Supporting Online Material for

Size: px
Start display at page:

Download "Supporting Online Material for"

Transcription

1 Supporting Online Material for Regulation of Neuronal Survival Factor MEF2D by Chaperone-Mediated Autophagy Qian Yang, Hua She, Marla Gearing, Emanuela Colla, Michael Lee, John J. Shacka, Zixu Mao* *To whom correspondence should be addressed. Published 2 January 2009, Science 323, 124 (2008) DOI: /science This PDF file includes: Materials and Methods Figs. S1 to S9 References

2 Material and Methods Plasmid, antibodies and chemicals: pcdna/hygro-antisense-lamp2a and pcdna/zeo(-)-antisense-hsc70 were gifts from Janice S. Blum (1), and Lamp2a construct from A.M. Curevo. Antibodies were purchased from following vendors: anti- MEF2D and anti-α-synuclein from BD Biosciences, anti-hsc70 and anti-lamp2a from Abcam, and anti-vp16 and anti-gst from cell signaling Technology. NH4Cl, 6-AN and 3-MA were purchased from Sigma, LMB from LC Laboratories, and luciferase reporter gene assay kit and cell proliferation reagent WST-1 from Roche. Cell culture: SN4741 cells were cultured in DMEM (Gibco) containing 10%FBS (2). To remove the serum, cells were washed four times with PBS before replacing the complete medium. Primary cultures of cortical and cerebellar granule neurons were described previously (2-4). Isolation of lysosomes: Lysosomes were isolated as described (5). Male Long-Evans rats were fasted for hours before sacrifice. Livers were removed, washed with cold PBS and homogenized in the extraction buffer (Sigma, lysosomal isolation kit). After separation by density gradient centrifugation (150,000 g for 4 hours), lysosomes were isolated from lysosomel fraction and tested for Lamp2a levels by immunoblotting. The intactness of the lysosomes was assessed using the dye Neutral Red (Sigma, N2537). Binding and uptake by lysosomes: The assays were carried out as described (6). For binding assay, isolated lysosomes were co-incubated with purified GST-MEF2D fusion proteins for 20 minutes at 37 o C and washed for four times with cold PBS. For uptake assay, isolated lysosomes were treated with 100μM chymostation for 10 minutes on ice and incubated with the purified GST-MEF2D fusion proteins or cellular lysates for 20 minutes at 37 o C in MOPS buffer. Proteinase K was added directly to the samples for 10 minutes on ice.

3 A53T α-synuclein transgenic mouse and cathepsin D deficient mouse: The characterization of these mouse models has been described elsewhere (7, 8). Real-time PCR. Complementary DNA was generated from total RNA using random priming and MMLV reverse transcriptase (Invitrogen). Semi-quantitive PCR was done on Mycycler (Bio-rad) as following: 95 0 C,3 min; 30 cycles of 94 0 C,30 sec; 56 0 C,20 sec; 72 0 C, 25 sec; followed by 72 0 C,10 min. Real-time PCR was performed using SYBR Green PCR Master Mix (Invitrogen) and analysed on an AB Prism 7000 analyser (Applied Biosystems). All real-time values were normalized to 18S rrna. The oligonucleotides used in the study were: 18S forward, 5'- CGGCTACCACATCCAAGGAA-3', 18S reverse, 5'- GAGCTGG AATTACCGCGGCT-3'; MouMEF2D-F: gcagccacaaccgccacaacc, MouMEF2D-R: tgtgagagcagcacccacgtg. Electrophoretic mobility shift: Electrophoretic mobility shift assay was performed as described (4). The cell lysates were incubated with MEF2 specific probe or mutant probe. For super shift assay, the lysates were incubated with MEF2D antibody for 15 minutes before incubation with labeled probe. GST-pull down: SN4741 or HEK293 were washed in PBS and lysated in lysis buffer (20mM Tris ph 7.4, 40mM NaCl, 1mM EDTA, 1mM EGTA, 1mM Na3VO4, 10mM NaF, 10mM sodium pyrophosphate, 10mM sodium β-glycerophosphate, 1% Triton X- 100), and centrifuged. The supernatant was incubated with purified GST fusion proteins with glutathione sepharose beads (GE) for 2 hours at 4. Lusiferase reporter gene assay: MEF2 luciferase reporter assays were performed as described (4). SN4741 cells were transfected with a MEF2 luciferase reporter gene (wild type MEF2 binding site: TCGACGGGCTATTTTTAGGGCC; mutated binding site: 5- TCGACGGGCGATTTTTCGGGCCG-3) by Lipofectamine 2000 transfection method (Invitrogen). Cellular extracts were assayed for both luciferase and β-gal activities. Relative fold of luciferase activity was calculated based on efficiency of transfection.

4 Pulse-chase of MEF2D with 35 S Met/Cys: SN4741 cells grown to 60-70% confluence were washed and placed in Met/Cys-free media containing 10% dialyzed FCS. 320μCi of 35 S-label were added to cells for 12 hours. After removal of radioactive media, cells were washed and placed in regular media with or without FCS for various lengths of time. WST assay: This colorimetric assay measures the conversion of tetrazolium salt to formazan dye by cellular enzymes, which correlates to the number of metabolically active cells. SN4741 cells were cultured in 96 well microplates. After treatment, 10μl cell proliferation WST-1 reagent were added to each well when cells reached 60-70% confluence and incubated under conditions according to Manufacture s instruction (Roche). Statistical analysis: All statistical analyses where indicated are the Student s t test expect for fig. 3E and S7, which used rank sum test.

5 Supplementary figures and legends Fig. S1. Modulation of MEF2D levels in neurons. (A) Inhibition of MEF2D degradation by blocking autophagy. NH 4 Cl leads to MEF2D accumulation in primary cerebellar granule neurons (top panel: DIV indicates days in vitro) and primary cortical neurons (bottom panel:10mm NH 4 Cl). (B) Increase of MEF2D in the cortex of cathepsin D- deficient mice. Images show the immunohistochemical analysis of MEF2D in the cortical regions of wt and cathepsin D-deficient (CDKO) mice (red, MEF2D; blue, Dapi. Scale bar, 10μM). Tissue lysates from two sets of control and cathepsin D-deficient (CD-/-) mice were analyzed. The bottom graph shows relative MEF2D levels (n=3; * = p<0.05).

6

7 Fig. S2. The effects of serum deprivation on MEF2D transcript and protein. (A) Serum deprivation-induced turnover of metabolically labeled MEF2D. SN4741 cells were pulse-labeled with 35 S-Met/Cys for 12 hours. After removal of radioactive media, cells were treated with serum deprivation for the indicated times. MEF2D was immunoprecipitated and analyzed by autoradiography (top panel: MEF2D; bottom panel: actin levels in lysates). The bottom graph shows the quantitative change of MEF2D (numbers are mean±sem, n=3). (B) Semi-quantitative and quantitative RT-PCR analysis of mef2d mrna. Total RNA isolated from SN4741 cells following serum deprivation was analyzed by semi-quantitative (top: mef2d and 18S transcripts) and quantitative (bottom: levels of mef2d transcript relative to 18S transcript) RT-PCR.

8 Fig. S3. Effect of 3-MA on MEF2D level. SN4741 cells were treated with the macroautophagy inhibitor 3-MA for 12 or 24 hours. The levels of MEF2D were determined by immunoblotting. Bottom graph shows the quantification of 3-MA results (n=4).

9 Fig. S4. Lysosomal binding and uptake of RNase A. The purified known CMA substrate RNase A was incubated with purified lysosomes in uptake assays and detected by immunoblotting.

10 Fig. S5. Presence of multiple CMA recognition motifs in MEF2D. (A) Presence of multiple imperfect KFERQ-like sequences (underlines and over line) in the N terminus of MEF2D. (B) Effect of mutating QR (10/11) to AA on MEF2D binding to Hsc70. Lysates with over-expressed wt MEF2D or QR (10/11) AA mutant were incubated with GST-Hsc70 in pull-down assays. MEF2D bound to GST-Hsc70 were determined by immunoblotting (n=3, p>0.05).

11 Fig. S6. Effect of α-synuclein on the levels of MEF2D. (A) Inhibition of 6-AN-mediated degradation of MEF2D by α-synuclein. SN4741 cells were transfected with plasmids encoding indicated proteins and treated with 5mM 6-AN for 12 hours. The levels of MEF2D were analyzed by immunoblotting. Graph shows the average values (mean±sem, n=4; * = p<0.05). (B) Inhibition of MEF2D binding to endogenous Hsc70 by α-synuclein. Top panels show the specific interaction between over-expressed MEF2D and endogenous Hsc70 in HEK293 cells. Lysates containing over-expressed MEF2D was immuno-precipitated with anti-mef2d antibody. The precipitates were immuno-blotted for MEF2D (bottom) and Hsc70 (top). Bottom panels show the disruption of MEF2D binding to Hsc70 by α-synuclein. Co-immunoprecipitation with Hsc70 was carried out as described above following over-expression of α-synuclein and MEF2D in HEK293 cells (IB/IP panel: immunoprecipitated and blotted with anti- MEF2D antibody; IB panel: immunoprecipitated with anti-mef2d and blotted with anti- Hsc70 antibody; bottom: immunoblotting of α-synuclein in lysates).

12 Fig. S7. Levels of α-synuclein in brains of Parkinson s disease patients. Photos show representative images of immunohistochemical staining for α-synuclein in the striatum of control (Con) and PD patients (scale bar: 50μm). Graph depicts the relative levels of staining in cases tested (p value is rank sum test).

13 Fig. S8. Impairment of MEF2D binding to DNA following blockade of CMA. (A) Correlation of MEF2D levels and its DNA binding activity. Immunoblotting shows the levels of MEF2D in the lysates used for EMSA in fig. 4A. (B, C) Reduction in MEF2D DNA binding activity following inhibition of CMA. CMA in SN4741 cells was inhibited by either NH 4 Cl (B, cytoplasmic lysates) or anti-sense Hsc70 (C, whole cell lysates). MEF2D DNA binding activity was assessed by EMSA. The bottom immuno blots show the elevated levels of MEF2D following NH 4 Cl or anti-sense Hsc70 treatment. CIAP indicates samples treated with calf intestinal alkaline phosphatase prior to EMSA.

14 Fig. S9. Regulation of MEF2D function by NH 4 Cl. (A) Inhibition of MEF2 transactivation activity by NH 4 Cl. NH 4 Cl inhibits MEF2 transactivation activity measured by MEF2-dependent reporter assay in SN4741 cells (mean±sem, n=5, * = p<0.05). (B) Effect of increasing nuclear MEF2D on NH 4 Cl-induced cell death. Overexpression of MEF2D-VP16 in SN4741 cells attenuates NH 4 Cl-induced loss of viability in WST assay (mean±sem, n=3, * = p<0.05).

15 References 1. D. Zhou et al., Immunity 22, 571 (May, 2005). 2. X. Gong et al., Neuron 38, 33 (Apr 10, 2003). 3. X. Tang et al., J Neurosci 25, 4823 (May 11, 2005). 4. X. Wang, X. Tang, M. Li, J. Marshall, Z. Mao, J Biol Chem 280, (Apr 29, 2005). 5. A. M. Cuervo, E. Knecht, S. R. Terlecky, J. F. Dice, Am J Physiol 269, C1200 (Nov, 1995). 6. A. M. Cuervo, L. Stefanis, R. Fredenburg, P. T. Lansbury, D. Sulzer, Science 305, 1292 (Aug 27, 2004). 7. J. J. Shacka et al., J Neurosci 27, 2081 (Feb 21, 2007). 8. L. J. Martin et al., J Neurosci 26, 41 (Jan 4, 2006).

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53 Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

Sarker et al. Supplementary Material. Subcellular Fractionation

Sarker et al. Supplementary Material. Subcellular Fractionation Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged

More information

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION The Supplementary Information (SI) Methods Cell culture and transfections H1299, U2OS, 293, HeLa cells were maintained in DMEM medium supplemented with 10% fetal bovine serum. H1299 and 293 cells were

More information

Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2

Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 female) or wild-type (5 months old, 1 male; 11 months old,

More information

Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various

Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various GST-tagged N-terminal truncated APP fragments including GST-APP full-length (FL), APP (123-695), APP (189-695), or

More information

Supplementary Figure 1. GST pull-down analysis of the interaction of GST-cIAP1 (A, B), GSTcIAP1

Supplementary Figure 1. GST pull-down analysis of the interaction of GST-cIAP1 (A, B), GSTcIAP1 Legends Supplementary Figure 1. GST pull-down analysis of the interaction of GST- (A, B), GST mutants (B) or GST- (C) with indicated proteins. A, B, Cell lysate from untransfected HeLa cells were loaded

More information

Supporting Information

Supporting Information Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS

More information

Supplemental Information

Supplemental Information Supplemental Information Intrinsic protein-protein interaction mediated and chaperonin assisted sequential assembly of a stable Bardet Biedl syndome protein complex, the BBSome * Qihong Zhang 1#, Dahai

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

Supplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb.

Supplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb. Supplementary Figure 1 α-synuclein is truncated in PD and LBD brains. (a) Specificity of anti-n103 antibody. Anti-N103 antibody was coated on an ELISA plate and different concentrations of full-length

More information

supplementary information

supplementary information DOI: 10.1038/ncb1862 Figure S1 Identification of SCAI as a Dia1 associating factor. (a) Identification of SCAI (Riken cdna 930041I02) as a Dia1-FH3 interacting protein. Mouse brain lysate was incubated

More information

HPV E6 oncoprotein targets histone methyltransferases for modulating specific. Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu,

HPV E6 oncoprotein targets histone methyltransferases for modulating specific. Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu, 1 HPV E oncoprotein targets histone methyltransferases for modulating specific gene transcription 3 5 Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu, Cheng-Ming Chiang, Sheng-Chung

More information

Supplementary Fig.1 Luton

Supplementary Fig.1 Luton Supplementary Fig.1 Luton a 175 Brain Thymus Spleen Small Intestine Kidney Testis HeLa b 250 Lung Kidney MDCK c EFA6B si Control si Mismatch #637 #1564 #1770 83 62 47.5 175 IB: anti-efa6b #B1 130 66 Lysates

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

Supplementary Material

Supplementary Material Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated

More information

Methods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis

Methods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis Methods Western blot analysis of plg Wild-type mice first received a standardized burn wound and then were intravenously administered 2 mg of human plg (Omnio AB, Umeå, Sweden). 24 hours after wounding

More information

RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the

RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the

More information

Stargazin regulates AMPA receptor trafficking through adaptor protein. complexes during long term depression

Stargazin regulates AMPA receptor trafficking through adaptor protein. complexes during long term depression Supplementary Information Stargazin regulates AMPA receptor trafficking through adaptor protein complexes during long term depression Shinji Matsuda, Wataru Kakegawa, Timotheus Budisantoso, Toshihiro Nomura,

More information

Attenuation of synaptic toxicity and MARK4/PAR1-mediated Tau phosphorylation by

Attenuation of synaptic toxicity and MARK4/PAR1-mediated Tau phosphorylation by Supplementary Methods and Figures Attenuation of synaptic toxicity and MARK4/PAR1-mediated Tau phosphorylation by methylene blue for Alzheimer s disease treatment Wenchao Sun 1, Seongsoo Lee 1,2, Xiaoran

More information

SUPPLEMENTARY INFORMATION. LIN-28 co-transcriptionally binds primary let-7 to regulate mirna maturation in C. elegans

SUPPLEMENTARY INFORMATION. LIN-28 co-transcriptionally binds primary let-7 to regulate mirna maturation in C. elegans SUPPLEMENTARY INFORMATION LIN-28 co-transcriptionally binds primary let-7 to regulate mirna maturation in C. elegans Priscilla M. Van Wynsberghe 1, Zoya S. Kai 1, Katlin B. Massirer 2-4, Victoria H. Burton

More information

Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators.

Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators. Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators. (a) A graphic depiction of the approach to determining the stability of

More information

SUPPLEMENTARY INFORMATION. Chemical modulation of Chaperone-mediated autophagy by novel

SUPPLEMENTARY INFORMATION. Chemical modulation of Chaperone-mediated autophagy by novel SUPPLEMENTARY INFORMATION Chemical modulation of Chaperone-mediated autophagy by novel retinoic acid derivatives Jaime Anguiano 1, Thomas P Garner 2, Murugesan Mahalingam 1, Bhaskar C. Das 1, Evripidis

More information

Supplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered

Supplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered Supplementary Information: Materials and Methods Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered saline (PBS) and lysed in TNN lysis buffer (50mM Tris at ph 8.0, 120mM NaCl

More information

Reagents and cell culture Mcl-1 gene expression: real-time quantitative RT-PCR In vitro PP2A phosphatase assay Detection of Mcl-1 in vivo

Reagents and cell culture Mcl-1 gene expression: real-time quantitative RT-PCR In vitro PP2A phosphatase assay Detection of Mcl-1 in vivo Reagents and cell culture Antibodies specific for caspase 3, PARP and GAPDH were purchased from Cell Signaling Technology Inc. (Beverly, MA). Caspase inhibitor z-vad-fmk and ROS scavenger N-acetyl-Lcysteine

More information

MeCP2. MeCP2/α-tubulin. GFP mir1-1 mir132

MeCP2. MeCP2/α-tubulin. GFP mir1-1 mir132 Conservation Figure S1. Schematic showing 3 UTR (top; thick black line), mir132 MRE (arrow) and nucleotide sequence conservation (vertical black lines; http://genome.ucsc.edu). a GFP mir1-1 mir132 b GFP

More information

15 June 2011 Supplementary material Bagriantsev et al.

15 June 2011 Supplementary material Bagriantsev et al. Supplementary Figure S1 Characterization of K 2P 2.1 (TREK-1) GOF mutants A, Distribution of the positions of mutated nucleotides, represented by a red x, from a pool of 18 unselected K 2P 2.1 (KCNK2)

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure S1 (a) P-cRAF colocalizes with LC3 puncta. Immunofluorescence (IF) depicting colocalization of P-cRAF (green) and LC3 puncta (red) in NIH/3T3 cells treated

More information

GFP CCD2 GFP IP:GFP

GFP CCD2 GFP IP:GFP D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant

More information

Recombinant adenoviruses. A TRB3-expressing adenovirus was generated through

Recombinant adenoviruses. A TRB3-expressing adenovirus was generated through Materials and Methods Recombinant adenoviruses. A -expressing adenovirus was generated through homologous recombination between a linearized transfer vector pad-track and the adenoviral backbone vector

More information

Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons

Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental

More information

Supplementary Figure S1. N-terminal fragments of LRRK1 bind to Grb2.

Supplementary Figure S1. N-terminal fragments of LRRK1 bind to Grb2. Myc- HA-Grb2 Mr(K) 105 IP HA 75 25 105 1-1163 1-595 - + - + - + 1164-1989 Blot Myc HA total lysate 75 25 Myc HA Supplementary Figure S1. N-terminal fragments of bind to Grb2. COS7 cells were cotransfected

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation

More information

Quantitative and non-quantitative RT-PCR. cdna was generated from 500ng RNA (iscript;

Quantitative and non-quantitative RT-PCR. cdna was generated from 500ng RNA (iscript; Supplemental Methods Quantitative and non-quantitative RT-PCR. cdna was generated from 500ng RNA (iscript; Bio-Rad, Hercules, CA, USA) and standard RT-PCR experiments were carried out using the 2X GoTaq

More information

1. QUANTITY OF LYSATE 2. LYSIS BUFFER

1. QUANTITY OF LYSATE 2. LYSIS BUFFER SAMPLE PREPARATION 1. QUANTITY OF LYSATE The amount of protein requested for the Kinex KAM-880 Antibody Microarray service is 100 µg per sample at an approximate concentration of 2 mg/ml. If your samples

More information

Supplementary Methods Plasmid constructs

Supplementary Methods Plasmid constructs Supplementary Methods Plasmid constructs. Mouse cdna encoding SHP-1, amplified from mrna of RAW264.7 macrophages with primer 5'cgtgcctgcccagacaaactgt3' and 5'cggaattcagacgaatgcccagatcacttcc3', was cloned

More information

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). 1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well

More information

Supplementary information

Supplementary information Supplementary information Table of Content: Supplementary Results... 2 Supplementary Figure S1: Experimental validation of AP-MS results by coimmunprecipitation Western blot analysis.... 3 Supplementary

More information

Coleman et al., Supplementary Figure 1

Coleman et al., Supplementary Figure 1 Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential

More information

Supplemental Materials and Methods

Supplemental Materials and Methods Supplemental Materials and Methods In situ hybridization In situ hybridization analysis of HFE2 and genin mrna in rat liver tissues was performed as previously described (1). Briefly, the digoxigenin-labeled

More information

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary

More information

Cell culture and drug treatment. HEK 293 cells were cultured in DMEM (Gibco-BRL)

Cell culture and drug treatment. HEK 293 cells were cultured in DMEM (Gibco-BRL) Supplementary materials Detailed methods Cell culture and drug treatment. HEK 293 cells were cultured in DMEM (Gibco-BRL) supplemented with 10% fetal bovine serum. To inhibit glucosidase Ι and ΙΙ, castanospermine

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods sirna sequences used in this study The sequences of Stealth Select RNAi for ALK and FLOT-1 were as follows: ALK sense no.1 (ALK): 5 -AAUACUGACAGCCACAGGCAAUGUC-3 ; ALK

More information

Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency.

Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. (a) Transfection of different concentration of GAS5-overexpressing

More information

Cdc42 Activation Assay Kit

Cdc42 Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Cdc42 Activation Assay Kit Catalog Number: 80701 20 assays 1 Table of Content Product Description 3 Assay

More information

Supplementary material for: Materials and Methods:

Supplementary material for: Materials and Methods: Supplementary material for: Iron-responsive degradation of iron regulatory protein 1 does not require the Fe-S cluster: S.L. Clarke, et al. Materials and Methods: Fe-S Cluster Reconstitution: Cells treated

More information

Supplemental Figure 1 Human REEP family of proteins can be divided into two distinct subfamilies. Residues (single letter amino acid code) identical

Supplemental Figure 1 Human REEP family of proteins can be divided into two distinct subfamilies. Residues (single letter amino acid code) identical Supplemental Figure Human REEP family of proteins can be divided into two distinct subfamilies. Residues (single letter amino acid code) identical in all six REEPs are highlighted in green. Additional

More information

DRG Pituitary Cerebral Cortex

DRG Pituitary Cerebral Cortex Liver Spinal cord Pons Atg5 -/- Atg5 +/+ DRG Pituitary Cerebral Cortex WT KO Supplementary Figure S1 Ubiquitin-positive IBs accumulate in Atg5 -/- tissues. Atg5 -/- neonatal tissues were fixed and decalcified.

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Supplementary Figure 1. PKM2 interacts with MLC2 in cytokinesis. a, U87, U87/EGFRvIII, and HeLa cells in cytokinesis were immunostained with DAPI and an anti-pkm2 antibody. Thirty

More information

SUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION

SUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION SUPPLEMENTAL MATERIALS SIRTUIN PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF ACTIVATION Haranatha R. Potteti*, Subbiah Rajasekaran*, Senthilkumar B. Rajamohan*, Chandramohan R. Tamatam,

More information

Supplemental Materials and Methods

Supplemental Materials and Methods Supplemental Materials and Methods Co-immunoprecipitation (Co-IP) assay Cells were lysed with NETN buffer (20 mm Tris-HCl, ph 8.0, 0 mm NaCl, 1 mm EDT, 0.5% Nonidet P-40) containing 50 mm β-glycerophosphate,

More information

Supporting Information

Supporting Information Supporting Information He et al. 10.1073/pnas.1116302108 SI Methods Cell Culture. Mouse J774A.1 and RAW 264.7 macrophages were obtained from ATCC and were cultured in MEM supplemented with 10% FS (Sigma)

More information

RheB Activation Assay Kit

RheB Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based RheB Activation Assay Kit Catalog Number: 81201 20 assays NewEast Biosciences 1 FAX: 610-945-2008 Table

More information

Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera

Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera SUPPLEMENTARY INFORMATION Roles of human POLD1 and POLD3 in genome stability Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera SUPPLEMENTARY METHODS Cell proliferation After sirna

More information

Grb2-Mediated Alteration in the Trafficking of AβPP: Insights from Grb2-AICD Interaction

Grb2-Mediated Alteration in the Trafficking of AβPP: Insights from Grb2-AICD Interaction Journal of Alzheimer s Disease 20 (2010) 1 9 1 IOS Press Supplementary Material Grb2-Mediated Alteration in the Trafficking of AβPP: Insights from Grb2-AICD Interaction Mithu Raychaudhuri and Debashis

More information

SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Rat) *Colorimetric*

SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Rat) *Colorimetric* SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Rat) *Colorimetric* Revision number: 1.3 Last updated: 1/15/18 Catalog # AS-55550-R Kit Size One 96-well strip plate This kit is optimized to detect

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/4/9/eaat5401/dc1 Supplementary Materials for GLK-IKKβ signaling induces dimerization and translocation of the AhR-RORγt complex in IL-17A induction and autoimmune

More information

Antibodies against PCNA were previously described [1]. To deplete PCNA from Xenopus egg

Antibodies against PCNA were previously described [1]. To deplete PCNA from Xenopus egg Supplementary information Supplementary methods PCNA antibody and immunodepletion Antibodies against PCNA were previously described [1]. To deplete PCNA from Xenopus egg extracts, one volume of protein

More information

Arf6 Activation Assay Kit

Arf6 Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Arf6 Activation Assay Kit Catalog Number: 82401 20 assays NewEast Biosciences 1 Table of Content Product

More information

SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric*

SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* Catalog # Kit Size SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* AS-55550 One 96-well strip plate This kit is optimized to detect human/mouse/rat alpha-synuclein

More information

Supplementary Figure 1. TSA (10 nmol/l), non-class-selective HDAC inhibitor, potentiates

Supplementary Figure 1. TSA (10 nmol/l), non-class-selective HDAC inhibitor, potentiates Supplementary Figure 1. TSA (10 nmol/l), non-class-selective HDAC inhibitor, potentiates vascular calcification (VC). (a) Von Kossa staining shows that TSA potentiated the Pi-induced VC. Scale bar, 100

More information

RNP-IP (Modified Method)-Getting Majority RNA from RNA Binding Protein in the Cytoplasm Fengzhi Liu *

RNP-IP (Modified Method)-Getting Majority RNA from RNA Binding Protein in the Cytoplasm Fengzhi Liu * RNP-IP (Modified Method)-Getting Majority RNA from RNA Binding Protein in the Cytoplasm Fengzhi Liu * School of Biomedical Sciences, Thomas Jefferson University, Philadelphia, USA *For correspondence:

More information

SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency

SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency Molecular Cell, Volume 52 Supplemental Information SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency Kengo Homma, Takao Fujisawa, Naomi Tsuburaya, Namiko

More information

Online Supplementary Information

Online Supplementary Information Online Supplementary Information NLRP4 negatively regulates type I interferon signaling by targeting TBK1 for degradation via E3 ubiquitin ligase DTX4 Jun Cui 1,4,6,7, Yinyin Li 1,5,6,7, Liang Zhu 1, Dan

More information

Supplementary Figures S1-S5. a b c

Supplementary Figures S1-S5. a b c Supplementary Figures S1-S5 a b c Supplementary Figure S1. Generation of IL-17RD-deficient mice. (a) Schematic shows the murine il-17rd gene and the genetrap targeting vector, containing a promoter-less

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION (Supplementary Methods and Materials) GST pull-down assay GST-fusion proteins Fe65 365-533, and Fe65 538-700 were expressed in BL21 bacterial cells and purified with glutathione-agarose beads (Sigma).

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/4/167/ra20/dc1 Supplementary Materials for Poly(ADP-Ribose) (PAR) Binding to Apoptosis-Inducing Factor Is Critical for PAR Polymerase-1 Dependent Cell Death (Parthanatos)

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/1154040/dc1 Supporting Online Material for Selective Blockade of MicroRNA Processing by Lin-28 Srinivas R. Viswanathan, George Q. Daley,* Richard I. Gregory* *To whom

More information

Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.

Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Target Gene Non-target / Control BTG2 BRCA1 NFE2L2 Target Sequence ON-TARGET plus Non-targeting sirna # 1 (Cat# D-001810-01-05) sirna1: GAACCGACAUGCUCCCGGA

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/404/ra120/dc1 Supplementary Materials for The subcellular localization and activity of cortactin is regulated by acetylation and interaction with Keap1 Akihiro

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12119 SUPPLEMENTARY FIGURES AND LEGENDS pre-let-7a- 1 +14U pre-let-7a- 1 Ddx3x Dhx30 Dis3l2 Elavl1 Ggt5 Hnrnph 2 Osbpl5 Puf60 Rnpc3 Rpl7 Sf3b3 Sf3b4 Tia1 Triobp U2af1 U2af2 1 6 2 4 3

More information

Rab5 Activation Assay Kit

Rab5 Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Rab5 Activation Assay Kit Catalog Number: 83701 20 assays 24 Whitewoods Lane 1 Table of Content Product

More information

Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated

Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated Supplementary Figure Legends Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated with either vehicle (left; n=3) or CCl 4 (right; n=3) were co-immunostained for NRP-1 (green)

More information

Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of

Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of Supplementary Information Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of Syntaxin 1 and SNAP-25 in Neuron Survival Lisheng Peng, Huisheng Liu, Hongyu Ruan, William H. Tepp, William H. Stoothoff,

More information

Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2.

Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2. Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2. Construct name ISG12b2 (No tag) HA-ISG12b2 (N-HA) ISG12b2-HA (C-HA; FL-HA) 94-283-HA (FL-GFP) 93-GFP

More information

Regulation of autophagic activity by ζ proteins associated with class III. phosphatidylinositol-3 kinase. Mercedes Pozuelo Rubio

Regulation of autophagic activity by ζ proteins associated with class III. phosphatidylinositol-3 kinase. Mercedes Pozuelo Rubio ONLINE SUPPORTING INFORMATION Regulation of autophagic activity by 14-3-3ζ proteins associated with class III phosphatidylinositol-3 kinase Mercedes Pozuelo Rubio entro Andaluz de Biología Molecular y

More information

EPIGENTEK. EpiQuik Chromatin Immunoprecipitation Kit. Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE

EPIGENTEK. EpiQuik Chromatin Immunoprecipitation Kit. Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE EpiQuik Chromatin Immunoprecipitation Kit Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Chromatin Immunoprecipitation Kit is suitable for combining the specificity of

More information

MEFs were treated with the indicated concentrations of LLOMe for three hours, washed

MEFs were treated with the indicated concentrations of LLOMe for three hours, washed Supplementary Materials and Methods Cell Fractionation MEFs were treated with the indicated concentrations of LLOMe for three hours, washed with ice-cold PBS, collected by centrifugation, and then homogenized

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3562 In the format provided by the authors and unedited. Supplementary Figure 1 Glucose deficiency induced FH-ATF2 interaction. In b-m, immunoblotting or immunoprecipitation analyses were

More information

8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and

8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and 1 Supplemental information 2 3 Materials and Methods 4 Reagents and animals 5 8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and 6 Silencer Select Pre-designed sirna

More information

Gα i Activation Assay Kit

Gα i Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Gα i Activation Assay Kit Catalog Number 80301 20 assays NewEast Biosciences, Inc 1 Table of Content Product

More information

LINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS.

LINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS. Supplemental Data: LINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS. Scott Jepson, Bryan Vought, Christian H.

More information

Cell extracts and western blotting RNA isolation and real-time PCR Chromatin immunoprecipitation (ChIP)

Cell extracts and western blotting RNA isolation and real-time PCR Chromatin immunoprecipitation (ChIP) Cell extracts and western blotting Cells were washed with ice-cold phosphate-buffered saline (PBS) and lysed with lysis buffer. 1 Total cell extracts were separated by SDS-PAGE and transferred to nitrocellulose

More information

Transcriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death

Transcriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death SUPPLEMENTAL DATA Transcriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death Huajun Jin 1, Arthi Kanthasamy 1, Vellareddy Anantharam

More information

supplementary information

supplementary information DOI: 10.1038/ncb2172 Figure S1 p53 regulates cellular NADPH and lipid levels via inhibition of G6PD. (a) U2OS cells stably expressing p53 shrna or a control shrna were transfected with control sirna or

More information

Table of Contents. I. Kit Components...2. Storage...2. Principle...2. IV. Precautions for operation...3. V. Protocol : reverse transcription...

Table of Contents. I. Kit Components...2. Storage...2. Principle...2. IV. Precautions for operation...3. V. Protocol : reverse transcription... Table of Contents I. Kit Components...2 II. III. Storage...2 Principle...2 IV. Precautions for operation...3 V. Protocol : reverse transcription...3 VI. Protocol : Real-time PCR...5 VII. Appendix...7 VIII.

More information

Transcriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3

Transcriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3 ChIP H3K4Me3 enrichment.25.2.15.1.5 H3K4Me3 H3K4Me3 ctrl H3K4Me3 + E2 NS + E2 1. kb kb +82 kb Figure S1. Estrogen promotes entry of MCF-7 into the cell cycle but does not significantly change activation-associated

More information

Supplemental Table S1. RT-PCR primers used in this study

Supplemental Table S1. RT-PCR primers used in this study Supplemental Table S1. RT-PCR primers used in this study -----------------------------------------------------------------------------------------------------------------------------------------------

More information

Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide,

Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide, Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide, conjugated with either TAT or Myristic acid and biotin for

More information

96-well Checkpoint Kinase Activity Assay Kit

96-well Checkpoint Kinase Activity Assay Kit Product Manual 96-well Checkpoint Kinase Activity Assay Kit Catalog Number STA-414 STA-414-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cdc25C is a

More information

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6

More information

Table 1. Primers, annealing temperatures, and product sizes for PCR amplification.

Table 1. Primers, annealing temperatures, and product sizes for PCR amplification. Table 1. Primers, annealing temperatures, and product sizes for PCR amplification. Gene Direction Primer sequence (5 3 ) Annealing Temperature Size (bp) BRCA1 Forward TTGCGGGAGGAAAATGGGTAGTTA 50 o C 292

More information

Fig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of

Fig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of Fig. S1 TGF RI inhibitor SB525334 effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of different concentrations of SB525334. Cells were lysed and

More information

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG. Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination

More information

Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene

Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene Developmental Cell, Volume 25 Supplemental Information Brg1 Governs a Positive Feedback Circuit in the Hair Follicle for Tissue Regeneration and Repair Yiqin Xiong, Wei Li, Ching Shang, Richard M. Chen,

More information

RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit

RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit Catalog #: TFEH-p65 User Manual Mar 13, 2017 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/3/146/ra80/dc1 Supplementary Materials for DNMT1 Stability Is Regulated by Proteins Coordinating Deubiquitination and Acetylation-Driven Ubiquitination Zhanwen

More information

1. Cross-linking and cell harvesting

1. Cross-linking and cell harvesting ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine

More information

Supplementary Figure 1. The Hsp70 acetylation level is related to the co-chaperone binding of Hsp70 under various stress conditions.

Supplementary Figure 1. The Hsp70 acetylation level is related to the co-chaperone binding of Hsp70 under various stress conditions. Supplementary Figure 1. The Hsp70 acetylation level is related to the co-chaperone binding of Hsp70 under various stress conditions. 1 (a) Etoposide treatment gradually changes acetylation level and co-chaperone

More information