Lecture #18 10/17/01 Dr. Wormington

Size: px
Start display at page:

Download "Lecture #18 10/17/01 Dr. Wormington"

Transcription

1 Lecture #18 10/17/01 Dr. Wormington DNA Replication The Story So Far Semiconservative Hydrolysis of 5' dntp 3' HO N 4 pn 3 pn 2 pn 1 p5'... + PP i 2P i Provides Energy for Phosphodiester Bond Formation Occurs Only 5' 3' Initiates at Discrete Origins Bidirectional Requires a Template and a Primer (usually RNA) So where are we? Everything You Need to Know About Life At The Replication Fork Hint The Players Names Tell You What They Do! Leading Strand Synthesis Proceeds in Same Direction As Replication Fork DNA Helicase unwinds the 2 strands RNA Primase makes primer Single-stranded DNA binding proteins hold the 2 strands apart Lagging Strand Synthesis Proceeds in Opposite Direction As Replication Fork Synthesized in Short pieces termed Okazaki Fragments

2 Continuing the Story DNA Synthesis is Semi-Discontinuous Lagging strand is synthesized as a series of short, discontinuous Okazaki fragments which are subsequently Ligated together into a single continuous strand. Its synthesis lags behind the leading strand as more steps are required Leading strand is synthesized as a single continuous strand Remember! DNA Replication is Bidirectional So Are Reversed for the Replication Fork Going this a way The Leading & Lagging Strands For the Replication Fork Going this a way Lagging Leading Leading Lagging

3 The End of the Story DNA Polymerase I removes RNA primers & replaces them with DNA DNA Ligase links Okazaki Fragments into a single continuous strand The 3 Major DNA Repair Mechanisms in Cells Replication Errors Occur Only 10-4 base pairs Repair Activities Reduce Overall Errors to 10-9 base pairs Removes incorrectly inserted nucleotides during replication Removes incorrectly inserted nucleotides after replication e.g., Recognizes an AC base pair - removes the C & replaces it with T or vice versa Note - The repair system does know if it's the A or the C which should be removed - don't ask Recognizes damaged DNA, e.g., UV photocrosslinked bases

4 DNA Replication The Take Home Semiconservative Hydrolysis of 5' dntp 3' HO N 4 pn 3 pn 2 pn 1 p5'... + PP i 2P i Provides Energy for Phosphodiester Bond Formation Occurs Only 5' 3' Initiates at Discrete Origins Bidirectional Requires a Template and a Primer (usually RNA) Semi-Discontinuous Leading Strand is Continuous Lagging Strand is Discontinuous Okazaki Fragments 3 DNA Repair Mechanisms Proofreading During DNA Replication Mismatch Repair (Post-Replication) Excision Repair (Post-Replication) G2 DNA Damage Checkpoint What's a Gene? Beadle & Tatum 1 Gene = 1 Enzyme (& Usually 1 Polypeptide) Mutant in C Mutant in B Mutant in A Prototroph = wild-type for synthesis of a given product e.g., amino acid Auxotroph = mutant which cannot synthesize a given product Therefore, the missing product must be provided in nutrient media or cells fail to grow

5 The Central Dogma or Information Storage & Transfer in Biological Systems Information Transfer from Nucleic Acids to Protein is Unidirectional Replication Transcription Translation Replication e.g., Picornaviruses Hepatitis C, Polio Transcription Reverse-Transcription e.g., Retroviruses, HIV Translation Gene Expression The Big Picture In prokaryotes, transcription and translation Both occur in the same compartment In eukaryotes transcription occurs in the nucleus but translation occurs in the cytoplasm mrnas must be exported For a given gene Only 1 strand is read Which one? Where to Start? Where to Stop? What is the "code" to "translate" the bases in mrna into amino acids Where to Start? Where to Stop?

6 The Big Picture cont'd 3 Essential Roles for RNA in Translation Catalyst = ribosomal RNA Adaptor = transfer RNA Template = messenger RNA Transcription Initiation & Elongation The Big Picture Transcription Occurs only 5' 3' Initiation Occurs at a Promoter Hydrolysis of 5'rNTP 3' OH N 4 pn 3 pn 2 pn 1 p5'...+ PP i Provides Energy for Phosphodiester Bond Formation in RNA Unlike DNA synthesis, PP i is not hydrolyzed to 2 P i

7 Transcription Elongation & Termination The Big Picture Transcription stops at a Terminator Termination Releases the mrna Unlike DNA polymerase, RNA polymerase does not proofread Error rate is extremely low Breaking the Genetic Code Nirenberg & Matthaei, 1961 Synthetic mrna Templates Protein Product Cell-free Translation reaction Why a triplet code? Consider 4 bases (A,C,G,U); 20 amino acids 1 base = 4 codons (4 1 ) Not enough 2 bases = 16 codons (4 2 ) Still not enough 3 bases = 64 codons (4 4 ) More than enough! Why have 44 "extra" codons?

8 The Genetic Code Is Almost Universal, Degenerate (Redundant) & Has 1 Start (AUG) and 3 Stops (UAA, UAG, UGA) A sequence of codons starting with an AUG and terminating with UAA or UAG or UGA defines an Open Reading Frame Consider the following hypothetical mrna Sequence: 5' AGAGGCCCUGUGCAUCUAUGCCGUUGCGAUA 3' Could be translated each of 3 ways: AGA GGC CCU GUG CAU CUA AUG GCC GUU UGA AUA GAG GCC CUG UGC AUC UAA UGG CCG UUU GAA UA AGG CCC UGU GCA UCU AAU GGC CGU UUG AAU Note: Translation Only Proceeds 5' 3' AGAGGCCCUGUGCAUCUAAUG GCC GUU UGA AUA The actual reading frame starts and stops This would generate a tripeptide methionine-alanine-valine = met-ala-val = MAV

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation 1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous

More information

DNA Replication and Repair

DNA Replication and Repair DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands

More information

Human Gene,cs 06: Gene Expression. Diversity of cell types. How do cells become different? 9/19/11. neuron

Human Gene,cs 06: Gene Expression. Diversity of cell types. How do cells become different? 9/19/11. neuron Human Gene,cs 06: Gene Expression 20110920 Diversity of cell types neuron How do cells become different? A. Each type of cell has different DNA in its nucleus B. Each cell has different genes C. Each type

More information

Name Date Class. The Central Dogma of Biology

Name Date Class. The Central Dogma of Biology Concept Mapping The Central Dogma of Biology Complete the events chain showing the events that occur as DNA codes for RNA, which guides the synthesis of proteins, the central dogma of biology. These terms

More information

Protein Synthesis: Transcription and Translation

Protein Synthesis: Transcription and Translation Review Protein Synthesis: Transcription and Translation Central Dogma of Molecular Biology Protein synthesis requires two steps: transcription and translation. DNA contains codes Three bases in DNA code

More information

UNIT I RNA AND TYPES R.KAVITHA,M.PHARM LECTURER DEPARTMENT OF PHARMACEUTICS SRM COLLEGE OF PHARMACY KATTANKULATUR

UNIT I RNA AND TYPES R.KAVITHA,M.PHARM LECTURER DEPARTMENT OF PHARMACEUTICS SRM COLLEGE OF PHARMACY KATTANKULATUR UNIT I RNA AND TYPES R.KAVITHA,M.PHARM LECTURER DEPARTMENT OF PHARMACEUTICS SRM COLLEGE OF PHARMACY KATTANKULATUR RNA, as previously mentioned, is an acronym for ribonucleic acid. There are many forms

More information

DNA Model Stations. For the following activity, you will use the following DNA sequence.

DNA Model Stations. For the following activity, you will use the following DNA sequence. Name: DNA Model Stations DNA Replication In this lesson, you will learn how a copy of DNA is replicated for each cell. You will model a 2D representation of DNA replication using the foam nucleotide pieces.

More information

Just one nucleotide! Exploring the effects of random single nucleotide mutations

Just one nucleotide! Exploring the effects of random single nucleotide mutations Dr. Beatriz Gonzalez In-Class Worksheet Name: Learning Objectives: Just one nucleotide! Exploring the effects of random single nucleotide mutations Given a coding DNA sequence, determine the mrna Based

More information

Biomolecules: lecture 6

Biomolecules: lecture 6 Biomolecules: lecture 6 - to learn the basics on how DNA serves to make RNA = transcription - to learn how the genetic code instructs protein synthesis - to learn the basics on how proteins are synthesized

More information

ANCIENT BACTERIA? 250 million years later, scientists revive life forms

ANCIENT BACTERIA? 250 million years later, scientists revive life forms ANCIENT BACTERIA? 250 million years later, scientists revive life forms Thursday, October 19, 2000 U.S. researchers say they have revived bacteria that have been dormant for more then 250 million years,

More information

Degenerate Code. Translation. trna. The Code is Degenerate trna / Proofreading Ribosomes Translation Mechanism

Degenerate Code. Translation. trna. The Code is Degenerate trna / Proofreading Ribosomes Translation Mechanism Translation The Code is Degenerate trna / Proofreading Ribosomes Translation Mechanism Degenerate Code There are 64 possible codon triplets There are 20 naturally-encoding amino acids Several codons specify

More information

Deoxyribonucleic Acid DNA. Structure of DNA. Structure of DNA. Nucleotide. Nucleotides 5/13/2013

Deoxyribonucleic Acid DNA. Structure of DNA. Structure of DNA. Nucleotide. Nucleotides 5/13/2013 Deoxyribonucleic Acid DNA The Secret of Life DNA is the molecule responsible for controlling the activities of the cell It is the hereditary molecule DNA directs the production of protein In 1953, Watson

More information

NUCLEIC ACIDS AND PROTEIN SYNTHESIS

NUCLEIC ACIDS AND PROTEIN SYNTHESIS NUCLEIC ACIDS AND PROTEIN SYNTHESIS DNA Cell Nucleus Chromosomes is a coiled double helix carrying hereditary information of the cell Contains the instructions for making from 20 different amino acids

More information

PRINCIPLES OF BIOINFORMATICS

PRINCIPLES OF BIOINFORMATICS PRINCIPLES OF BIOINFORMATICS BIO540/STA569/CSI660, Fall 2010 Lecture 3 (Sep-13-2010) Primer on Molecular Biology/Genomics Igor Kuznetsov Department of Epidemiology & Biostatistics Cancer Research Center

More information

Protein Synthesis. Application Based Questions

Protein Synthesis. Application Based Questions Protein Synthesis Application Based Questions MRNA Triplet Codons Note: Logic behind the single letter abbreviations can be found at: http://www.biology.arizona.edu/biochemistry/problem_sets/aa/dayhoff.html

More information

CONVERGENT EVOLUTION. Def n acquisition of some biological trait but different lineages

CONVERGENT EVOLUTION. Def n acquisition of some biological trait but different lineages CONVERGENT EVOLUTION Def n acquisition of some biological trait but different lineages Living Rock cactus Baseball plant THE QUESTION From common ancestor or independent acquisition? By Lineage By Convergence

More information

Biomolecules: lecture 6

Biomolecules: lecture 6 Biomolecules: lecture 6 - to learn the basics on how DNA serves to make RNA = transcription - to learn how the genetic code instructs protein synthesis - to learn the basics on how proteins are synthesized

More information

Gene Expression Transcription/Translation Protein Synthesis

Gene Expression Transcription/Translation Protein Synthesis Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino

More information

DNA is the MASTER PLAN. RNA is the BLUEPRINT of the Master Plan

DNA is the MASTER PLAN. RNA is the BLUEPRINT of the Master Plan Sec. 12-3 RNA and Protein Synthesis Roles of DNA and RNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 1 RNA uses the information from DNA to make proteins Differs from DNA: 1. Ribose

More information

iclicker Question #28B - after lecture Shown below is a diagram of a typical eukaryotic gene which encodes a protein: start codon stop codon 2 3

iclicker Question #28B - after lecture Shown below is a diagram of a typical eukaryotic gene which encodes a protein: start codon stop codon 2 3 Bio 111 Handout for Molecular Biology 4 This handout contains: Today s iclicker Questions Information on Exam 3 Solutions Fall 2008 Exam 3 iclicker Question #28A - before lecture Which of the following

More information

Chapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc.

Chapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc. Chapter 8 Microbial Genetics Lectures prepared by Christine L. Case Structure and Function of Genetic Material Learning Objectives 8-1 Define genetics, genome, chromosome, gene, genetic code, genotype,

More information

DNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks.

DNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks. DNA REPLICATION 5 4 Phosphate 3 DNA structure Nitrogenous base 1 Deoxyribose 2 Nucleotide DNA strand = DNA polynucleotide 2004 Biology Olympiad Preparation Program 2 2004 Biology Olympiad Preparation Program

More information

Honors packet Instructions

Honors packet Instructions Honors packet Instructions The following are guidelines in order for you to receive FULL credit for this bio packet: 1. Read and take notes on the packet in full 2. Answer the multiple choice questions

More information

(a) Which enzyme(s) make 5' - 3' phosphodiester bonds? (c) Which enzyme(s) make single-strand breaks in DNA backbones?

(a) Which enzyme(s) make 5' - 3' phosphodiester bonds? (c) Which enzyme(s) make single-strand breaks in DNA backbones? EXAMPLE QUESTIONS AND ANSWERS 1. Topoisomerase does which one of the following? (a) Makes new DNA strands. (b) Unties knots in DNA molecules. (c) Joins the ends of double-stranded DNA molecules. (d) Is

More information

الحمد هلل رب العالميه الذي هداوا لهذا وما كىا لىهتدي لىال أن هداوا اهلل والصالة والسالم على أشزف األوبياء. 222Cell Biolgy 1

الحمد هلل رب العالميه الذي هداوا لهذا وما كىا لىهتدي لىال أن هداوا اهلل والصالة والسالم على أشزف األوبياء. 222Cell Biolgy 1 الحمد هلل رب العالميه الذي هداوا لهذا وما كىا لىهتدي لىال أن هداوا اهلل والصالة والسالم على أشزف األوبياء 222Cell Biolgy 1 Lecture 14 222Cell Biolgy 2 DNA replication DNA replication is a semi-conservative

More information

Chapter 17. From Gene to Protein. AP Biology

Chapter 17. From Gene to Protein. AP Biology Chapter 17. From Gene to Protein Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)

More information

From Genes to Protein

From Genes to Protein From Genes to Protein Transcription and Translation Metabolism Teaches Us About Genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from

More information

The combination of a phosphate, sugar and a base forms a compound called a nucleotide.

The combination of a phosphate, sugar and a base forms a compound called a nucleotide. History Rosalin Franklin: Female scientist (x-ray crystallographer) who took the picture of DNA James Watson and Francis Crick: Solved the structure of DNA from information obtained by other scientist.

More information

DNA, RNA, and PROTEIN SYNTHESIS

DNA, RNA, and PROTEIN SYNTHESIS DNA, RNA, and PROTEIN SYNTHESIS 1 DNA DNA contains genes, sequences of nucleotide bases The genes code for polypeptides (proteins) Proteins are used to build cells and do much of the work inside cells

More information

DNA Replication and Repair

DNA Replication and Repair DN Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif DN Replication genetic information is passed on to the next generation semi-conservative Parent molecule with

More information

Replication, Transcription, and Translation

Replication, Transcription, and Translation Replication, Transcription, and Translation Information Flow from DNA to Protein The Central Dogma of Molecular Biology Replication is the copying of DNA in the course of cell division. Transcription is

More information

From Genes to Protein

From Genes to Protein From Genes to Protein Transcription and Translation Metabolism Teaches Us About Genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from

More information

PROTEIN SYNTHESIS. copyright cmassengale

PROTEIN SYNTHESIS. copyright cmassengale PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other

More information

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made

More information

Bioinformatics CSM17 Week 6: DNA, RNA and Proteins

Bioinformatics CSM17 Week 6: DNA, RNA and Proteins Bioinformatics CSM17 Week 6: DNA, RNA and Proteins Transcription (reading the DNA template) Translation (RNA -> protein) Protein Structure Transcription - reading the data enzyme - transcriptase gene opens

More information

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These

More information

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery

More information

NUCLEIC ACID METABOLISM. Omidiwura, B.R.O

NUCLEIC ACID METABOLISM. Omidiwura, B.R.O NUCLEIC ACID METABOLISM Omidiwura, B.R.O Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid

More information

3. The following sequence is destined to be translated into a protein: However, a mutation occurs that results in the molecule being altered to:

3. The following sequence is destined to be translated into a protein: However, a mutation occurs that results in the molecule being altered to: 1. Please identify the molecule below: 5 -ACTCGATTACGATACGA-3ʼ a) DNA b) mrna c) trna d) rrna e) It cannot be determined 2. If a complimentary strand of RNA were made to the molecule in question 1, what

More information

Biology 30 DNA Review: Importance of Meiosis nucleus chromosomes Genes DNA

Biology 30 DNA Review: Importance of Meiosis nucleus chromosomes Genes DNA Biology 30 DNA Review: Importance of Meiosis Every cell has a nucleus and every nucleus has chromosomes. The number of chromosomes depends on the species. o Examples: Chicken 78 Chimpanzee 48 Potato 48

More information

7.016 Problem Set 3. 1 st Pedigree

7.016 Problem Set 3. 1 st Pedigree 7.016 Problem Set 3 Question 1 The following human pedigree shows the inheritance pattern of a specific disease within a family. Assume that the individuals marrying into the family for all generations

More information

AP Biology

AP Biology Chapter 17. From Gene to Protein Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)

More information

Level 2 Biology, 2017

Level 2 Biology, 2017 91159 911590 2SUPERVISOR S Level 2 Biology, 2017 91159 Demonstrate understanding of gene expression 2.00 p.m. Wednesday 22 November 2017 Credits: Four Achievement Achievement with Merit Achievement with

More information

6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA

6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA 6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA DNA mrna Protein DNA is found in the nucleus, but making a protein occurs at the ribosome

More information

PROTEIN SYNTHESIS. copyright cmassengale

PROTEIN SYNTHESIS. copyright cmassengale PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other

More information

DNA. Griffith s Transforming Principle Experiment 11/30/2006 DNA 2

DNA. Griffith s Transforming Principle Experiment 11/30/2006 DNA 2 DNA Griffith s Transforming Principle Experiment 11/30/2006 DNA 2 1 Avery, McCarty, & MacLeod 1944 Extended Griffith s work 16 years later Search for the transforming factor Live rough cells + Protein

More information

Fidelity of DNA polymerase

Fidelity of DNA polymerase Fidelity of DNA polymerase Shape selectivity: DNA polymerase's conformational change for determination of fidelity for each nucleotide Induced fit: Structure determines function Matched nucleotide Fidelity

More information

Molecular Genetics. Before You Read. Read to Learn

Molecular Genetics. Before You Read. Read to Learn 12 Molecular Genetics section 3 DNA,, and Protein DNA codes for, which guides protein synthesis. What You ll Learn the different types of involved in transcription and translation the role of polymerase

More information

Protein Synthesis Honors Biology

Protein Synthesis Honors Biology Protein Synthesis What do we know? Metabolism is controlled by enzymes enzymes are proteins DNA contains the genetic information to build proteins. DNA is only in the nucleus. Ribosomes are not. How then

More information

Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.

Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6. Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)

More information

Ch 10 Molecular Biology of the Gene

Ch 10 Molecular Biology of the Gene Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read

More information

6.1 Transfer of Information from DNA. SBI4U Ms. Ho-Lau

6.1 Transfer of Information from DNA. SBI4U Ms. Ho-Lau 6.1 Transfer of Information from DNA SBI4U Ms. Ho-Lau Link between Genes and Proteins Early 1900s, scientists suggested proteins were involved in inheritance Gregor Mendel: Certain factors were responsible

More information

DNA replication. Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes.

DNA replication. Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes. DNA replication Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes. Figure 10.8 http://www.hhmi.org/biointeractive/media/ DNAi_replication_schematic-lg.mov

More information

BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 11 DNA Replication

BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 11 DNA Replication BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 11 DNA Replication 2 3 4 5 6 7 8 9 Are You Getting It?? Which characteristics will be part of semi-conservative replication? (multiple answers) a) The

More information

RNA and Protein Synthesis

RNA and Protein Synthesis RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and

More information

Describe the features of a gene which enable it to code for a particular protein.

Describe the features of a gene which enable it to code for a particular protein. 1. Answers should be written in continuous prose. Credit will be given for biological accuracy, the organisation and presentation of the information and the way in which the answer is expressed. Cancer

More information

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as

More information

A. Incorrect! This feature does help with it suitability as genetic material.

A. Incorrect! This feature does help with it suitability as genetic material. College Biology - Problem Drill 08: Gene Structures and Functions No. 1 of 10 1. Which of the statements below is NOT true in explaining why DNA is a suitable genetic material? #01 (A) Its double helix

More information

Zoo-342 Molecular biology Lecture 2. DNA replication

Zoo-342 Molecular biology Lecture 2. DNA replication Zoo-342 Molecular biology Lecture 2 DNA replication DNA replication DNA replication is the process in which one doubled-stranded DNA molecule is used to create two double-stranded molecules with identical

More information

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Ch 17 Practice Questions MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) Garrod hypothesized that "inborn errors of metabolism" such as alkaptonuria

More information

How life. constructs itself.

How life. constructs itself. How life constructs itself Life constructs itself using few simple rules of information processing. On the one hand, there is a set of rules determining how such basic chemical reactions as transcription,

More information

It has not escaped our notice that the specific paring we have postulated immediately suggest a possible copying mechanism for the genetic material

It has not escaped our notice that the specific paring we have postulated immediately suggest a possible copying mechanism for the genetic material 5-carbon sugar hosphate functional group Nitrogenous base 2 types urines = 2 rings 5 & 6 member N containing ring yrimidines = 1 ring 6 member N containing ring Geometry and space requires complimentary

More information

Bundle 5 Test Review

Bundle 5 Test Review Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic

More information

Lecture for Wednesday. Dr. Prince BIOL 1408

Lecture for Wednesday. Dr. Prince BIOL 1408 Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that

More information

Fishy Amino Acid Codon. UUU Phe UCU Ser UAU Tyr UGU Cys. UUC Phe UCC Ser UAC Tyr UGC Cys. UUA Leu UCA Ser UAA Stop UGA Stop

Fishy Amino Acid Codon. UUU Phe UCU Ser UAU Tyr UGU Cys. UUC Phe UCC Ser UAC Tyr UGC Cys. UUA Leu UCA Ser UAA Stop UGA Stop Fishy Code Slips Fish 1 GGTTATAGAGGTACTACC Fish 2 GGCTTCAGAGGTACTACC Fish 3 CATAGCAGAGGTACTACC Fish 4 GGTTATTCTGTCTTATTG Fish 5 GGCTTCTCTGTCTTATTG Fish 6 CATAGCGCTGCAACTACC Fishy Amino Acid Codon UUU Phe

More information

IB BIO I Replication/Transcription/Translation Van Roekel/Madden. Name Date Period. D. It separates DNA strands. (Total 1 mark)

IB BIO I Replication/Transcription/Translation Van Roekel/Madden. Name Date Period. D. It separates DNA strands. (Total 1 mark) Name Date Period 1. What is the function of helicase? A. It forms bonds between DNA nucleotides. B. It adds new nucleotides to the DNA helix. C. It forms the DNA helix. D. It separates DNA strands. 2.

More information

CH 17 :From Gene to Protein

CH 17 :From Gene to Protein CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there

More information

Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)

Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the

More information

From Gene to Protein. How Genes Work

From Gene to Protein. How Genes Work From Gene to Protein How Genes Work 2007-2008 The Central Dogma Flow of genetic information in a cell How do we move information from DNA to proteins? DNA RNA protein replication phenotype You! Step 1:

More information

Chapter 10. The Structure and Function of DNA. Lectures by Edward J. Zalisko

Chapter 10. The Structure and Function of DNA. Lectures by Edward J. Zalisko Chapter 10 The Structure and Function of DNA PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey,

More information

DNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base

DNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base DNA,, RNA,, AND PROTEIN SYNTHESIS DNA Deoxyribonucleic Acid Enables cells to have different forms and perform different functions Primary functions of DNA: Store and transmit genetic information that tells

More information

PROTEIN SYNTHESIS Study Guide

PROTEIN SYNTHESIS Study Guide PART A. Read the following: PROTEIN SYNTHESIS Study Guide Protein synthesis is the process used by the body to make proteins. The first step of protein synthesis is called Transcription. It occurs in the

More information

Chapter 10: Gene Expression and Regulation

Chapter 10: Gene Expression and Regulation Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must

More information

2. From the first paragraph in this section, find three ways in which RNA differs from DNA.

2. From the first paragraph in this section, find three ways in which RNA differs from DNA. Name Chapter 17: From Gene to Protein Begin reading at page 328 Basic Principles of Transcription and Translation. Work on this chapter a single concept at a time, and expect to spend at least 6 hours

More information

DNA & RNA. Chapter Twelve and Thirteen Biology One

DNA & RNA. Chapter Twelve and Thirteen Biology One DNA & RNA Chapter Twelve and Thirteen Biology One I. DNA Structure A. DNA monomers = nucleotides *1. sugar bonded to PO4 & one of four possible nitrogen bases 2. bases = Adenine, Guanine, Cytosine, Thymine

More information

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information

BEADLE & TATUM EXPERIMENT

BEADLE & TATUM EXPERIMENT FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in

More information

Delve AP Biology Lecture 7: 10/30/11 Melissa Ko and Anne Huang

Delve AP Biology Lecture 7: 10/30/11 Melissa Ko and Anne Huang Today s Agenda: I. DNA Structure II. DNA Replication III. DNA Proofreading and Repair IV. The Central Dogma V. Transcription VI. Post-transcriptional Modifications Delve AP Biology Lecture 7: 10/30/11

More information

From Gene to Protein. How Genes Work (Ch. 17)

From Gene to Protein. How Genes Work (Ch. 17) From Gene to Protein How Genes Work (Ch. 17) What do genes code for? How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA DNA proteins cells bodies The Central

More information

Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology

Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated to synthesize

More information

BIO 311C Spring Lecture 34 Friday 23 Apr.

BIO 311C Spring Lecture 34 Friday 23 Apr. BIO 311C Spring 2010 1 Lecture 34 Friday 23 Apr. Summary of DNA Replication in Prokaryotes origin of replication initial double helix origin of replication new growing polynucleotide chains Circular molecule

More information

Translating the Genetic Code. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences

Translating the Genetic Code. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences Translating the Genetic Code DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences An overview of gene expression Figure 13.2 The Idea of A Code 20 amino acids 4 nucleotides How do nucleic acids

More information

Chemistry 121 Winter 17

Chemistry 121 Winter 17 Chemistry 121 Winter 17 Introduction to Organic Chemistry and Biochemistry Instructor Dr. Upali Siriwardane (Ph.D. Ohio State) E-mail: upali@latech.edu Office: 311 Carson Taylor Hall ; Phone: 318-257-4941;

More information

A Zero-Knowledge Based Introduction to Biology

A Zero-Knowledge Based Introduction to Biology A Zero-Knowledge Based Introduction to Biology Konstantinos (Gus) Katsiapis 25 Sep 2009 Thanks to Cory McLean and George Asimenos Cells: Building Blocks of Life cell, membrane, cytoplasm, nucleus, mitochondrion

More information

FROM MOLECULES TO LIFE

FROM MOLECULES TO LIFE Chapter 7 (Strickberger) FROM MOLECULES TO LIFE Organisms depended on processes that transformed materials available outside of the cell into metabolic products necessary for cellular life. These processes

More information

Protein Synthesis

Protein Synthesis HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is

More information

Nucleic acids and protein synthesis

Nucleic acids and protein synthesis THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one

More information

Protein Synthesis Making Proteins

Protein Synthesis Making Proteins Protein Synthesis Making Proteins 2009-2010 Bodies Cells DNA Bodies are made up of cells All cells run on a set of instructions spelled out in DNA DNA Cells Bodies How does DNA code for cells & bodies?

More information

Proposed Models of DNA Replication. Conservative Model. Semi-Conservative Model. Dispersive model

Proposed Models of DNA Replication. Conservative Model. Semi-Conservative Model. Dispersive model 5.2 DNA Replication Cell Cycle Life cycle of a cell Cells can reproduce Daughter cells receive an exact copy of DNA from parent cell DNA replication happens during the S phase Proposed Models of DNA Replication

More information

Nucleic Acid Structure:

Nucleic Acid Structure: Genetic Information In Microbes: The genetic material of bacteria and plasmids is DNA. Bacterial viruses (bacteriophages or phages) have DNA or RNA as genetic material. The two essential functions of genetic

More information

From Gene to Protein Transcription and Translation

From Gene to Protein Transcription and Translation Name: Hour: From Gene to Protein Transcription and Translation Introduction: In this activity you will learn how the genes in our DNA influence our characteristics. For example, how can a gene cause albinism

More information

(deoxyribonucleic acid)

(deoxyribonucleic acid) 1 The Central Dogma of Molecular Biology Mark Mayo Cypress College 2 The Central Dogma of Molecular Biology 3 Importance of Proteins There are three main kinds: structural - make up most body parts hormone

More information

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16 Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes

More information

FROM MOLECULES TO LIFE

FROM MOLECULES TO LIFE Chapter 7 (Strickberger) FROM MOLECULES TO LIFE Organisms depended on processes that transformed materials available outside of the cell into metabolic products necessary for cellular life. These processes

More information

From DNA to Protein. Chapter 14

From DNA to Protein. Chapter 14 From DNA to Protein Chapter 14 What do genes code for? How does DNA code for cells & bodies? How are cells and bodies made from the instructions in DNA? DNA proteins cells bodies The Central Dogma Flow

More information

Tala Saleh. Tamer Barakat ... Anas Abu. Humaidan

Tala Saleh. Tamer Barakat ... Anas Abu. Humaidan 7 Tala Saleh Tamer Barakat... Anas Abu. Humaidan Some Information in this lecture may not be mentioned by the Dr. as thoroughly as this sheet. But they cannot be overlooked for a better understanding,

More information

Chapter 8: DNA and RNA

Chapter 8: DNA and RNA Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play

More information

7.2 Protein Synthesis. From DNA to Protein Animation

7.2 Protein Synthesis. From DNA to Protein Animation 7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They

More information

Introduction to genome biology Sandrine Dudoit and Robert Gentleman

Introduction to genome biology Sandrine Dudoit and Robert Gentleman Introduction to genome biology Sandrine Dudoit and Robert Gentleman University of California, Berkeley Outline Cells and cell division DNA structure and replication Proteins Central dogma: transcription,

More information

Welcome to Class 18! Lecture 18: Outline and Objectives. Replication is semiconservative! Replication: DNA DNA! Introductory Biochemistry!

Welcome to Class 18! Lecture 18: Outline and Objectives. Replication is semiconservative! Replication: DNA DNA! Introductory Biochemistry! Lecture 18: Outline and Objectives Welcome to Class 18! Introductory Biochemistry! l DNA Replication! l DNA polymerase! l the enzymatic reaction! l proofreading and accuracy! l DNA synthesis! l origins

More information