Lecture #18 10/17/01 Dr. Wormington
|
|
- Phillip Bruce
- 6 years ago
- Views:
Transcription
1 Lecture #18 10/17/01 Dr. Wormington DNA Replication The Story So Far Semiconservative Hydrolysis of 5' dntp 3' HO N 4 pn 3 pn 2 pn 1 p5'... + PP i 2P i Provides Energy for Phosphodiester Bond Formation Occurs Only 5' 3' Initiates at Discrete Origins Bidirectional Requires a Template and a Primer (usually RNA) So where are we? Everything You Need to Know About Life At The Replication Fork Hint The Players Names Tell You What They Do! Leading Strand Synthesis Proceeds in Same Direction As Replication Fork DNA Helicase unwinds the 2 strands RNA Primase makes primer Single-stranded DNA binding proteins hold the 2 strands apart Lagging Strand Synthesis Proceeds in Opposite Direction As Replication Fork Synthesized in Short pieces termed Okazaki Fragments
2 Continuing the Story DNA Synthesis is Semi-Discontinuous Lagging strand is synthesized as a series of short, discontinuous Okazaki fragments which are subsequently Ligated together into a single continuous strand. Its synthesis lags behind the leading strand as more steps are required Leading strand is synthesized as a single continuous strand Remember! DNA Replication is Bidirectional So Are Reversed for the Replication Fork Going this a way The Leading & Lagging Strands For the Replication Fork Going this a way Lagging Leading Leading Lagging
3 The End of the Story DNA Polymerase I removes RNA primers & replaces them with DNA DNA Ligase links Okazaki Fragments into a single continuous strand The 3 Major DNA Repair Mechanisms in Cells Replication Errors Occur Only 10-4 base pairs Repair Activities Reduce Overall Errors to 10-9 base pairs Removes incorrectly inserted nucleotides during replication Removes incorrectly inserted nucleotides after replication e.g., Recognizes an AC base pair - removes the C & replaces it with T or vice versa Note - The repair system does know if it's the A or the C which should be removed - don't ask Recognizes damaged DNA, e.g., UV photocrosslinked bases
4 DNA Replication The Take Home Semiconservative Hydrolysis of 5' dntp 3' HO N 4 pn 3 pn 2 pn 1 p5'... + PP i 2P i Provides Energy for Phosphodiester Bond Formation Occurs Only 5' 3' Initiates at Discrete Origins Bidirectional Requires a Template and a Primer (usually RNA) Semi-Discontinuous Leading Strand is Continuous Lagging Strand is Discontinuous Okazaki Fragments 3 DNA Repair Mechanisms Proofreading During DNA Replication Mismatch Repair (Post-Replication) Excision Repair (Post-Replication) G2 DNA Damage Checkpoint What's a Gene? Beadle & Tatum 1 Gene = 1 Enzyme (& Usually 1 Polypeptide) Mutant in C Mutant in B Mutant in A Prototroph = wild-type for synthesis of a given product e.g., amino acid Auxotroph = mutant which cannot synthesize a given product Therefore, the missing product must be provided in nutrient media or cells fail to grow
5 The Central Dogma or Information Storage & Transfer in Biological Systems Information Transfer from Nucleic Acids to Protein is Unidirectional Replication Transcription Translation Replication e.g., Picornaviruses Hepatitis C, Polio Transcription Reverse-Transcription e.g., Retroviruses, HIV Translation Gene Expression The Big Picture In prokaryotes, transcription and translation Both occur in the same compartment In eukaryotes transcription occurs in the nucleus but translation occurs in the cytoplasm mrnas must be exported For a given gene Only 1 strand is read Which one? Where to Start? Where to Stop? What is the "code" to "translate" the bases in mrna into amino acids Where to Start? Where to Stop?
6 The Big Picture cont'd 3 Essential Roles for RNA in Translation Catalyst = ribosomal RNA Adaptor = transfer RNA Template = messenger RNA Transcription Initiation & Elongation The Big Picture Transcription Occurs only 5' 3' Initiation Occurs at a Promoter Hydrolysis of 5'rNTP 3' OH N 4 pn 3 pn 2 pn 1 p5'...+ PP i Provides Energy for Phosphodiester Bond Formation in RNA Unlike DNA synthesis, PP i is not hydrolyzed to 2 P i
7 Transcription Elongation & Termination The Big Picture Transcription stops at a Terminator Termination Releases the mrna Unlike DNA polymerase, RNA polymerase does not proofread Error rate is extremely low Breaking the Genetic Code Nirenberg & Matthaei, 1961 Synthetic mrna Templates Protein Product Cell-free Translation reaction Why a triplet code? Consider 4 bases (A,C,G,U); 20 amino acids 1 base = 4 codons (4 1 ) Not enough 2 bases = 16 codons (4 2 ) Still not enough 3 bases = 64 codons (4 4 ) More than enough! Why have 44 "extra" codons?
8 The Genetic Code Is Almost Universal, Degenerate (Redundant) & Has 1 Start (AUG) and 3 Stops (UAA, UAG, UGA) A sequence of codons starting with an AUG and terminating with UAA or UAG or UGA defines an Open Reading Frame Consider the following hypothetical mrna Sequence: 5' AGAGGCCCUGUGCAUCUAUGCCGUUGCGAUA 3' Could be translated each of 3 ways: AGA GGC CCU GUG CAU CUA AUG GCC GUU UGA AUA GAG GCC CUG UGC AUC UAA UGG CCG UUU GAA UA AGG CCC UGU GCA UCU AAU GGC CGU UUG AAU Note: Translation Only Proceeds 5' 3' AGAGGCCCUGUGCAUCUAAUG GCC GUU UGA AUA The actual reading frame starts and stops This would generate a tripeptide methionine-alanine-valine = met-ala-val = MAV
1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
More informationDNA Replication and Repair
DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands
More informationHuman Gene,cs 06: Gene Expression. Diversity of cell types. How do cells become different? 9/19/11. neuron
Human Gene,cs 06: Gene Expression 20110920 Diversity of cell types neuron How do cells become different? A. Each type of cell has different DNA in its nucleus B. Each cell has different genes C. Each type
More informationName Date Class. The Central Dogma of Biology
Concept Mapping The Central Dogma of Biology Complete the events chain showing the events that occur as DNA codes for RNA, which guides the synthesis of proteins, the central dogma of biology. These terms
More informationProtein Synthesis: Transcription and Translation
Review Protein Synthesis: Transcription and Translation Central Dogma of Molecular Biology Protein synthesis requires two steps: transcription and translation. DNA contains codes Three bases in DNA code
More informationUNIT I RNA AND TYPES R.KAVITHA,M.PHARM LECTURER DEPARTMENT OF PHARMACEUTICS SRM COLLEGE OF PHARMACY KATTANKULATUR
UNIT I RNA AND TYPES R.KAVITHA,M.PHARM LECTURER DEPARTMENT OF PHARMACEUTICS SRM COLLEGE OF PHARMACY KATTANKULATUR RNA, as previously mentioned, is an acronym for ribonucleic acid. There are many forms
More informationDNA Model Stations. For the following activity, you will use the following DNA sequence.
Name: DNA Model Stations DNA Replication In this lesson, you will learn how a copy of DNA is replicated for each cell. You will model a 2D representation of DNA replication using the foam nucleotide pieces.
More informationJust one nucleotide! Exploring the effects of random single nucleotide mutations
Dr. Beatriz Gonzalez In-Class Worksheet Name: Learning Objectives: Just one nucleotide! Exploring the effects of random single nucleotide mutations Given a coding DNA sequence, determine the mrna Based
More informationBiomolecules: lecture 6
Biomolecules: lecture 6 - to learn the basics on how DNA serves to make RNA = transcription - to learn how the genetic code instructs protein synthesis - to learn the basics on how proteins are synthesized
More informationANCIENT BACTERIA? 250 million years later, scientists revive life forms
ANCIENT BACTERIA? 250 million years later, scientists revive life forms Thursday, October 19, 2000 U.S. researchers say they have revived bacteria that have been dormant for more then 250 million years,
More informationDegenerate Code. Translation. trna. The Code is Degenerate trna / Proofreading Ribosomes Translation Mechanism
Translation The Code is Degenerate trna / Proofreading Ribosomes Translation Mechanism Degenerate Code There are 64 possible codon triplets There are 20 naturally-encoding amino acids Several codons specify
More informationDeoxyribonucleic Acid DNA. Structure of DNA. Structure of DNA. Nucleotide. Nucleotides 5/13/2013
Deoxyribonucleic Acid DNA The Secret of Life DNA is the molecule responsible for controlling the activities of the cell It is the hereditary molecule DNA directs the production of protein In 1953, Watson
More informationNUCLEIC ACIDS AND PROTEIN SYNTHESIS
NUCLEIC ACIDS AND PROTEIN SYNTHESIS DNA Cell Nucleus Chromosomes is a coiled double helix carrying hereditary information of the cell Contains the instructions for making from 20 different amino acids
More informationPRINCIPLES OF BIOINFORMATICS
PRINCIPLES OF BIOINFORMATICS BIO540/STA569/CSI660, Fall 2010 Lecture 3 (Sep-13-2010) Primer on Molecular Biology/Genomics Igor Kuznetsov Department of Epidemiology & Biostatistics Cancer Research Center
More informationProtein Synthesis. Application Based Questions
Protein Synthesis Application Based Questions MRNA Triplet Codons Note: Logic behind the single letter abbreviations can be found at: http://www.biology.arizona.edu/biochemistry/problem_sets/aa/dayhoff.html
More informationCONVERGENT EVOLUTION. Def n acquisition of some biological trait but different lineages
CONVERGENT EVOLUTION Def n acquisition of some biological trait but different lineages Living Rock cactus Baseball plant THE QUESTION From common ancestor or independent acquisition? By Lineage By Convergence
More informationBiomolecules: lecture 6
Biomolecules: lecture 6 - to learn the basics on how DNA serves to make RNA = transcription - to learn how the genetic code instructs protein synthesis - to learn the basics on how proteins are synthesized
More informationGene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
More informationDNA is the MASTER PLAN. RNA is the BLUEPRINT of the Master Plan
Sec. 12-3 RNA and Protein Synthesis Roles of DNA and RNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 1 RNA uses the information from DNA to make proteins Differs from DNA: 1. Ribose
More informationiclicker Question #28B - after lecture Shown below is a diagram of a typical eukaryotic gene which encodes a protein: start codon stop codon 2 3
Bio 111 Handout for Molecular Biology 4 This handout contains: Today s iclicker Questions Information on Exam 3 Solutions Fall 2008 Exam 3 iclicker Question #28A - before lecture Which of the following
More informationChapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc.
Chapter 8 Microbial Genetics Lectures prepared by Christine L. Case Structure and Function of Genetic Material Learning Objectives 8-1 Define genetics, genome, chromosome, gene, genetic code, genotype,
More informationDNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks.
DNA REPLICATION 5 4 Phosphate 3 DNA structure Nitrogenous base 1 Deoxyribose 2 Nucleotide DNA strand = DNA polynucleotide 2004 Biology Olympiad Preparation Program 2 2004 Biology Olympiad Preparation Program
More informationHonors packet Instructions
Honors packet Instructions The following are guidelines in order for you to receive FULL credit for this bio packet: 1. Read and take notes on the packet in full 2. Answer the multiple choice questions
More information(a) Which enzyme(s) make 5' - 3' phosphodiester bonds? (c) Which enzyme(s) make single-strand breaks in DNA backbones?
EXAMPLE QUESTIONS AND ANSWERS 1. Topoisomerase does which one of the following? (a) Makes new DNA strands. (b) Unties knots in DNA molecules. (c) Joins the ends of double-stranded DNA molecules. (d) Is
More informationالحمد هلل رب العالميه الذي هداوا لهذا وما كىا لىهتدي لىال أن هداوا اهلل والصالة والسالم على أشزف األوبياء. 222Cell Biolgy 1
الحمد هلل رب العالميه الذي هداوا لهذا وما كىا لىهتدي لىال أن هداوا اهلل والصالة والسالم على أشزف األوبياء 222Cell Biolgy 1 Lecture 14 222Cell Biolgy 2 DNA replication DNA replication is a semi-conservative
More informationChapter 17. From Gene to Protein. AP Biology
Chapter 17. From Gene to Protein Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)
More informationFrom Genes to Protein
From Genes to Protein Transcription and Translation Metabolism Teaches Us About Genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from
More informationThe combination of a phosphate, sugar and a base forms a compound called a nucleotide.
History Rosalin Franklin: Female scientist (x-ray crystallographer) who took the picture of DNA James Watson and Francis Crick: Solved the structure of DNA from information obtained by other scientist.
More informationDNA, RNA, and PROTEIN SYNTHESIS
DNA, RNA, and PROTEIN SYNTHESIS 1 DNA DNA contains genes, sequences of nucleotide bases The genes code for polypeptides (proteins) Proteins are used to build cells and do much of the work inside cells
More informationDNA Replication and Repair
DN Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif DN Replication genetic information is passed on to the next generation semi-conservative Parent molecule with
More informationReplication, Transcription, and Translation
Replication, Transcription, and Translation Information Flow from DNA to Protein The Central Dogma of Molecular Biology Replication is the copying of DNA in the course of cell division. Transcription is
More informationFrom Genes to Protein
From Genes to Protein Transcription and Translation Metabolism Teaches Us About Genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationBioinformatics CSM17 Week 6: DNA, RNA and Proteins
Bioinformatics CSM17 Week 6: DNA, RNA and Proteins Transcription (reading the DNA template) Translation (RNA -> protein) Protein Structure Transcription - reading the data enzyme - transcriptase gene opens
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationDNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
More informationNUCLEIC ACID METABOLISM. Omidiwura, B.R.O
NUCLEIC ACID METABOLISM Omidiwura, B.R.O Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid
More information3. The following sequence is destined to be translated into a protein: However, a mutation occurs that results in the molecule being altered to:
1. Please identify the molecule below: 5 -ACTCGATTACGATACGA-3ʼ a) DNA b) mrna c) trna d) rrna e) It cannot be determined 2. If a complimentary strand of RNA were made to the molecule in question 1, what
More informationBiology 30 DNA Review: Importance of Meiosis nucleus chromosomes Genes DNA
Biology 30 DNA Review: Importance of Meiosis Every cell has a nucleus and every nucleus has chromosomes. The number of chromosomes depends on the species. o Examples: Chicken 78 Chimpanzee 48 Potato 48
More information7.016 Problem Set 3. 1 st Pedigree
7.016 Problem Set 3 Question 1 The following human pedigree shows the inheritance pattern of a specific disease within a family. Assume that the individuals marrying into the family for all generations
More informationAP Biology
Chapter 17. From Gene to Protein Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)
More informationLevel 2 Biology, 2017
91159 911590 2SUPERVISOR S Level 2 Biology, 2017 91159 Demonstrate understanding of gene expression 2.00 p.m. Wednesday 22 November 2017 Credits: Four Achievement Achievement with Merit Achievement with
More information6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA
6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA DNA mrna Protein DNA is found in the nucleus, but making a protein occurs at the ribosome
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationDNA. Griffith s Transforming Principle Experiment 11/30/2006 DNA 2
DNA Griffith s Transforming Principle Experiment 11/30/2006 DNA 2 1 Avery, McCarty, & MacLeod 1944 Extended Griffith s work 16 years later Search for the transforming factor Live rough cells + Protein
More informationFidelity of DNA polymerase
Fidelity of DNA polymerase Shape selectivity: DNA polymerase's conformational change for determination of fidelity for each nucleotide Induced fit: Structure determines function Matched nucleotide Fidelity
More informationMolecular Genetics. Before You Read. Read to Learn
12 Molecular Genetics section 3 DNA,, and Protein DNA codes for, which guides protein synthesis. What You ll Learn the different types of involved in transcription and translation the role of polymerase
More informationProtein Synthesis Honors Biology
Protein Synthesis What do we know? Metabolism is controlled by enzymes enzymes are proteins DNA contains the genetic information to build proteins. DNA is only in the nucleus. Ribosomes are not. How then
More informationHello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.
Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)
More informationCh 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
More information6.1 Transfer of Information from DNA. SBI4U Ms. Ho-Lau
6.1 Transfer of Information from DNA SBI4U Ms. Ho-Lau Link between Genes and Proteins Early 1900s, scientists suggested proteins were involved in inheritance Gregor Mendel: Certain factors were responsible
More informationDNA replication. Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes.
DNA replication Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes. Figure 10.8 http://www.hhmi.org/biointeractive/media/ DNAi_replication_schematic-lg.mov
More informationBIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 11 DNA Replication
BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 11 DNA Replication 2 3 4 5 6 7 8 9 Are You Getting It?? Which characteristics will be part of semi-conservative replication? (multiple answers) a) The
More informationRNA and Protein Synthesis
RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and
More informationDescribe the features of a gene which enable it to code for a particular protein.
1. Answers should be written in continuous prose. Credit will be given for biological accuracy, the organisation and presentation of the information and the way in which the answer is expressed. Cancer
More informationWhat happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
More informationA. Incorrect! This feature does help with it suitability as genetic material.
College Biology - Problem Drill 08: Gene Structures and Functions No. 1 of 10 1. Which of the statements below is NOT true in explaining why DNA is a suitable genetic material? #01 (A) Its double helix
More informationZoo-342 Molecular biology Lecture 2. DNA replication
Zoo-342 Molecular biology Lecture 2 DNA replication DNA replication DNA replication is the process in which one doubled-stranded DNA molecule is used to create two double-stranded molecules with identical
More informationMULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.
Ch 17 Practice Questions MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) Garrod hypothesized that "inborn errors of metabolism" such as alkaptonuria
More informationHow life. constructs itself.
How life constructs itself Life constructs itself using few simple rules of information processing. On the one hand, there is a set of rules determining how such basic chemical reactions as transcription,
More informationIt has not escaped our notice that the specific paring we have postulated immediately suggest a possible copying mechanism for the genetic material
5-carbon sugar hosphate functional group Nitrogenous base 2 types urines = 2 rings 5 & 6 member N containing ring yrimidines = 1 ring 6 member N containing ring Geometry and space requires complimentary
More informationBundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationFishy Amino Acid Codon. UUU Phe UCU Ser UAU Tyr UGU Cys. UUC Phe UCC Ser UAC Tyr UGC Cys. UUA Leu UCA Ser UAA Stop UGA Stop
Fishy Code Slips Fish 1 GGTTATAGAGGTACTACC Fish 2 GGCTTCAGAGGTACTACC Fish 3 CATAGCAGAGGTACTACC Fish 4 GGTTATTCTGTCTTATTG Fish 5 GGCTTCTCTGTCTTATTG Fish 6 CATAGCGCTGCAACTACC Fishy Amino Acid Codon UUU Phe
More informationIB BIO I Replication/Transcription/Translation Van Roekel/Madden. Name Date Period. D. It separates DNA strands. (Total 1 mark)
Name Date Period 1. What is the function of helicase? A. It forms bonds between DNA nucleotides. B. It adds new nucleotides to the DNA helix. C. It forms the DNA helix. D. It separates DNA strands. 2.
More informationCH 17 :From Gene to Protein
CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there
More informationIndependent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)
Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the
More informationFrom Gene to Protein. How Genes Work
From Gene to Protein How Genes Work 2007-2008 The Central Dogma Flow of genetic information in a cell How do we move information from DNA to proteins? DNA RNA protein replication phenotype You! Step 1:
More informationChapter 10. The Structure and Function of DNA. Lectures by Edward J. Zalisko
Chapter 10 The Structure and Function of DNA PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey,
More informationDNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base
DNA,, RNA,, AND PROTEIN SYNTHESIS DNA Deoxyribonucleic Acid Enables cells to have different forms and perform different functions Primary functions of DNA: Store and transmit genetic information that tells
More informationPROTEIN SYNTHESIS Study Guide
PART A. Read the following: PROTEIN SYNTHESIS Study Guide Protein synthesis is the process used by the body to make proteins. The first step of protein synthesis is called Transcription. It occurs in the
More informationChapter 10: Gene Expression and Regulation
Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must
More information2. From the first paragraph in this section, find three ways in which RNA differs from DNA.
Name Chapter 17: From Gene to Protein Begin reading at page 328 Basic Principles of Transcription and Translation. Work on this chapter a single concept at a time, and expect to spend at least 6 hours
More informationDNA & RNA. Chapter Twelve and Thirteen Biology One
DNA & RNA Chapter Twelve and Thirteen Biology One I. DNA Structure A. DNA monomers = nucleotides *1. sugar bonded to PO4 & one of four possible nitrogen bases 2. bases = Adenine, Guanine, Cytosine, Thymine
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationBEADLE & TATUM EXPERIMENT
FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in
More informationDelve AP Biology Lecture 7: 10/30/11 Melissa Ko and Anne Huang
Today s Agenda: I. DNA Structure II. DNA Replication III. DNA Proofreading and Repair IV. The Central Dogma V. Transcription VI. Post-transcriptional Modifications Delve AP Biology Lecture 7: 10/30/11
More informationFrom Gene to Protein. How Genes Work (Ch. 17)
From Gene to Protein How Genes Work (Ch. 17) What do genes code for? How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA DNA proteins cells bodies The Central
More informationUnit IX Problem 3 Genetics: Basic Concepts in Molecular Biology
Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated to synthesize
More informationBIO 311C Spring Lecture 34 Friday 23 Apr.
BIO 311C Spring 2010 1 Lecture 34 Friday 23 Apr. Summary of DNA Replication in Prokaryotes origin of replication initial double helix origin of replication new growing polynucleotide chains Circular molecule
More informationTranslating the Genetic Code. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences
Translating the Genetic Code DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences An overview of gene expression Figure 13.2 The Idea of A Code 20 amino acids 4 nucleotides How do nucleic acids
More informationChemistry 121 Winter 17
Chemistry 121 Winter 17 Introduction to Organic Chemistry and Biochemistry Instructor Dr. Upali Siriwardane (Ph.D. Ohio State) E-mail: upali@latech.edu Office: 311 Carson Taylor Hall ; Phone: 318-257-4941;
More informationA Zero-Knowledge Based Introduction to Biology
A Zero-Knowledge Based Introduction to Biology Konstantinos (Gus) Katsiapis 25 Sep 2009 Thanks to Cory McLean and George Asimenos Cells: Building Blocks of Life cell, membrane, cytoplasm, nucleus, mitochondrion
More informationFROM MOLECULES TO LIFE
Chapter 7 (Strickberger) FROM MOLECULES TO LIFE Organisms depended on processes that transformed materials available outside of the cell into metabolic products necessary for cellular life. These processes
More informationProtein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
More informationNucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
More informationProtein Synthesis Making Proteins
Protein Synthesis Making Proteins 2009-2010 Bodies Cells DNA Bodies are made up of cells All cells run on a set of instructions spelled out in DNA DNA Cells Bodies How does DNA code for cells & bodies?
More informationProposed Models of DNA Replication. Conservative Model. Semi-Conservative Model. Dispersive model
5.2 DNA Replication Cell Cycle Life cycle of a cell Cells can reproduce Daughter cells receive an exact copy of DNA from parent cell DNA replication happens during the S phase Proposed Models of DNA Replication
More informationNucleic Acid Structure:
Genetic Information In Microbes: The genetic material of bacteria and plasmids is DNA. Bacterial viruses (bacteriophages or phages) have DNA or RNA as genetic material. The two essential functions of genetic
More informationFrom Gene to Protein Transcription and Translation
Name: Hour: From Gene to Protein Transcription and Translation Introduction: In this activity you will learn how the genes in our DNA influence our characteristics. For example, how can a gene cause albinism
More information(deoxyribonucleic acid)
1 The Central Dogma of Molecular Biology Mark Mayo Cypress College 2 The Central Dogma of Molecular Biology 3 Importance of Proteins There are three main kinds: structural - make up most body parts hormone
More informationThe Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16
Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes
More informationFROM MOLECULES TO LIFE
Chapter 7 (Strickberger) FROM MOLECULES TO LIFE Organisms depended on processes that transformed materials available outside of the cell into metabolic products necessary for cellular life. These processes
More informationFrom DNA to Protein. Chapter 14
From DNA to Protein Chapter 14 What do genes code for? How does DNA code for cells & bodies? How are cells and bodies made from the instructions in DNA? DNA proteins cells bodies The Central Dogma Flow
More informationTala Saleh. Tamer Barakat ... Anas Abu. Humaidan
7 Tala Saleh Tamer Barakat... Anas Abu. Humaidan Some Information in this lecture may not be mentioned by the Dr. as thoroughly as this sheet. But they cannot be overlooked for a better understanding,
More informationChapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
More information7.2 Protein Synthesis. From DNA to Protein Animation
7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They
More informationIntroduction to genome biology Sandrine Dudoit and Robert Gentleman
Introduction to genome biology Sandrine Dudoit and Robert Gentleman University of California, Berkeley Outline Cells and cell division DNA structure and replication Proteins Central dogma: transcription,
More informationWelcome to Class 18! Lecture 18: Outline and Objectives. Replication is semiconservative! Replication: DNA DNA! Introductory Biochemistry!
Lecture 18: Outline and Objectives Welcome to Class 18! Introductory Biochemistry! l DNA Replication! l DNA polymerase! l the enzymatic reaction! l proofreading and accuracy! l DNA synthesis! l origins
More information