Supporting Information
|
|
- Augustine Carr
- 6 years ago
- Views:
Transcription
1 Supporting Information Horie et al /pnas SI Materials and Methods ell ulture and Reagents. THP-1 cells were obtained from the American Type ell ollection. THP-1 cells were transformed into macrophages by incubation for 3 d with 100 nm PMA (Nacalai Tesque). An immortalized primary human hepatocyte (HuS-E/2) cell line was kindly given by Makoto Hijikata (Kyoto University, Kyoto, Japan). Peritoneal macrophages were obtained from the peritoneal cavity of WT and mir-33 deficient mice 4 d after i.p. injection of 1 ml 10% thioglycolate. The cells obtained were washed with RPMI1640 (Nacalai Tesque), spun at 1,000 rpm for 10 min, and plated at a density of 10 6 cells per ml. ells were washed 1 h later and incubated for 2 d, then used for experiments. The antibodies used were a polyclonal anti-aa1 antibody (Novus iologicals), a polyclonal anti-ag1 antibody (Novus iologicals), a polyclonal anti SREP-2 antibody (ayman hemical), an anti-gaph antibody (ell Signaling Technology), and an anti β-actin antibody (Sigma-Aldrich). Simvastatin was purchased from Wako Pure hemical Industries. Acetylated LL (AcLL) was purchased from iomedical Technologies. ApoA-I was from Sigma-Aldrich. [1, 2-3 H (N)]-cholesterol was from Perkin-Elmer. Plasmids. Expression vectors for the negative control (mir-control) and micrornas were generated using LOK-iT PolIImiR RNAi Expression Vector Kits in accordance with the manufacturer s protocol (Invitrogen). The mir-control vector contains a hairpin structure just as for a regular premirna, but which is predicted not to target any known vertebrate gene (pcna6.2-gw/ EmGFP-miR-neg control plasmid). To create an anti mir-33 (decoy) vector, the luciferase 3 UTR was modified to include three to nine tandem sequences complementary to mir-33, separated by a single nucleotide space. The sequences of all constructs were analyzed using an AI 3100 genetic analyzer. All of these constructs were correctly inserted into a plenti6/v5--topo vector (Invitrogen) driven by a MV promoter to stably express genes in THP-1 and HuS-E/2 cells. Southern lotting. Southern blotting was performed using IG High Prime NA Labeling and etection Starter Kit II in accordance with the protocol of the manufacturer (Roche). Primer Sequences for the Southern lotting Probe and Genotyping. Primer sequences for the probe (865 bp) for Southern blotting and genotyping (WT, 385 bp; KO, 491 bp) were as follows: Southern probe primer sense; AATGAGTGAGAGGTG- GAGTTTG Southern probe primer antisense; ATGATTGAGTTA- GAGTA WT/KO sense; GGATATTTGATTT WT antisense; AATAAATGAAAGTG KO antisense; TTGGGATAGAATTGTGATTAA Western lotting. ell lysates were prepared and subjected to SS/ PAGE followed by standard Western blotting procedure. Quantitative PR for microrna. Measurement of mir-33 was performed in accordance with the TaqMan MicroRNA Assays (Applied iosystems) protocol, and products were analyzed using a thermal cycler (AI Prism7900HT sequence detection system). Values were normalized using U6 snrna expression. Quantitative PR for mrna. Total RNA was isolated using TRIzol reagent (Invitrogen). cna was synthesized using Transriptor First Strand cna Synthesis Kit (Roche), and PR was performed with a SYR Green PR master mix (Applied iosystems), normalized with GAPH. An AI Prism 7900HT sequence detection system was used as a thermal cycler. Genespecific primers were as follows: AA1 sense (human); 5 GTTTTTGATTATT- GG3 AA1 antisense (human); 5 AGTTTGGAAGGTTTG- TTA3 SREP2 sense (human); 5 AGGAGAAATGGTGTGA3 SREP2 antisense (human); 5 TAAAGGAGAGGAAG- GA3 LL-receptor sense (human); 5 AGATATATAAGAA- G3 LL-receptor antisense (human); 5 TTAAAGTT- AT3 GAPH sense (human and mouse); 5 TTGATAAGA- TT3 GAPH antisense (human and mouse); 5 TTGTATGGAT- GATTGG3 sense (mouse); 5 GTGGAGAGTTAAGTA3 antisense (mouse); 5 TGGTAGGTTAAG- GAG3 Oligonucleotide Sequences Used for onstruction of WT or Mutant Abca1 and Abcg1 3 UTR Reporter onstructs. WT Abca1: GAAAAATGGATATGTATGAATATTAATG- AATGATTAATGAAGAGAAAAATTAT- TA Mutant Abca1: GAAAAATGGATATGTATGAATATTATA- GTTAGTTTATAGTAGAGAAAAATTAT- TA WT Abcg1: TAGTAAAGTGGTGGGGAGAGGGAT- AAGAAGAATGAAGAATGAGAAGTG- TGGGGTATTA Mutant Abcg1: TAGTAAAGTGGTGGGGAGAGGGA- TAAGAAGATAGTAGATAGTGAAGTG- TGGGGTATTA 1of5
2 PMA(-) PMA(+) Phase Phase GFP GFP Fig. S1. Microscopy images of THP-1 and HuS-E/2 cells. (A) mirnas were transduced into THP-1 cells using lentivirus vectors. Transduction efficiency, which was shown using GFP, was always greater than 90%. THP-1 cells were induced to differentiate into macrophages by PMA stimulation (100 nm) for 3 d. () mirnas were transduced into HuS-E/2 cells, which are immortalized human primary hepatocytes. Transduction efficiency, which was shown using GFP, was always greater than 90%. A E A A 1 GA P H A A 1 Si mv ast at in 24 h ( µm) Si mv ast at in (10 µm) 0h 6h 24 h LL- r ecep to r/ GAP H SREP2 /G APH mi R- 33/ U6 GA P H 0h 6h 24 h 0h 6h 24 h 0h 6h 24 h Fig. S2. Effect of simvastatin in THP-1 macrophages. (A) Western blot analysis of AA1 protein levels after stimulation with simvastatin for 24 h at indicated concentrations in THP-1 macrophages. GAPH was used as loading control. () Western blot analysis of AA1 protein levels after stimulation with simvastatin (10 μm) for indicated time periods in THP-1 macrophages. GAPH was used as a loading control. () Quantitative real-time PR analysis of LL receptor expression levels following stimulation with simvastatin (10 μm) for indicated time periods in THP-1 macrophages. Values are mean ± SE of six independent experiments with normalization using Gapdh expression. P < 5 compared with 0 h. () Quantitative real-time PR analysis of expression levels following stimulation with simvastatin (10 μm) in THP-1 macrophages. Values are mean ± SE of six independent experiments with normalization using GAPH expression. P < 5 compared with 0 h. (E) Quantitative real-time PR analysis of mir-33 expression levels following stimulation with simvastatin (10 μm) for time indicated in THP-1 macrophages. Values are mean ± SE of six independent experiments with normalization using U6 snrna expression. P < 5 compared with 0 h. 2of5
3 MV ecoy(anti-mir-33)-luc x3 MV Anti-miR-33 Anti-miR-33 Anti-miR-33 x6 MV Anti-miR-33 Anti-miR-33 Anti-miR-33 x9 MV Anti-miR-33 Anti-miR-33 Anti-miR-33 Anti-miR-33 Tandem sequences complementary to mir-33 ecoy-lucx3 ecoy-lucx6 activity (%) AA1 ecoy(anti-mir-33x9)-luc ecoy(anti-mir-33x9)-luc ecoy(anti-mir-33x9)-luc ecoy-lucx9 GAPH 10% FS SFM Simvastatin (10 µm) Fig. S3. Silencing of endogenous mir-33 using decoy gene in vitro. (A) Schema of decoy gene. 3 UTR was modified to include three to nine tandem sequences complementary to mir-33, each separated by a single nucleotide spacer. () 293T cells were transfected with control-luc or decoy-luc ( 3, 6, and 9) constructs, along with expression vector of mir-33. activity was measured 48 h after transfection. Reduction in luciferase activity indicates effect of decoy gene. Values are mean ± SE of three independent experiments.p < 01; P < 5. () Western blot analysis of AA1. THP-1 cells were transfected with control-luc or decoy (anti mir-33 9)-luc using a lentivirus vector. ells were cultured in RPMI 1640 with 10% FS; otherwise cells were cultured without FS or treated with simvastatin (10 μm) for 24 h. GAPH was used as loading control. Re la ti ve expr essi on leve l Sr e bp2 (8 w eek) Ma le (+ /+ ) Ma le (-/ -) Fe ma le (+ /+ ) Fe ma le (-/ -) Fig. S4. omparison of expression in 8-wk-old mice. Quantitative real-time PR analysis of in liver of 8-wk-old male and female mice. Values are mean ± SE of three to four mice with normalization using Gapdh expression. Value for WT male mice was set at. 3of5
4 (exon16 exon17) Gapdh +/+ -/- +/+ -/ (16 week) Male (+/+) Male (-/-) Female (+/+) Female (-/-) (exon16 exon17) Gapdh +/+ -/- +/+ -/ (24 week) Male (+/+) Male (-/-) Female (+/+) Female (-/-) Fig. S5. omparison of expression in 16- and 24-wk-old mice. (A) RT-PR analysis of in the liver of 16-wk-old male (Upper) and female (Lower) mice. The sense primer was designed in exon 16 of and the antisense primer was designed in exon 17 of. Gapdh expression was used as a control. () Quantitative real-time PR analysis of in the liver of 16-wk-old male and female mice. Values are the means ± SE of three to four mice with normalization using Gapdh expression. The value for WT male mice was set at. () RT-PR analysis of in the liver of 24-wk-old male (Upper) and female (Lower) mice. Sense primer was designed in exon 16 of, and antisense primer was designed in exon 17 of. Gapdh expression was used as control. () Quantitative real-time PR analysis of in the liver of 24-wk-old male and female mice. Values are mean ± SE of three to four mice with normalization using Gapdh expression. Value for WT male mice was set at. 4of5
5 Re la ti ve Expr essi on leve l Re la ti ve ex pr essi on leve l Ep if at mi R- 33 Me sf at Su bf at Lu ng Sp l een Te st is He ar t Li ver Sm al li nt est in e Ki dne y Mu scl e r ai n mir-33 (Ki dney) +/ + -/ - +/ - Re la ti ve ex pr essi on leve l mir-33 ( ra in ) +/ + -/ - Re la ti ve ex pr essi on level Ep if at +/ - Me sf at Su bf at Lun g Spl een T est is H ear t Li ver Sm al li nt est in e Ki dne y Mu scl e r ai n Ma le (+ /+ ) mir-33 (Li ver ) Fig. S6. Expression level of mir-33 in mice. (A) Quantitative real-time PR analysis of mir-33 and in 8-wk-old WT male mice with normalization using U6 snrna or Gapdh expression. Values for liver were set at. () Quantitative real-time PR analysis of mir-33 in kidney of 8-wk-old male mice. N, not determined. () Quantitative real-time PR analysis of mir-33 in brain of 8-wk-old male mice. N, not determined. () Quantitative real-time PR analsysis of mir-33 in liver of 16-wk-old male and female mice. N, not determined. Ma le (-/ -) Fe ma le (+ /+ ) Fe ma le (-/ -) A Abcg1 3 UTR mir-33 binding site 1 2 Mmu (Mouse) Rno (Rat) UGGUGGGGAGAGGGAUAAGAAGA AUGA AG-----AA UGA GAAGUGUGGGG UGGUGGGAGAGGGAU A AUGA AUGAAAAA UGA GAAGUGUGGGG Relative luciferase activity Abcg1 3'UTR AG mir-control mir-33 mir-146a mir-control mir-33 mir-146a GAPH AG1 GAPH +/+ -/- +/+ + -/- WT Mutant Fig. S7. Analysis of AG1 in vitro and in vivo. (A) Sequence alignment of Abcg1 3 UTR. There are two potential mir-33 binding sites in the Abcg1 3 UTR; however, these were conserved only in rodents and not in humans. () 293T cells were transfected with WT or mutant Abcg1 3 UTR luciferase constructs, along with expression plasmids for mir-control (negative control), mir-33, and mir-146a. Values are mean ± SE of four independent experiments. P < 5 compared with other columns. () Western blot analysis of hepatic AG1 in 16-wk-old male mice. GAPH was used as loading control. () Western blot analysis of hepatic AG1 in 16-wk-old female mice. GAPH was used as loading control. 5of5
8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and
1 Supplemental information 2 3 Materials and Methods 4 Reagents and animals 5 8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and 6 Silencer Select Pre-designed sirna
More informationMeCP2. MeCP2/α-tubulin. GFP mir1-1 mir132
Conservation Figure S1. Schematic showing 3 UTR (top; thick black line), mir132 MRE (arrow) and nucleotide sequence conservation (vertical black lines; http://genome.ucsc.edu). a GFP mir1-1 mir132 b GFP
More informationCell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).
1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationSupplementary Methods
Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed
More information1. Primers for PCR to amplify hairpin stem-loop precursor mir-145 plus different flanking sequence from human genomic DNA.
Supplemental data: 1. Primers for PCR to amplify hairpin stem-loop precursor mir-145 plus different flanking sequence from human genomic DNA. Strategy#1: 20nt at both sides: #1_BglII-Fd primer : 5 -gga
More informationSupplementary Figure 1
Supplementary Figure 1 Virus infection induces RNF128 expression. (a,b) RT-PCR analysis of Rnf128 (RNF128) mrna expression in mouse peritoneal macrophages (a) and THP-1 cells (b) upon stimulation with
More informationTRIM31 is recruited to mitochondria after infection with SeV.
Supplementary Figure 1 TRIM31 is recruited to mitochondria after infection with SeV. (a) Confocal microscopy of TRIM31-GFP transfected into HEK293T cells for 24 h followed with SeV infection for 6 h. MitoTracker
More informationSUPPLEMENTARY INFORMATION
Supplementary Figure a T m ( C) Seq. '-3' uguuugugguaacagugugaggu L 62 AttGtcAcaCtcC L2 6 ccattgtcacactcc L3 66 attgtcacactcc 7 ccattgtcacactcca L 73 ccattgtcacactcc L6 74 AttGTcaCaCtCC L7 7 attgtcacactcc
More informationRegulation of hepcidin expression by inflammation-induced activin B
Regulation of hepcidin expression by inflammation-induced activin B Yohei Kanamori, Makoto Sugiyama, Osamu Hashimoto, Masaru Murakami, Tohru Matsui and Masayuki Funaba Supplemental methods Liver cell separation
More informationSupplementary Figure 1. Characterization of the POP2 transcriptional and post-transcriptional regulatory elements. (A) POP2 nucleotide sequence
1 5 6 7 8 9 10 11 1 1 1 Supplementary Figure 1. Characterization of the POP transcriptional and post-transcriptional regulatory elements. (A) POP nucleotide sequence depicting the consensus sequence for
More informationSupplementary Figure 1 Validate the expression of mir-302b after bacterial infection by northern
Supplementary Figure 1 Validate the expression of mir-302b after bacterial infection by northern blot. Northern blot analysis of mir-302b expression following infection with PAO1, PAK and Kp in (A) lung
More informationSupplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell
Supplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell Supplementary Figures S1-S3 Supplementary Methods Supplementary Figure S1. Identification
More informationIKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity
IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα
More informationFig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination
More informationSupporting Information
Supporting Information He et al. 10.1073/pnas.1116302108 SI Methods Cell Culture. Mouse J774A.1 and RAW 264.7 macrophages were obtained from ATCC and were cultured in MEM supplemented with 10% FS (Sigma)
More informationUTR Reporter Vectors and Viruses
UTR Reporter Vectors and Viruses 3 UTR, 5 UTR, Promoter Reporter (Version 1) Applied Biological Materials Inc. #1-3671 Viking Way Richmond, BC V6V 2J5 Canada Notice to Purchaser All abm products are for
More informationSupporting Information
Supporting Information Tal et al. 10.1073/pnas.0807694106 SI Materials and Methods VSV Infection and Quantification. Infection was carried out by seeding 5 10 5 MEF cells per well in a 6-well plate and
More informationSupplemental Methods Cell lines and culture
Supplemental Methods Cell lines and culture AGS, CL5, BT549, and SKBR were propagated in RPMI 64 medium (Mediatech Inc., Manassas, VA) supplemented with % fetal bovine serum (FBS, Atlanta Biologicals,
More informationSupplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2.
Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2. Construct name ISG12b2 (No tag) HA-ISG12b2 (N-HA) ISG12b2-HA (C-HA; FL-HA) 94-283-HA (FL-GFP) 93-GFP
More informationTo generate the luciferase fusion to the human 3 UTRs, we sub-cloned the 3 UTR
Plasmids To generate the luciferase fusion to the human 3 UTRs, we sub-cloned the 3 UTR fragments downstream of firefly luciferase (luc) in pgl3 control (Promega). pgl3- CDK6 was made by amplifying a 2,886
More informationExperimental genetics - 2 Partha Roy
Partha Roy Experimental genetics - 2 Making genetically altered animal 1) Gene knock-out k from: a) the entire animal b) selected cell-type/ tissue c) selected cell-type/tissue at certain time 2) Transgenic
More informationAt E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in
Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm
More informationFig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector.
Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector. (a) Western blotting analysis and (b) qpcr analysis of eif6 expression in HEK293 T cells transfected with either
More informationTOOLS sirna and mirna. User guide
TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)
More informationSupporting Information
Supporting Information SI Materials and Methods RT-qPCR The 25 µl qrt-pcr reaction mixture included 1 µl of cdna or DNA, 12.5 µl of 2X SYBER Green Master Mix (Applied Biosystems ), 5 µm of primers and
More informationTable I. Primers used in quantitative real-time PCR for detecting gene expressions in mouse liver tissues
Table I. Primers used in quantitative real-time PCR for detecting gene expressions in mouse liver tissues Gene name Forward primer 5' to 3' Gene name Reverse primer 5' to 3' CC_F TGCCCTGTTGGGGTTG CC_R
More informationLong-term, efficient inhibition of microrna function in mice using raav vectors
Nature Methods Long-term, efficient inhibition of microrna function in mice using raav vectors Jun Xie, Stefan L Ameres, Randall Friedline, Jui-Hung Hung, Yu Zhang, Qing Xie, Li Zhong, Qin Su, Ran He,
More informationLullaby sirna Transfection Reagent - Results
sirna Transfection Reagent - Results OZ Biosciences is delighted to announce the launching of a new sirna transfection reagent: -sirna. This lipid based transfection reagent is specifically designed for
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1137999/dc1 Supporting Online Material for Disrupting the Pairing Between let-7 and Enhances Oncogenic Transformation Christine Mayr, Michael T. Hemann, David P. Bartel*
More informationGeneration of App knock-in mice reveals deletion mutations protective against Alzheimer s. disease-like pathology. Nagata et al.
Generation of App knock-in mice reveals deletion mutations protective against Alzheimer s disease-like pathology Nagata et al. Supplementary Fig 1. Previous App knock-in model did not show Aβ accumulation
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation
More informationDocument S1. Supplemental Experimental Procedures and Three Figures (see next page)
Supplemental Data Document S1. Supplemental Experimental Procedures and Three Figures (see next page) Table S1. List of Candidate Genes Identified from the Screen. Candidate genes, corresponding dsrnas
More informationsirna Transfection Into Primary Neurons Using Fuse-It-siRNA
sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative
More informationA revolution in PCR analysis!
A revolution in PCR analysis! Fast, convenient qualitative and quantitative PCR analysis Detect amplicon in seconds Generate accurate quantitative gene expression data Eliminate post-pcr processing Minimize
More informationSUPPLEMENTAL FIGURES AND TABLES
SUPPLEMENTAL FIGURES AND TABLES A B Flag-ALDH1A1 IP: α-ac HEK293T WT 91R 128R 252Q 367R 41/ 419R 435R 495R 412R C Flag-ALDH1A1 NAM IP: HEK293T + + - + D NAM - + + E Relative ALDH1A1 activity 1..8.6.4.2
More informationOmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells
OmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells OmicsLink shrna clone collections consist of lentiviral, and other mammalian expression vector based small hairpin RNA (shrna)
More informationEPIGENTEK. EpiQuik Tissue Chromatin Immunoprecipitation Kit. Base Catalog # P-2003 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Tissue Chromatin Immunoprecipitation Kit Base Catalog # P-2003 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Tissue Chromatin Immunoprecipitation Kit is suitable for combining the specificity
More informationSupporting Information
Supporting Information Liu et al. 10.1073/pnas.0901216106 SI Materials and Methods Reagents. Thioglycolate and LPS from Escherichia coli 0111:B4 were from Sigma-Aldrich. PAM3CSK4 and poly(i:c) were from
More informationTranslation of HTT mrna with expanded CAG repeats is regulated by
Supplementary Information Translation of HTT mrna with expanded CAG repeats is regulated by the MID1-PP2A protein complex Sybille Krauß 1,*, Nadine Griesche 1, Ewa Jastrzebska 2,3, Changwei Chen 4, Désiree
More informationHCT116 SW48 Nutlin: p53
Figure S HCT6 SW8 Nutlin: - + - + p GAPDH Figure S. Nutlin- treatment induces p protein. HCT6 and SW8 cells were left untreated or treated for 8 hr with Nutlin- ( µm) to up-regulate p. Whole cell lysates
More informationGalina Gabriely, Ph.D. BWH/HMS
Galina Gabriely, Ph.D. BWH/HMS Email: ggabriely@rics.bwh.harvard.edu Outline: microrna overview microrna expression analysis microrna functional analysis microrna (mirna) Characteristics mirnas discovered
More informationLegend for Supplemental Figures and Tables
Legend for Supplemental Figures and Tables Supplemental Fig. 1. Negative regulation of the CYP27B1 promoter in a ligand-dependent manner (A) OK-P cells were transfected with pcdna-trα, pcdna-trβ1 or pcdna3
More informationSUPPLEMENTARY INFORMATION
doi:.38/nature899 Supplementary Figure Suzuki et al. a c p7 -/- / WT ratio (+)/(-) p7 -/- / WT ratio Log X 3. Fold change by treatment ( (+)/(-)) Log X.5 3-3. -. b Fold change by treatment ( (+)/(-)) 8
More informationMir-X mirna First-Strand Synthesis and SYBR qrt-pcr
User Manual Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,
More informationTable S1. Primers used in the study
Table S1. Primers used in the study Primer name Application Sequence I1F16 Genotyping GGCAAGTGAGTGAGTGCCTA I1R11 Genotyping CCCACTCGTATTGACGCTCT V19 Genotyping GGGTCTCAAAGTCAGGGTCA D18Mit184-F Genotyping
More informationGFP CCD2 GFP IP:GFP
D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant
More informationSupplemental Table 1: Sequences of real time PCR primers. Primers were intronspanning
Symbol Accession Number Sense-primer (5-3 ) Antisense-primer (5-3 ) T a C ACTB NM_001101.3 CCAGAGGCGTACAGGGATAG CCAACCGCGAGAAGATGA 57 HSD3B2 NM_000198.3 CTTGGACAAGGCCTTCAGAC TCAAGTACAGTCAGCTTGGTCCT 60
More informationSUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION
SUPPLEMENTAL MATERIALS SIRTUIN PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF ACTIVATION Haranatha R. Potteti*, Subbiah Rajasekaran*, Senthilkumar B. Rajamohan*, Chandramohan R. Tamatam,
More informationSupplementary Figure 1. GST pull-down analysis of the interaction of GST-cIAP1 (A, B), GSTcIAP1
Legends Supplementary Figure 1. GST pull-down analysis of the interaction of GST- (A, B), GST mutants (B) or GST- (C) with indicated proteins. A, B, Cell lysate from untransfected HeLa cells were loaded
More informationSupplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency.
Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. (a) Transfection of different concentration of GAS5-overexpressing
More informationSUPPLEMENTARY INFORMATION
6 Relative levels of ma3 RNA 5 4 3 2 1 LN MG SG PG Spl Thy ma3 ß actin Lymph node Mammary gland Prostate gland Salivary gland Spleen Thymus MMTV target tissues Fig. S1: MMTV target tissues express ma3.
More information3 UTR (untranslated region) Reporter Clone and its vector, pmirtarget. Application Guide. OriGene Technologies, Inc
3 UTR (untranslated region) Reporter Clone and its vector, pmirtarget Application Guide OriGene Technologies, Inc Package Contents and Storage Conditions 3 UTR reporter clone as 10ug lyophilized plasmid
More informationSupplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2
Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 female) or wild-type (5 months old, 1 male; 11 months old,
More informationSupplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing
Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing Chase L. Beisel, Yvonne Y. Chen, Stephanie J. Culler, Kevin G. Hoff, & Christina
More informationEPIGENTEK. EpiQuik Chromatin Immunoprecipitation Kit. Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Chromatin Immunoprecipitation Kit Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Chromatin Immunoprecipitation Kit is suitable for combining the specificity of
More informationComparative Analysis of Argonaute-Dependent Small RNA Pathways in Drosophila
Molecular Cell, Volume 32 Supplemental Data Comparative Analysis of Argonaute-Dependent Small RNA Pathways in Drosophila Rui Zhou, Ikuko Hotta, Ahmet M. Denli, Pengyu Hong, Norbert Perrimon, and Gregory
More informationSupplementary Figure 1. Reintroduction of HDAC1 in HDAC1-/- ES cells reverts the
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Reintroduction of HDAC1 in HDAC1-/- ES cells reverts the phenotype of HDAC1-/- teratomas. 3x10 6 HDAC1 reintroduced (HDAC1-/-re) and empty vector infected
More informationHairpin-it TM mirnas qpcr Quantitation Kit
Hairpin-it TM mirnas qpcr Quantitation Kit For the detection and quantification of micrornas using real-time PCR detection instruments. Catalog No. QPM-010/ QPM-011/ QPM-012/ QPM-013 User Manual Table
More informationSupplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.
Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Target Gene Non-target / Control BTG2 BRCA1 NFE2L2 Target Sequence ON-TARGET plus Non-targeting sirna # 1 (Cat# D-001810-01-05) sirna1: GAACCGACAUGCUCCCGGA
More informationSupplementary Data. Supplementary Materials and Methods Quantification of delivered sirnas. Fluorescence microscopy analysis
Supplementary Data Supplementary Materials and Methods Quantification of delivered sirnas After transfection, cells were washed in three times with phosphate buffered saline and total RNA was extracted
More informationMutagenesis and generation of expression vectors Gene expression profiling Lentiviral production and infection of TF1 cells
Mutagenesis and generation of expression vectors Human c-kit wild-type cdna encoding the short c-kit isoform was excised from vector pbshkitwt (kind gift from Dr. L Gros, France) by Sal I-Acc65 I digestion.
More informationRegulation of axonal and dendritic growth by the extracellular calcium-sensing
Regulation of axonal and dendritic growth by the extracellular calcium-sensing receptor (CaSR). Thomas N. Vizard, Gerard W. O Keeffe, Humberto Gutierrez, Claudine H. Kos, Daniela Riccardi, Alun M. Davies
More informationSupplemental Material Igreja and Izaurralde 1. CUP promotes deadenylation and inhibits decapping of mrna targets. Catia Igreja and Elisa Izaurralde
Supplemental Material Igreja and Izaurralde 1 CUP promotes deadenylation and inhibits decapping of mrna targets Catia Igreja and Elisa Izaurralde Supplemental Materials and methods Functional assays and
More informationSchematic representation of the endogenous PALB2 locus and gene-disruption constructs
Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying
More informationBmDCs were generated as described by a modified protocol of Inaba et al S1. Briefly, bone
Generation and culture of bone marrow-derived dendritic cells (bmdcs) BmDCs were generated as described by a modified protocol of Inaba et al S1. Briefly, bone marrow cells from murine tibias and femurs
More informationshrna expression Cloning Kit
shrna expression Cloning Kit User Manual for making lentiviral and non-lentiviral shrna expression clones Cat# Product Name Amount Application LTSH-GB LTSH-GP LTSH-RB LTSH-RP SH-GB peco-lenti-h1-shrna-
More informationFigure S1. Transformed human epithelial cells showed up-regulated p63 but down-regulated p53. (a) Heavy particle radiation promotes human bronchial
Figure S1. Transformed human epithelial cells showed up-regulated p63 but down-regulated p53. (a) Heavy particle radiation promotes human bronchial cell transformation. The immortalized cells without IR
More informationUser Manual. Version 5. Published February Catalog No. K1021 ~
GeneFishing TM DEG Premix Kit User Manual Version 5 Published February 2005 Catalog No. K1021 ~ 1026 Table of Contents 1. Notices to Customers 1.1 Product Warranty and Liability------------------------------------
More informationhours after food deprivation hours after food deprivation
Figure S.6 protein (fasted / control).2.8.4 p47 p97 Rpt Ufd 3 24 48 hours after food deprivation mrn (fasted / control) C mrn (denervated / control) 2.5 2.5.5 3.5 3 2.5 2.5.5 p97 ** Npl4 Ufd p47 2 3 4
More informationSupplementary Figure 1. Nur77 and leptin-controlled obesity. (A) (B) (C)
Supplementary Figure 1. Nur77 and leptin-controlled obesity. (A) Effect of leptin on body weight and food intake between WT and KO mice at the age of 12 weeks (n=7). Mice were i.c.v. injected with saline
More informationSupplementary Figure 1 A
Supplementary Figure A B M. mullata p53, 3 UTR Luciferase activity (%) mir-5b 8 Le et al. Supplementary Information NC-DP - + - - - - - NC-DP - - + - - - - NC-DP3 - - - + - - - 5b-DP - - - - + + + NC-AS
More informationT1: Pure spongia-13(16),14-dien-19-oic acid (T1) (514 mg) was obtained from a Spongia sp.
Supplementary Materials and Methods Synthesis of spongian diterpenoids T1: Pure spongia-13(16),14-dien-19-oic acid (T1) (514 mg) was obtained from a Spongia sp. (sample # 47612) as follows. 45 g dry weight
More informationSupporting Information
Supporting Information Ho et al. 10.1073/pnas.0808899106 SI Materials and Methods In immunostaining, antibodies from Developmental Studies Hybridoma ank were -FasII (mouse, 1:200), - (mouse, 1:100), and
More informationSite-Directed Mutagenesis. Mutations in four Smad4 sites of mouse Gat1 promoter
Supplement Supporting Materials and Methods Site-Directed Mutagenesis. Mutations in four Smad4 sites of mouse Gat1 promoter were independently generated using a two-step PCR method. The Smad4 binding site
More informationSupplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators.
Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators. (a) A graphic depiction of the approach to determining the stability of
More informationRegulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132
Neuron, Volume 65 Regulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132 Dieter Edbauer, Joel R. Neilson, Kelly A. Foster, Chi-Fong Wang, Daniel P. Seeburg, Matthew
More informationSupporting Information
Supporting Information Pichiorri et al. 10.1073/pnas.0806202105 SI Methods Cell Collection and Total RNA Purification. Samples included PCs from 16 newly diagnosed cases of MM, 6 patients with MGUS, and
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationSupplemental material
Supplemental material THE JOURNAL OF CELL BIOLOGY Taylor et al., http://www.jcb.org/cgi/content/full/jcb.201403021/dc1 Figure S1. Representative images of Cav 1a -YFP mutants with and without LMB treatment.
More informationSupplementary Figure 1. TSA (10 nmol/l), non-class-selective HDAC inhibitor, potentiates
Supplementary Figure 1. TSA (10 nmol/l), non-class-selective HDAC inhibitor, potentiates vascular calcification (VC). (a) Von Kossa staining shows that TSA potentiated the Pi-induced VC. Scale bar, 100
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1154040/dc1 Supporting Online Material for Selective Blockade of MicroRNA Processing by Lin-28 Srinivas R. Viswanathan, George Q. Daley,* Richard I. Gregory* *To whom
More informationRNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the
Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the
More informationGene Forward (5 to 3 ) Reverse (5 to 3 ) Accession # PKA C- TCTGAGGAAATGGGAGAACC CGAGGGTTTTCTTCCTCTCAA NM_011100
Supplementary Methods: Materials. BRL37344, insulin, 3-isobutyl-1-methylxanthine, dibutyryl camp (Bt2-cAMP) and 8-Bromoadenosine 3,5 -cyclic monophosphate sodium (8-br-cAMP), cilostamide, adenosine deaminase,
More informationMammosphere formation assay. Mammosphere culture was performed as previously described (13,
Supplemental Text Materials and Methods Mammosphere formation assay. Mammosphere culture was performed as previously described (13, 17). For co-culture with fibroblasts and treatment with CM or CCL2, fibroblasts
More informationSupplemental Information
Supplemental Information Intrinsic protein-protein interaction mediated and chaperonin assisted sequential assembly of a stable Bardet Biedl syndome protein complex, the BBSome * Qihong Zhang 1#, Dahai
More informationSupplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated
Supplementary Figure Legends Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated with either vehicle (left; n=3) or CCl 4 (right; n=3) were co-immunostained for NRP-1 (green)
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More informationmmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230
mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR
More informationRegulation of transcription by the MLL2 complex and MLL complex-associated AKAP95
Supplementary Information Regulation of transcription by the complex and MLL complex-associated Hao Jiang, Xiangdong Lu, Miho Shimada, Yali Dou, Zhanyun Tang, and Robert G. Roeder Input HeLa NE IP lot:
More informationEPIGENTEK. EpiQuik Methylated DNA Immunoprecipitation Kit. Base Catalog # P-2019 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Methylated DNA Immunoprecipitation Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik MeDIP Kit can be used for immunoprecipitating the methylated DNA from a broad range
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/428/ra5/1 Supplementary Materials for ameliorates liver steatosis by decreasing stearoyloa desaturase 1 (S1) abundance and altering hepatic lipid metabolism
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10810 Supplementary Fig. 1: Mutation of the loqs gene leads to shortened lifespan and adult-onset brain degeneration. a. Northern blot of control and loqs f00791 mutant flies. loqs f00791
More informationDescription of Supplementary Files. File name: Supplementary Information Description: Supplementary figures and supplementary tables.
Description of Supplementary Files File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Supplementary Data 1 Description: Differential expression
More informationSupplementary Information
Supplementary Information MLL histone methylases regulate expression of HDLR- in presence of estrogen and control plasma cholesterol in vivo Khairul I. Ansari 1, Sahba Kasiri 1, Imran Hussain 1, Samara
More informationSupplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
More informationSelected Techniques Part I
1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative
More informationTherapeutic & Prevention Application of Nucleic Acids
Therapeutic & Prevention Application of Nucleic Acids Seyed Amir Hossein Jalali Institute of Biotechnology and Bioengineering, Isfahan University Of Technology (IUT). 30.7.2015 * Plasmids * DNA Aptamers
More informationThermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles
Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles Long-term gene silencing shrna-specific design algorithm High titer, purified particles Thermo Scientific Dharmacon SMARTvector shrna
More informationSupplemental Table/Figure Legends
MiR-26a is required for skeletal muscle differentiation and regeneration in mice Bijan K. Dey, Jeffrey Gagan, Zhen Yan #, Anindya Dutta Supplemental Table/Figure Legends Suppl. Table 1: Effect of overexpression
More information