopadhyay Sankar K. Pal Classification and Learning Using Genetic Algorithms Applications in Bioinformatics and Web Intelligence With 87 Figures and 43 Tables 4y Spri rineer 1 Introduction
More informationDOWNLOAD OR READ : UNDERSTANDING BIOINFORMATICS PDF EBOOK EPUB MOBI
DOWNLOAD OR READ : UNDERSTANDING BIOINFORMATICS PDF EBOOK EPUB MOBI Page 1 Page 2 understanding bioinformatics understanding bioinformatics pdf understanding bioinformatics Bioinformatics / ËŒ b aéª. oêš
More informationIntroduction to 'Omics and Bioinformatics
Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current
More informationRESEARCH METHODOLOGY, BIOSTATISTICS AND IPR
MB 401: RESEARCH METHODOLOGY, BIOSTATISTICS AND IPR Objectives: The overall aim of the course is to deepen knowledge regarding basic concepts of Biostatistics, the research process in occupational therapy
More informationAn Analytical Upper Bound on the Minimum Number of. Recombinations in the History of SNP Sequences in Populations
An Analytical Upper Bound on the Minimum Number of Recombinations in the History of SNP Sequences in Populations Yufeng Wu Department of Computer Science and Engineering University of Connecticut Storrs,
More informationChallenging algorithms in bioinformatics
Challenging algorithms in bioinformatics 11 October 2018 Torbjørn Rognes Department of Informatics, UiO torognes@ifi.uio.no What is bioinformatics? Definition: Bioinformatics is the development and use
More informationELE4120 Bioinformatics. Tutorial 5
ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar
More informationCollege- and Career Readiness Standards for Science Genetics
College- and Career Readiness Genetics Mississippi 2018 GEN.1 Structure and Function of DNA GEN.1A Students will demonstrate that all cells contain genetic material in the form of DNA. GEN.1A.1 Model the
More informationCSC 121 Computers and Scientific Thinking
CSC 121 Computers and Scientific Thinking Fall 2005 Computers in Biology and Bioinformatics 1 Biology biology is roughly defined as "the study of life" it is concerned with the characteristics and behaviors
More informationEvolutionary Genetics: Part 1 Polymorphism in DNA
Evolutionary Genetics: Part 1 Polymorphism in DNA S. chilense S. peruvianum Winter Semester 2012-2013 Prof Aurélien Tellier FG Populationsgenetik Color code Color code: Red = Important result or definition
More informationCrash-course in genomics
Crash-course in genomics Molecular biology : How does the genome code for function? Genetics: How is the genome passed on from parent to child? Genetic variation: How does the genome change when it is
More informationBGEN Laboratory Methods in Human and Medical Genetics
BMG COURSES BGEN 7000 - Research Seminar MSc Consists of presentations of the student's current research. For Master s students only. 1.0 credit hours. BGEN 7020 Proteins (Formerly 137.702) Three hours
More informationPh.D. Program in Genetics, Genomics, and Cancer Biology
Ph.D. Program in Genetics, Genomics, and Cancer Biology Program Requirements Required Courses Credits GE 501, 511, 521, 531 Experimental Methods Pre-entry, I, II, III (3 research rotations are usually
More informationLecture 1. Bioinformatics 2. About me... The class (2009) Course Outcomes. What do I think you know?
Lecture 1 Bioinformatics 2 Introduction Course Overview & Assessment Introduction to Bioinformatics Research Careers and PhD options Core topics in Bioinformatics the central dogma of molecular biology
More informationImaging informatics computer assisted mammogram reading Clinical aka medical informatics CDSS combining bioinformatics for diagnosis, personalized
1 2 3 Imaging informatics computer assisted mammogram reading Clinical aka medical informatics CDSS combining bioinformatics for diagnosis, personalized medicine, risk assessment etc Public Health Bio
More informationBioinformatics 2. Lecture 1
Bioinformatics 2 Introduction Lecture 1 Course Overview & Assessment Introduction to Bioinformatics Research Careers and PhD options Core topics in Bioinformatics the central dogma of molecular biology
More informationALGORITHMS IN BIO INFORMATICS. Chapman & Hall/CRC Mathematical and Computational Biology Series A PRACTICAL INTRODUCTION. CRC Press WING-KIN SUNG
Chapman & Hall/CRC Mathematical and Computational Biology Series ALGORITHMS IN BIO INFORMATICS A PRACTICAL INTRODUCTION WING-KIN SUNG CRC Press Taylor & Francis Group Boca Raton London New York CRC Press
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Vocabulary Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 Gene: Genetics: Genome: Genomics: hereditary
More informationProf. Clare Bates Congdon, PhD
Women in Bioinformatics Forum Ballroom D, Tuesday 12:15PM-1:15PM Open to EVERYONE! Lunch Provided! ACM BCB 2013 Bioinformatics: Translation Catalyst, Enabler, Hub Bio+Med Study Discovery & Development
More informationComplex Adaptive Systems Forum: Transformative CAS Initiatives in Biomedicine
Complex Adaptive Systems Forum: Transformative CAS Initiatives in Biomedicine January 18, 2013 Anna D. Barker, Ph.D. Director, Transformative Healthcare Networks C-Director, Complex Adaptive Systems Initiative
More informationExome Sequencing Exome sequencing is a technique that is used to examine all of the protein-coding regions of the genome.
Glossary of Terms Genetics is a term that refers to the study of genes and their role in inheritance the way certain traits are passed down from one generation to another. Genomics is the study of all
More informationFUNCTIONAL BIOINFORMATICS
Molecular Biology-2018 1 FUNCTIONAL BIOINFORMATICS PREDICTING THE FUNCTION OF AN UNKNOWN PROTEIN Suppose you have found the amino acid sequence of an unknown protein and wish to find its potential function.
More informationAlgorithms for Genetics: Introduction, and sources of variation
Algorithms for Genetics: Introduction, and sources of variation Scribe: David Dean Instructor: Vineet Bafna 1 Terms Genotype: the genetic makeup of an individual. For example, we may refer to an individual
More informationClinical and Translational Bioinformatics
Clinical and Translational Bioinformatics An Overview Jussi Paananen Institute of Biomedicine September 4 th, 2015 Bioinformatics Bioinformatics combines statistics, computer science and information technology
More informationGenome 373: Genomic Informatics. Elhanan Borenstein
Genome 373: Genomic Informatics Elhanan Borenstein Genome 373 This course is intended to introduce students to the breadth of problems and methods in computational analysis of genomes and biological systems,
More informationShort Course Instructors
Short Course Instructors Andrew Allen, Ph.D., Professor of Biostatistics and Bioinformatics and Director of the new Duke Center of Statistical Genetics and Genomics, Duke University, has expertise in statistical
More informationTwo Mark question and Answers
1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics IMBB 2017 RAB, Kigali - Rwanda May 02 13, 2017 Joyce Nzioki Plan for the Week Introduction to Bioinformatics Raw sanger sequence data Introduction to CLC Bio Quality Control
More informationSingle Nucleotide Variant Analysis. H3ABioNet May 14, 2014
Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide
More informationVALLIAMMAI ENGINEERING COLLEGE
VALLIAMMAI ENGINEERING COLLEGE SRM Nagar, Kattankulathur 603 203 DEPARTMENT OF COMPUTER SCIENCE AND ENGINEERING QUESTION BANK VII SEMESTER BM6005 BIO INFORMATICS Regulation 2013 Academic Year 2018-19 Prepared
More informationWhat is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases.
What is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases. Bioinformatics is the marriage of molecular biology with computer
More informationTypes of Databases - By Scope
Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of
More informationChapter 8 Data Analysis, Modelling and Knowledge Discovery in Bioinformatics
Chapter 8 Data Analysis, Modelling and Knowledge Discovery in Bioinformatics Prof. Nik Kasabov nkasabov@aut.ac.nz http://www.kedri.info 12/16/2002 Nik Kasabov - Evolving Connectionist Systems Overview
More informationENGR 213 Bioengineering Fundamentals April 25, A very coarse introduction to bioinformatics
A very coarse introduction to bioinformatics In this exercise, you will get a quick primer on how DNA is used to manufacture proteins. You will learn a little bit about how the building blocks of these
More informationTexas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 4 - Polymerase Chain Reaction (PCR)
Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 4 - Polymerase Chain Reaction (PCR) Progressing with the sequence of experiments, we are now ready to amplify the green
More informationBioinformatics. Outline of lecture
Bioinformatics Uma Chandran, MSIS, PhD Department of Biomedical Informatics University of Pittsburgh chandran@pitt.edu 412 648 9326 07/08/2014 Outline of lecture What is Bioinformatics? Examples of bioinformatics
More informationHidden Markov Models. Some applications in bioinformatics
Hidden Markov Models Some applications in bioinformatics Hidden Markov models Developed in speech recognition in the late 1960s... A HMM M (with start- and end-states) defines a regular language L M of
More informationHuman Chromosomes Section 14.1
Human Chromosomes Section 14.1 In Today s class. We will look at Human chromosome and karyotypes Autosomal and Sex chromosomes How human traits are transmitted How traits can be traced through entire families
More informationAC Algorithms for Mining Biological Sequences (COMP 680)
AC-04-18 Algorithms for Mining Biological Sequences (COMP 680) Instructor: Mathieu Blanchette School of Computer Science and McGill Centre for Bioinformatics, 332 Duff Building McGill University, Montreal,
More informationIntroduction to Molecular Biology
Introduction to Molecular Biology Bioinformatics: Issues and Algorithms CSE 308-408 Fall 2007 Lecture 2-1- Important points to remember We will study: Problems from bioinformatics. Algorithms used to solve
More informationLeonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck
More informationTEACHING PLAN FOR. Genetics and Genomics. 1. Basic description
TEACHING PLAN FOR Genetics and Genomics 1. Basic description Name of the course: Genetics and Genomics Module: Life Science Academic year: 2016-2017 Year: 2017 Term: Third Degree / Course: Bioinformatics
More informationEUROPEAN PATENT OFFICE U.S. PATENT AND TRADEMARK OFFICE CPC NOTICE OF CHANGES 647 DATE: FEBRUARY 1, 2019 PROJECT RP0573 G06F 19/00
EUROPEAN PATENT OFFICE U.S. PATENT AND TRADEMARK OFFICE The following classification changes will be effected by this Notice of Changes: Action Subclass Group(s) SCHEME: Symbols Deleted: C40B 30/02 C40B
More informationBioinformatics: Sequence Analysis. COMP 571 Luay Nakhleh, Rice University
Bioinformatics: Sequence Analysis COMP 571 Luay Nakhleh, Rice University Course Information Instructor: Luay Nakhleh (nakhleh@rice.edu); office hours by appointment (office: DH 3119) TA: Leo Elworth (DH
More informationINTRODUCTION NEW GENETIC TECHNIQUES IN METABOLIC DISEASES 26/01/2016 FROM ONE GENERATION TO THE NEXT. Image challenge of the week D.
NEW GENETIC TECHNIQUES IN METABOLIC DISEASES D. RYMEN, MD, PHD Pentalfa session Leuven, January 21 st 2016 INTRODUCTION Image challenge of the week 1 INTRODUCTION But what about Hypotonia Facial dysmorphism
More informationRapid Transcriptome Characterization for a nonmodel organism using 454 pyrosequencing
Rapid Transcriptome Characterization for a nonmodel organism using 454 pyrosequencing "#$%&'()*+,"(-*."#$%&/.,"*01*0.,(%-*.&0("2*01*3,$,45,"-*4#66&*71** 3"#)(82,"-*2&9:)($*)1*"(03&"2-*#)66(*.(8$6#*;
More informationFrom Fossils to Phylogenies. Dane Besser and Baylee Goodwin In the laboratory of Stephen Ramsey
From Fossils to Phylogenies Dane Besser and Baylee Goodwin In the laboratory of Stephen Ramsey Who are we? Professor Stephen Ramsey Ph.D. from University of Maryland, faculty in Biomedical Sciences. Baylee
More informationNGS Approaches to Epigenomics
I519 Introduction to Bioinformatics, 2013 NGS Approaches to Epigenomics Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Contents Background: chromatin structure & DNA methylation Epigenomic
More information