Canonical B-DNA CGCGTTGACAACTGCAGAATC GC AT CG TA AT GC TA TA CG AT 20 Å. Minor Groove 34 Å. Major Groove 3.4 Å. Strands are antiparallel
|
|
|
- Rafe Erik Harper
- 6 years ago
- Views:
Transcription
1 DNA
2 Canonical B-DNA 20 Å GC AT CG TA CGCGTTGACAACTGCAGAATC 34 Å AT GC TA Minor Groove 3.4 Å TA CG AT Major Groove Strands are antiparallel CG GC GC
3 Canonical B DNA First determined experimentally by fiber diffraction (Arnott) C2 -endo sugar puckers High anti glycosidic angles Right handed 10 base pairs per turn Bases perpendicular to the helix axis and stacked over the axis Overall bending as much as 15 degrees Over 230 structures 25 with base mis-pairing only cause local perturbations
4 A and B DNA allomorphs Hydration Antiparallel strands B A
5 Review of DNA Structure
6 DNA Structures: A, B and Z
7 Review of DNA Structure
8 DNA Structures: A, B and Z Property A-DNA B-DNA Z-DNA Helix Right-handed Right-handed Left-handed Sugar C2 -endo C3 -endo C2 endo (C) C3 endo (G) Base pairs /turn Pitch 28 Å 34 Å 44.6 Å Tilt 20 deg 0-7 deg Rise /bp 2.3 Å 3.4 Å 3.7 Å Diameter 23 Å 20 Å 17 Å
9 DNA grooves MAJOR MINOR Important for recognition and binding
10 Spine of Hydration
11 B-DNA (longitudinal view)
12 R.H. helix B-DNA (lateral view)
13 DNA Structures: B-DNA d(cgcgaattcgcg) d(cgcgaattcgcg)
14 A-DNA (longitudinal view)
15 R.H. helix A-DNA (lateral view)
16 DNA Structures: A-DNA d(agcttgccttgag) d(ctcaaggcaagct)
17 Canonical A DNA C3 -endo sugar puckers brings consecutive phosphates closer together 5.9A rather than 7.0 Glycosidic angle from high anti to anti Base pairs twisted and nearly 5A from helix axis Helix rise 2.56A rather than 3.4A Helix wider and 11 base pairs per repeat Major groove now deep and narrow Minor grove wide and very shallow
18 Z-DNA (longitudinal view)
19 L.H. helix Z-DNA (lateral view)
20 DNA Structures: Z-DNA d(cgcgcgcgcgcg) d(cgcgcgcgcgcg)
21 Base pairs are rotated in Z-DNA
22 Z-DNA Helix has left-handed sense Can be formed in vivo, given proper sequence and superhelical tension, but function remains obscure. Narrower, more elongated helix than A or B. Major "groove" not really groove Narrow minor groove Conformation favored by high salt concentrations, some base substitutions, but requires alternating purine-pyrimidine sequence. N2-amino of G H-bonds to 5' PO: explains slow exchange of proton, need for G purine. Base pairs nearly perpendicular to helix axis GpC repeat, not single base-pair P-P distances: vary for GpC and CpG GpC stack: good base overlap CpG: less overlap. Zigzag backbone due to C sugar conformation compensating for G glycosidic bond conformation Conformations: G; syn, C2'-endo C; anti, C3'-endo
23 Drug complexes to DNA Bound to the base pair double helix can accommodate this Bound in the minor grove show base specificity Cis-platinum drugs
24 Nucleotide triphosphates - O NH 2 N N N N O O O P O P O P O CH 5' 2 O H H O - O - O - 1' 4' 2'-deoxyadenosine 5' triphosphate H 3' 2' H OH H O HN N H 2 N N N O O O - O P O P O P O CH 5' 2 O 2'-deoxyguanosine 5' triphosphate O - O - O - 4' H H 1' H 3' 2' H OH H 2'-deoxycytidine 5' triphosphate O O O - O P O P O P O CH 5' 2 NH 2 N O N O H H O - O - O - 4' 1' H H 3' 2' OH H - O O H N O N O O O P O P O P O CH 5' 2 O O - O - O - 4' H H 1' thymidine 5' triphosphate H H 3' 2' OH H CH 3
25 Unusual DNA structures
26 Alternative base pairs Reversed Watson-Crick Watson-Crick Hoogsteen Reversed Hoogsteen
27 - note C(N3) protonation Watson-Crick + Hoogsteen = Base triplet
28 Triple helix DNA
29 Guanine Hoogsteen pairing Base tetraplex
30 Quadruplex DNA
31 Inverted repeat can lead to loop formation
32 Holliday junction DNA cruciform
33 PNA versus DNA
34 Achiral, peptide-like backbone Backbone is uncharged High thermal stability High-specificity hybridization with DNA Resistant to enzymatic degradation Can displace DNA strand of duplex Pyrimidine PNA strands can form 2:1 triplexes with ssdna Biotechnological applications Peptide Nucleic acid(pna)
35 Parallel-stranded DNA
36 I-DNA: intercalated parallel-stranded duplexes
37 α and β nucleotide anomers
38 H OH is not the only change in passing from DNA to RNA...
39 Books on DNA Principles of Nucleic Acid Structure, W. Saenger, 1984 Springer-Verlag Nucleic Acid Structure, Ed. S. Neidle, 1999 Oxford University Press DNA Structure and Function, R.R. Sinden, 1994 Academic Press Biochemistry, D. Voet and J.G. Voet, 1998 DeBoeck The Eighth Day of Creation, H.F. Judson, 1996 Cold Spring Harbour Press
1.1 Chemical structure and conformational flexibility of single-stranded DNA
1 DNA structures 1.1 Chemical structure and conformational flexibility of single-stranded DNA Single-stranded DNA (ssdna) is the building base for the double helix and other DNA structures. All these structures
Non-standard base pairs Non-standard base pairs play critical roles in the varied structures observed in DNA and RNA.
DNA ORIENTATION Non-standard base pairs Non-standard base pairs play critical roles in the varied structures observed in DNA and RNA. Non-standard base pairs Wobble and mismatched base pairs still use
Introduction to DNA. Natalia Tretyakova, College of Pharmacy, U. of Minnesota Richard Lavery, Institut de Biologie Physico-Chimique, Paris
Introduction to DNA Lecture notes edited by John Reif from PPT lectures by: Natalia Tretyakova, College of Pharmacy, U. of Minnesota Richard Lavery, Institut de Biologie Physico-Chimique, Paris Image from
MBMB,BCHM, or CHEM 451A
MBMB,BCHM, or CHEM 451A This is a team taught course Blaine Bartholomew: 1 st section Joseph Schmit: 2 nd section Peter Hardwicke:3 rd Section Text is Lehninger Principles of Biochemistry 4 th edition
MCB 110:Biochemistry of the Central Dogma of MB. MCB 110:Biochemistry of the Central Dogma of MB
MCB 110:Biochemistry of the Central Dogma of MB Part 1. DNA replication, repair and genomics (Prof. Alber) Part 2. RNA & protein synthesis. Prof. Zhou Part 3. Membranes, protein secretion, trafficking
Chapter 5: Nucleic Acids, etc.
Chapter 5: Nucleic Acids, etc. Voet & Voet: Sections 1 & 3 Pages 82-84 & 88-93 Any introductory Biochemistry textbook will have an introductory chapter on nucleic acids Slide 1 Nucleotides and Derivatives
Structural Bioinformatics (C3210) DNA and RNA Structure
Structural Bioinformatics (C3210) DNA and RNA Structure Importance of DNA/RNA 3D Structure Nucleic acids are essential materials found in all living organisms. Their main function is to maintain and transmit
Hmwk 6. Nucleic Acids
The purpose of this homework exercise is Hmwk 6. Nucleic Acids 1). to recognize fundamental features of B-form DNA and A-form RNA 2). to view the folded structure of trna B-FORM DNA In aqueous solutions,
Structural Bioinformatics GENOME 541 Spring 2018
Molecular composition of a rapidly dividing Escherichia coli cell Structural Bioinformatics GENOME 541 Spring 2018 Lecture 4: Nucleic Acids Frank DiMaio (dimaio@uw.edu) The major biopolymers DNA structure
DNA Structures. Biochemistry 201 Molecular Biology January 5, 2000 Doug Brutlag. The Structural Conformations of DNA
DNA Structures Biochemistry 201 Molecular Biology January 5, 2000 Doug Brutlag The Structural Conformations of DNA 1. The principle message of this lecture is that the structure of DNA is much more flexible
Nucleotides and Nucleic Acids
ucleotides and ucleic Acids ucleotides: Composed of a sugar; a weak nitrogenous base; at least one phosphoryl group - - P - C 2 Base *ucleoside: sugar + base 2 Classes of ucleotides: Ribonucleotides and
1/4/18 NUCLEIC ACIDS. Nucleic Acids. Nucleic Acids. ECS129 Instructor: Patrice Koehl
NUCLEIC ACIDS ECS129 Instructor: Patrice Koehl Nucleic Acids Nucleotides DNA Structure RNA Synthesis Function Secondary structure Tertiary interactions Wobble hypothesis DNA RNA Replication Transcription
NUCLEIC ACIDS. ECS129 Instructor: Patrice Koehl
NUCLEIC ACIDS ECS129 Instructor: Patrice Koehl Nucleic Acids Nucleotides DNA Structure RNA Synthesis Function Secondary structure Tertiary interactions Wobble hypothesis DNA RNA Replication Transcription
Biochemistry Prof. S. Dasgupta Department of Chemistry. Indian Institute of Technology Kharagpur. Lecture - 16 Nucleic Acids - I
Biochemistry Prof. S. Dasgupta Department of Chemistry. Indian Institute of Technology Kharagpur Lecture - 16 Nucleic Acids - I We start our discussion on Nucleic Acids and their components. Before we
Gene and DNA structure. Dr Saeb Aliwaini
Gene and DNA structure Dr Saeb Aliwaini 2016 DNA during cell cycle Cell cycle for different cell types Molecular Biology - "Study of the synthesis, structure, and function of macromolecules (DNA, RNA,
Paper 4: Biomolecules and Their Interactions Module 14: Chargaff's rule, DNA polymorphism
Paper 4: Biomolecules and Their Interactions Module 14: Chargaff's rule, DNA polymorphism Introduction The DNA structure described in the previous module (module 13) is observed for aqueous gels of DNA
Assembly and Characteristics of Nucleic Acid Double Helices
Assembly and Characteristics of Nucleic Acid Double Helices Patterns of base-base hydrogen bonds-characteristics of the base pairs Interactions between like and unlike bases have been observed in crystal
Structure of nucleic acids II Biochemistry 302. January 20, 2006
Structure of nucleic acids II Biochemistry 302 January 20, 2006 Intrinsic structural flexibility of RNA antiparallel A-form Fig. 4.19 High Temp Denaturants In vivo conditions Base stacking w/o base pairing/h-bonds
Structure of nucleic acids II Biochemistry 302. Bob Kelm January 21, 2005
Structure of nucleic acids II Biochemistry 302 Bob Kelm January 21, 2005 http://biochem.uvm.edu/courses/kelm/302 User: student PW: nucleicacid Secondary structure of RNAs antiparallel A-form Fig. 4.19
Understanding DNA Structure
Understanding DNA Structure I619 Structural Bioinformatics Molecular Biology Basics + Scale total length of DNA in a human cell is about 2m DNA is compacted in length by a factor of 10000 the compaction
Nucleotides: structure and functions. Prof. Dalė Vieželienė Biochemistry department Room No
Nucleotides: structure and functions Prof. Dalė Vieželienė Biochemistry department Room No. 229 Email: daleveze@med.kmu.lt Composition of Nucleic Acids Nucleotide structure Two types of nucleic acids:
Dina Al-Tamimi. Faisal Nimri. Ma amoun Ahram. 1 P a g e
1 Dina Al-Tamimi Faisal Nimri Ma amoun Ahram 1 P a g e **Difference between Molecular Biology and Genetics: Molecular Biology: is a fancy term of biochemistry. It is the science that deals with DNA, RNA
Nucleic acids. How DNA works. DNA RNA Protein. DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology
Nucleic acid chemistry and basic molecular theory Nucleic acids DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology Cell cycle DNA RNA Protein Transcription Translation
(Due Sept 9 th ) Problem Set 2
Problem Set 2 (Due Sept 9 th ) 1. Consider these two polynucleotides: AAGCGT GCACTG a. Draw each molecule in the 2 deoxy form (DNA). SEE BELOW b. What is the sequence of the complementary strand? Write
Molecular biology (1)
Molecular biology (1) Color index: Doctors slides Notes and explanations Extra information highlights Objectives Know the central dogma of molecular biology. Understand the composition, types and structure
Nucleic Acid Structure. Nucleic Acid Sequence Abbreviations. Sequence Abbreviations, con t.
BC 4054 Spring 2001 Chapter 11 & 12 Review Lecture otes Slide 1 ucleic Acid Structure Linear polymer of nucleotides Phosphodiester linkage between 3 and 5 positions See Figure 11.17 Slide 2 ucleic Acid
10BT43 Structural Biology
10BT43 Structural Biology Unit III Structure of Nucleic Acids 1. General characteristics of nucleic acid structures (A, T, G, C, U), Base-pairing 2. Base pairing types, glycosidic bond, Ribose puckering,
BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 10 Nucleic Acids
BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 10 Nucleic Acids 2 3 DNA vs RNA DNA RNA deoxyribose ribose A, C, G, T A, C, G, U 10 3 10 8 nucleotides 10 2 10 4 nucleotides nucleus cytoplasm double-stranded
CHAPTER 4, Part 1: LECTURE TOPICS: DNA and RNA - MOLECULES OF HEREDITY
Chapter 4 Notes: Part 1 Biochemistry 461 Fall 2010 CHAPTER 4, Part 1: LECTURE TOPICS: DNA and RNA - MOLECULES OF HEREDITY 1) DNA/RNA structures, nomenclature, shorthand conventions 2) DNA and RNA as genetic
MOLECULAR STRUCTURE OF DNA
MOLECULAR STRUCTURE OF DNA Characteristics of the Genetic Material 1. Replication Reproduced and transmitted faithfully from cell to cell (generation to generation) 2. Information Storage Biologically
Nucleic Acids. Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology 1
Nucleic Acids Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology 1 Topics : 2 hrs - Nucleic acid ----------------------------- Nucleic acid structure
Molecular Biology (1)
Molecular Biology (1) DNA structure and basic applications Mamoun Ahram, PhD Second semester, 2017-2018 Resources This lecture Cooper, pp. 49-52, 118-119, 130 What is molecular biology? Central dogma
CHAPTER 8 Nucleotides and Nucleic Acids
CHAPTER 8 Nucleotides and Nucleic Acids Key topics Biological function of nucleotides and nucleic acids Structures of common nucleotides Structure of double-stranded DNA Structures of ribonucleic acids
DNA & DNA : Protein Interactions BIBC 100
DNA & DNA : Protein Interactions BIBC 100 Sequence = Information Alphabet = language L,I,F,E LIFE DNA = DNA code A, T, C, G CAC=Histidine CAG=Glutamine GGG=Glycine Protein = Protein code 20 a.a. LIVE EVIL
Molecular biology (1)
2018/9/24 Molecular biology (1) Important. 436 Notes Original slides. 438 notes Extra information Objectives: Know the central dogma of molecular biology. Understand the composition, types and structure
Syllabus for GUTS Lecture on DNA and Nucleotides
Syllabus for GUTS Lecture on DNA and Nucleotides I. Introduction. DNA is the instruction manual for how to build a living organism here on earth. The instructions in DNA are propagated to future generations
Fundamentals of Organic Chemistry. CHAPTER 10: Nucleic Acids
Fundamentals of Organic Chemistry CHEM 109 For Students of Health Colleges Credit hrs.: (2+1) King Saud University College of Science, Chemistry Department CHEM 109 CHAPTER 10: Nucleic Acids 2 o Nucleic
Drug DNA interaction. Modeling DNA ligand interaction of intercalating ligands
Drug DNA interaction DNA as carrier of genetic information is a major target for drug interaction because of the ability to interfere with transcription (gene expression and protein synthesis) and DNA
BIOCHEM SHEET (8) Made by: rahmeh Alsukkar corrected by: date : 11-10
BIOCHEM SHEET (8) Made by: rahmeh Alsukkar corrected by: date : 11-10 1 Note: Thursday it is a revision lecture slide 3 ( 5:11 min ) *nucleic acid is a monomer of DNA *nucleotide composed of :1-nitroenous
Road to the Double Helix
Road to the Double Helix Watson and Crick Missing layer means alternating pattern (major & minor groove) Hydrogen bonding A pairs with T G pairs with C Double helix fits the data! Franklin and Wilkins
BASIC MOLECULAR GENETIC MECHANISMS Introduction:
BASIC MOLECULAR GENETIC MECHANISMS Introduction: nucleic acids. (1) contain the information for determining the amino acid sequence & the structure and function of proteins (1) part of the cellular structures:
M1 - Biochemistry. Nucleic Acid Structure II/Transcription I
M1 - Biochemistry Nucleic Acid Structure II/Transcription I PH Ratz, PhD (Resources: Lehninger et al., 5th ed., Chapters 8, 24 & 26) 1 Nucleic Acid Structure II/Transcription I Learning Objectives: 1.
MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription. Gene Organization. Genome. Objectives: Gene Organization
Overview & Recap of Molecular Biology before the last two sections MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription Gene Organization Joy Winuthayanon, PhD School of Molecular Biosciences
RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds.
The Versatility of RNA Primary structure of RNA RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds. Each nucleotide subunit is composed of a ribose sugar,
Nucleic Acid Triplexes and Quadruplexes
part of interactions of RNAs and proteins Computational EvoDevo University Leipzig June 23, 2014 Nucleic acid triple helices (triplexes) oligonucleotide complexes made of three strands a DNA duplex and
}Nucleosides NUCLEIC ACIDS. Nucleic acids are polymers Monomer---nucleotides Nitrogenous bases Purines Pyrimidines Sugar Ribose Deoxyribose
DNA STRUCTURE NUCLEIC ACIDS Nucleic acids are polymers Monomer---nucleotides Nitrogenous bases Purines Pyrimidines Sugar Ribose Deoxyribose Phosphates +nucleoside=nucleotide }Nucleosides The Sugars The
Molecular Biology (1)
Molecular Biology (1) DNA structure and basic applications Mamoun Ahram, PhD Second semester, 2018-2019 Resources This lecture Cooper, pp. 49-52, 118-119, 130 Nucleic acids 2 types: Deoxyribonucleic acid
Gene Expression - Transcription
DNA Gene Expression - Transcription Genes are expressed as encoded proteins in a 2 step process: transcription + translation Central dogma of biology: DNA RNA protein Transcription: copy DNA strand making
Chapter 9: DNA: The Molecule of Heredity
Chapter 9: DNA: The Molecule of Heredity What is DNA? Answer: Molecule that carries the blueprint of life General Features: DNA is packages in chromosomes (DNA + Proteins) Gene = Functional segment of
Biochemistry 674 Your Name: Nucleic Acids Prof. Jason Kahn Exam I October 11, Secondary Structure and Thermodynamics (25 pts):
Biochemistry 674 Nucleic Acids Your Name: Prof. Jason Kahn Exam I October 11, 2001 You have 80 minutes for this exam. Exams written in pencil or erasable ink will not be re-graded under any circumstances.
Lecture 16 Nucleic acid polymers
Lecture 16 Nucleic acid polymers Key learning goals: Understand 1 and 2 structure of DNA and RNA chains, and how 3 structures arise Understand why DNA is a good genetic storage medium but RNA is much more
Lecture 8. Chromosome. The Nuclei. Two Types of Nucleic Acids. Genes. Information Contained Within Each Cell
Information Contained Within Each Cell Lecture 8 Nucleic Acids and Protein Synthesis Chapter 23: Section 1-5 Most higher organisms reproduce sexually! Sperm cell + Egg cell! Fertilized egg The wondrous
Nucleotides and nucleic acid
Nucleotides and nucleic acid This is the last lecture for this week I wish you a blessed Eid and remarkable marks in the mid exam ;) this lecture is talking about nucleic acids and nucleotides. Dr.Ma'mon
By the end of today, you will have an answer to: How can 1 strand of DNA serve as a template for replication?
Name: Period: Date: KIPP NYC College Prep Genetics and Biotech UNIT 9: Introduction to DNA Lecture 4: DNA Modeling and Intro to Replication By the end of today, you will have an answer to: How can 1 strand
Chapter 11 Structure of Nucleic Acids
Reginald H. Garrett Charles M. Grisham Chapter 11 Structure of Nucleic Acids 11.1 How Do Scientists Determine the Primary Structure of Nucleic Acids? Two simple tools have made nucleic acid sequencing
Introduction to Bioinformatics. Lecture 20: Sequencing genomes
Introduction to Bioinformatics Lecture 20: Sequencing genomes Nucleic Acid Basics Nucleic Acids Are Polymers Each Monomer Consists of Three Moieties: Nucleotide A Base + A Ribose Sugar + A Phosphate Nucleoside
BIOLOGICAL SCIENCE. Lecture Presentation by Cindy S. Malone, PhD, California State University Northridge. FIFTH EDITION Freeman Quillin Allison
BIOLOGICAL SCIENCE FIFTH EDITION Freeman Quillin Allison 4 Lecture Presentation by Cindy S. Malone, PhD, California State University Northridge In this chapter you will learn that Nucleic acids store the
Structure of DNA [pln39]
![Structure of DNA [pln39]](/thumbs/77/76253099.jpg "Structure of DNA [pln39]")
Structure of DNA [pln39] Deoxyribonucleic acid (DNA) consists of two biopolymer strands cross-linked into a double helix. Each strand is a polynucleotide. Composition of nucleotide: nucleobase: guanine
translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors
We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 4,000 116,000 120M Open access books available International authors and editors Downloads Our
38. Inter-basepair Hydrogen Bonds in DNA
190 Proc. Japan Acad., 70, Ser. B (1994) [Vol. 70(B), 38. Inter-basepair Hydrogen Bonds in DNA By Masashi SUZUKI*),t) and Naoto YAGI**) (Communicated by Setsuro EBASHI, M. J. A., Dec. 12, 1994) Abstract:
Nucleic Acids. Information specifying protein structure
Nucleic Acids Nucleic acids represent the fourth major class of biomolecules (other major classes of biomolecules are proteins, carbohydrates, fats) Genome - the genetic information of an organism Information
Nucleic Acids and the RNA World. Pages Chapter 4
Nucleic Acids and the RNA World Pages 74-89 Chapter 4 RNA vs. Protein Chemical Evolution stated that life evolved from a polymer called a protein. HOWEVER, now many scientists question this. There is currently
What Are the Chemical Structures and Functions of Nucleic Acids?
THE NUCLEIC ACIDS What Are the Chemical Structures and Functions of Nucleic Acids? Nucleic acids are polymers specialized for the storage, transmission, and use of genetic information. DNA = deoxyribonucleic
Paper 4: Biomolecules and Their Interactions Module 12: Bases, Sugars, Nucleosides and Nucleotides Introduction Nucleic acids are involved in storage
Paper 4: Biomolecules and Their Interactions Module 12: Bases, Sugars, Nucleosides and Nucleotides Introduction Nucleic acids are involved in storage and transfer of genetic information. The double helical
Review of ORGANIC CHEMISTRY
Nucleic Acids: DNA Review of ORGANIC CHEMISTRY Definition: Contains CARBON (C) and Hydrogen (H) Large polymers can be made of smaller individual monomers. Ex: For carbohydrates, polysaccharides are large
Concept 5.5: Nucleic acids store and transmit hereditary information
Concept 5.5: Nucleic acids store and transmit hereditary information The amino acid sequence of a polypeptide is programmed by a unit of inheritance called a gene Genes are made of DNA, a nucleic acid
UNIT 24: Nucleic Acids Essential Idea(s): The structure of DNA allows efficient storage of genetic information.
UNIT 24: Nucleic Acids Name: Essential Idea(s): The structure of DNA allows efficient storage of genetic information. IB Assessment Statements 2.6.U1 The nucleic acids DNA and RNA are polymers of nucleotides.
A nucleotide consists of: an inorganic phosphate group (attached to carbon 5 of the sugar) a 5C sugar (pentose) a Nitrogenous (N containing) base
Nucleic Acids! Nucleic acids are found in all living cells and viruses and the two main types are DNA and RNA. They are macromolecules made of chains of nucleotides bonded together. They carry genetic
Information specifying protein structure. Chapter 19 Nucleic Acids Nucleotides Are the Building Blocks of Nucleic Acids
Chapter 19 Nucleic Acids Information specifying protein structure Nucleic acids represent the fourth major class of biomolecules (other major classes of biomolecules are proteins, carbohydrates, fats)
DNA Structure, Function, and Engineering Page /14/2018 Dr. Amjid Iqbal 1
DNA Structure, Function, and Engineering Page 40-51 2/14/2018 Dr. Amjid Iqbal 1 Background Organisms exhibit striking similarity at the molecular level. The structures and metabolic activities of all cells
Chapter 5: Introduction to the Nucleic Acids
Chapter 5: Introduction to the Nucleic Acids DNA, RNA, and the Flow of Genetic Information DNA and RNA are long gpolymers Carry information that is passed on to the next generation Genetic information
Division Ave. High School Ms. Foglia AP Biology. Nucleic acids. AP Biology Nucleic Acids. Information storage
Nucleic acids 2006-2007 Nucleic Acids Information storage 2006-2007 1 DNA Nucleic Acids Function: u genetic material stores information w genes w blueprint for building proteins n DNA RNA proteins transfers
Super Models. Nucleotides Molecular Model Kit Copyright 2015 Ryler Enterprises, Inc. Recommended for ages 10 - adult
Super Models! ucleotides Molecular Model Kit Copyright 015 Ryler Enterprises, Inc. Recommended for ages 10 - adult Caution: Atom centers and vinyl tubing are a choking hazard. Do not eat or chew model
Chapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix
Chapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix Deoxyribonucleic acid ) (DNA) is a nucleic acid that contains the genetic instructions used in the development and functioning
Structure. Structural Components of Nucleotides Base. Sugar. Introduction Nucleotide to Cells & Microscopy and Nucleic Acid. Phosphate Glycosidic bond
11 Structural Components of Nucleotides Base Sugar Introduction Nucleotide to Cells & Microscopy and Nucleic Acid Structure Phosphate Glycosidic bond H NUCLEOTIDE H Nucleic acid polymer of nucleotides
Appendix A DNA and PCR in detail DNA: A Detailed Look
Appendix A DNA and PCR in detail DNA: A Detailed Look A DNA molecule is a long polymer consisting of four different components called nucleotides. It is the various combinations of these four bases or
Lecture #17 10/12/01 Dr. Wormington
Lecture #17 10/12/01 Dr. Wormington DNA = Genetic Material & Mechanism of Replication Series of "Classical" Studies in Molecular Biology Avery, MacLeod & McCarty 1944 Griffith's "Transforming Principle"
Structure and Function of Nucleic Acids
Structure and Function of Nucleic Acids E T Nyahangare Class Assignment 1. Write notes and outline the role of the following in protein biosynthesis a. DNA replication b. Transcription c. Genetic code
Nucleic acids AP Biology
Nucleic acids 2006-2007 Nucleic Acids Information storage 2006-2007 Nucleic Acids Function: u genetic material DNA stores information w genes w blueprint for building proteins n DNA RNA proteins transfers
Molecular biology WID Masters of Science in Tropical and Infectious Diseases-Transcription Lecture Series RNA I. Introduction and Background:
Molecular biology WID 602 - Masters of Science in Tropical and Infectious Diseases-Transcription Lecture Series RNA I. Introduction and Background: DNA and RNA each consists of only four different nucleotides.
DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
The nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).
Nucleic acids are macromolecules composed of chains of mononucleotides joined by phosphodiester bonds. The nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). Nucleic acids are universal
How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information
DNA: CH 13 How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information Discovering DNA s Function 1928: Frederick Griffith studied
Nucleic Acids: How Structure Conveys Information 1. What Is the Structure of DNA? 2. What Are the Levels of Structure in Nucleic Acids? 3.
Fig. 9-CO, p.215 Nucleic Acids: How Structure Conveys Information 1. What Is the Structure of DNA? 2. What Are the Levels of Structure in Nucleic Acids? 3. What Is the Covalent Structure of Polynucleotides?
RNA Expression of the information in a gene generally involves production of an RNA molecule transcribed from a DNA template. RNA differs from DNA
RNA Expression of the information in a gene generally involves production of an RNA molecule transcribed from a DNA template. RNA differs from DNA that it has a hydroxyl group at the 2 position of the
Fundamentals of Organic Chemistry. CHAPTER 10: Nucleic Acids
Fundamentals of Organic Chemistry CHEM 109 For Students of Health Colleges Credit hrs.: (2+1) King Saud University College of Science, Chemistry Department CHEM 109 CHAPTER 10: Nucleic Acids 2 o Nucleic
DNA Replication I Biochemistry 302. Bob Kelm January 24, 2005
DNA Replication I Biochemistry 302 Bob Kelm January 24, 2005 Watson Crick prediction: Each stand of parent DNA serves as a template for synthesis of a new complementary daughter strand Fig. 4.12 Proof
Feedback D. Incorrect! No, although this is a correct characteristic of RNA, this is not the best response to the questions.
Biochemistry - Problem Drill 23: RNA No. 1 of 10 1. Which of the following statements best describes the structural highlights of RNA? (A) RNA can be single or double stranded. (B) G-C pairs have 3 hydrogen
Fundamentals of Biochemistry
Donald Voet Judith G. Voet Charlotte W. Pratt Fundamentals of Biochemistry Second Edition Chapter 6: Proteins: Three-Dimensional Structure Copyright 2006 by John Wiley & Sons, Inc. 1958, John Kendrew Any
Multiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
The Double Helix. DNA and RNA, part 2. Part A. Hint 1. The difference between purines and pyrimidines. Hint 2. Distinguish purines from pyrimidines
DNA and RNA, part 2 Due: 3:00pm on Wednesday, September 24, 2014 You will receive no credit for items you complete after the assignment is due. Grading Policy The Double Helix DNA, or deoxyribonucleic
Roadmap. The Cell. Introduction to Molecular Biology. DNA RNA Protein Central dogma Genetic code Gene structure Human Genome
Introduction to Molecular Biology Lodish et al Ch1-4 http://www.ncbi.nlm.nih.gov/books EECS 458 CWRU Fall 2004 DNA RNA Protein Central dogma Genetic code Gene structure Human Genome Roadmap The Cell Lodish
DNA, Replication and RNA
DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is
Structure Factor Calculations of Various DNA Duplexes
Structure Factor Calculations of Various DNA Duplexes MANJU BANSAL AND GOUTAM GUPTA Molecular Biophysics Unit, ndian nstitute of Science, Bangalore 56001 2, ndia Abstract Based upon a stereochemical guideline,
RNA does not adopt the classic B-DNA helix conformation when it forms a self-complementary double helix
Reason: RNA has ribose sugar ring, with a hydroxyl group (OH) If RNA in B-from conformation there would be unfavorable steric contact between the hydroxyl group, base, and phosphate backbone. RNA structure
Chapter 16 DNA: The Genetic Material. The Nature of Genetic Material. Chemical Nature of Nucleic Acids. Chromosomes - DNA and protein
Chapter 16 DNA: The Genetic Material The Nature of Genetic Material Chromosomes - DNA and protein Genes are subunits DNA = 4 similar nucleotides C(ytosine) A(denine) T(hymine) G(uanine) Proteins = 20 different
DNA STRUCTURE & REPLICATION
DNA STRUCTURE & REPLICATION A MODEL OF DNA In 1953, two scientists named Watson & Crick built a model of DNA that demonstrates its exact structure and function. They called this model a double helix, which
Hydrogen bonding in yeast phenylalanine transfer RNA (electron density map/base stacking/base pairing/ion interactions)
Proc. Nat. Acad. Sci. USA Vol. 72, No. 12, pp. 4866-4870, December 1975 Biochemistry Hydrogen bonding in yeast phenylalanine transfer RNA (electron density map/base stacking/base pairing/ion interactions)
DNA Replication AP Biology
DNA Replication 2007-2008 Double helix structure of DNA It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material.