Microarray Technique. Some background. M. Nath
|
|
- Janice Woods
- 6 years ago
- Views:
Transcription
1 Microarray Technique Some background M. Nath
2 Outline Introduction Spotting Array Technique GeneChip Technique Data analysis Applications Conclusion
3 Now
4 Blind Guess?
5 Functional Pathway
6 Microarray Technique
7 Principle Comprehensive functional analysis of genome Simultaneous analysis of patterns of gene expression Genome > Transcriptome > Proteome
8 Types of Microarray cdna Array (Brown et. al., 1995) Genomic DNA Array (DeRisi et. al., 1997) Oligonucleotide Array (Morton et. al., 1998)
9 Spotted Array Technology
10 Library Spotted Array Technology
11 Printing Slides Spotted Array Technology An array of slides is printed Slides can be glass or nylon
12 Spotted Array Technology
13 Hybridisation of Slides Spotted Array Technology Slide developer Up to 48 slides are developed under uniform conditions
14 Scanning Spotted Array Technology Confocal laser scanner is used Two different lasers to read Red and Green dye intensities A Graphic image is saved Laser Scanner Imaging software reads Red & Green intensity for each dot applied
15 Results Spotted Array Technology Green = Active in Sample 1 Red = Active in Sample 2 Yellow = Active in both samples Black = Active in neither
16 Affymetrix chip GeneChip Technology Oligos of 25 nt long 40 oligos for detection of each gene oligos as Perfect Match (PM) oligos as Mismatch (MM) at position 13
17 GeneChip Technology
18 GeneChip Technology
19 Spotted Array Technology Features Routine Starting material Probes pair per gene No. of genes / array µg total RNA
20 Spotted Array Technology Laborious Inexpensive Moderate specificity Moderate representation Low Density Cannot detect polymorphism
21 GeneChip Technology Features Starting material Detection specificity Discrimination of related genes Probes pair per gene No. of genes / array Routine 5 µg total RNA 1: % identity Limit 2 ng total RNA 1: % identity
22 GeneChip Technology Easy Expensive High specificity High representation High density Can detect polymorphism
23 Data Analysis
24 Gene intensity Chip 2 Scaling Data Analysis Linearity Gene intensity Chip 1
25 Gene intensity Chip 2 Scaling Data Analysis Linear and non-linear models Constitutively and constantly expressed Maintenance gene More genes on chip Gene intensity Chip 1
26 Outlier Data Analysis Two chips may differ in expression for same gene If one replicate deviates several standard deviation from mean, remove it
27 Data Analysis Absolute measurements AvgDiff Σ ( PM n MM n ) / N Weighted AvgDiff Σ ( PM n MM n ) φ n / N
28 Fold Change Data Analysis Log 2 of ratio of intensities after being corrected for background E.g. Log 2 (Sample / Control) = Log 2 (Red / Green) =1 : unchanged; >1 : upregulated; <1 : downregulated Affymetrix chip (AffyFold) (Sample - Control) / Min (Sample, Control)
29 Test of significance Significance Test t-test with unequal variance ANOVA and F test REML Data Analysis Non-parametric tests Wilcoxon test Mann-Whitney rank sum test Correction for multiple testing Bonferroni correction
30 Cluster Analysis Data Analysis Single array not suitable Functional analysis Co-regulation New gene discovery Samples collected temporally, spatially Multiple array & Cluster analysis Clustering of similarly behaving genes Genes with similar functions generally cluster together
31 Cluster Analysis Data Analysis Cluster analysis Hierarchical clustering K-means clustering Self Organising Maps Distance measures
32 Beyond Clustering Data Analysis Discovery of regulatory elements in promoter region Identifying regulatory networks Time series approach Steady-state approach Neural network technique Selection of genes Gene finding Selection of regions within the genes Selection of PCR primers Selection of unique oligomer probes
33 Software Package Data Analysis Affymetrix Data Mining Tool Affymetrix NetAffx Biomax Gene Expression Analysis Suite GeneData Expressionist Informax Xpression Invitrogen Corp. ResGen Pathways Rosetta Resolver Gene Expression System Silicon Genetics GeneSpring Spotfire
34 Applications Analysis of patterns of gene expression Functional relationship between genes Expression in coregulatory gene group Monitoring changes in genomic DNA Cellular pathways affected by mutation Changes in expression profiles of mutants
35 Applications Simultaneous detection of many genes Gene discovery Pathway analysis Molecular basis of disease progression
36 Applications Molecular signatures of pathogens Comparative genomic studies of pathogens Virulence difference Pathogen genetics and manifestation Life cycle Replication, translational control
37 Applications Host-parasite interaction Pathogen establishment Host cell recognition Host cell response Parasite response to host immune response
38 Applications
39 Constraints Complex system of eukaryotes & multicellular organisms Transcriptome analysis Developing technology Many stages Design of experiment
40 Constraints Array quality Highly variable data Analysis of data Published experiments Cost
41 From Here to Tomorrow Recent & Powerful More improvement Protocol Hardware Experimental design Computational technique Integrate with other data Reproducible, fast, sensitive & economic
42
EECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and
More informationCOS 597c: Topics in Computational Molecular Biology. DNA arrays. Background
COS 597c: Topics in Computational Molecular Biology Lecture 19a: December 1, 1999 Lecturer: Robert Phillips Scribe: Robert Osada DNA arrays Before exploring the details of DNA chips, let s take a step
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationGene expression. What is gene expression?
Gene expression What is gene expression? Methods for measuring a single gene. Northern Blots Reporter genes Quantitative RT-PCR Operons, regulons, and stimulons. DNA microarrays. Expression profiling Identifying
More informationGene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis
Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods
More informationMicroarray Experiment Design
Microarray Experiment Design Samples used, extract preparation and labelling: AML blasts were isolated from bone marrow by centrifugation on a Ficoll- Hypaque gradient. Total RNA was extracted using TRIzol
More informationExploration and Analysis of DNA Microarray Data
Exploration and Analysis of DNA Microarray Data Dhammika Amaratunga Senior Research Fellow in Nonclinical Biostatistics Johnson & Johnson Pharmaceutical Research & Development Javier Cabrera Associate
More informationExpressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes
Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Genes can be regulated at many levels Usually, gene regulation, are referring to transcriptional
More informationMotivation From Protein to Gene
MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein
More informationIntroduction to Bioinformatics and Gene Expression Technology
Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA
More informationNormalization. Getting the numbers comparable. DNA Microarray Bioinformatics - #27612
Normalization Getting the numbers comparable The DNA Array Analysis Pipeline Question Experimental Design Array design Probe design Sample Preparation Hybridization Buy Chip/Array Image analysis Expression
More informationComputational Biology I
Computational Biology I Microarray data acquisition Gene clustering Practical Microarray Data Acquisition H. Yang From Sample to Target cdna Sample Centrifugation (Buffer) Cell pellets lyse cells (TRIzol)
More informationMicroarray Informatics
Microarray Informatics Donald Dunbar MSc Seminar 4 th February 2009 Aims To give a biologistʼs view of microarray experiments To explain the technologies involved To describe typical microarray experiments
More informationRafael A Irizarry, Department of Biostatistics JHU
Getting Usable Data from Microarrays it s not as easy as you think Rafael A Irizarry, Department of Biostatistics JHU rafa@jhu.edu http://www.biostat.jhsph.edu/~ririzarr http://www.bioconductor.org Acknowledgements
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationMicroarray Informatics
Microarray Informatics Donald Dunbar MSc Seminar 31 st January 2007 Aims To give a biologist s view of microarray experiments To explain the technologies involved To describe typical microarray experiments
More information2000/2001 ABRF MICROARRAY RESEARCH GROUP STUDY: A CURRENT PROFILE OF MICROARRAY LABORATORIES
2000/2001 ABRF MICROARRAY RESEARCH GROUP STUDY: A CURRENT PROFILE OF MICROARRAY LABORATORIES by George Grills 1, Chandi Griffin 2, Aldo Massimi 1, Kathryn Lilley 3, Kevin Knudtson 4, and James VanEe 5
More informationDNA Microarray Technology
2 DNA Microarray Technology 2.1 Overview DNA microarrays are assays for quantifying the types and amounts of mrna transcripts present in a collection of cells. The number of mrna molecules derived from
More informationBiology 644: Bioinformatics
Measure of the linear correlation (dependence) between two variables X and Y Takes a value between +1 and 1 inclusive 1 = total positive correlation 0 = no correlation 1 = total negative correlation. When
More informationDNA Microarrays and Clustering of Gene Expression Data
DNA Microarrays and Clustering of Gene Expression Data Martha L. Bulyk mlbulyk@receptor.med.harvard.edu Biophysics 205 Spring term 2008 Traditional Method: Northern Blot RNA population on filter (gel);
More informationGene Expression Data Analysis
Gene Expression Data Analysis Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu BMIF 310, Fall 2009 Gene expression technologies (summary) Hybridization-based
More informationThe essentials of microarray data analysis
The essentials of microarray data analysis (from a complete novice) Thanks to Rafael Irizarry for the slides! Outline Experimental design Take logs! Pre-processing: affy chips and 2-color arrays Clustering
More informationMoc/Bio and Nano/Micro Lee and Stowell
Moc/Bio and Nano/Micro Lee and Stowell Moc/Bio-Lecture GeneChips Reading material http://www.gene-chips.com/ http://trueforce.com/lab_automation/dna_microa rrays_industry.htm http://www.affymetrix.com/technology/index.affx
More informationBioinformatics: Microarray Technology. Assc.Prof. Chuchart Areejitranusorn AMS. KKU.
Introduction to Bioinformatics: Microarray Technology Assc.Prof. Chuchart Areejitranusorn AMS. KKU. ความจร งเก ยวก บ ความจรงเกยวกบ Cell and DNA Cell Nucleus Chromosome Protein Gene (mrna), single strand
More informationRecent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationMICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE
MICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE National Center for Biotechnology Information With only a few exceptions, every
More informationMicroarray Data Analysis Workshop. Preprocessing and normalization A trailer show of the rest of the microarray world.
Microarray Data Analysis Workshop MedVetNet Workshop, DTU 2008 Preprocessing and normalization A trailer show of the rest of the microarray world Carsten Friis Media glna tnra GlnA TnrA C2 glnr C3 C5 C6
More informationGene expression profiling experiments:
Gene expression profiling experiments: Problems, pitfalls, and solutions. Heli Borg The Alternatives in Microarray Experiments bacteria - eucaryots non poly(a) + - poly(a) + oligonucleotide Affymetrix
More informationMicroarray. Key components Array Probes Detection system. Normalisation. Data-analysis - ratio generation
Microarray Key components Array Probes Detection system Normalisation Data-analysis - ratio generation MICROARRAY Measures Gene Expression Global - Genome wide scale Why Measure Gene Expression? What information
More informationIntroduction to DNA microarrays. DTU - January Hanne Jarmer
Introduction to DNA microarrays DTU - January 2007 - Hanne Jarmer Microarrays - The Concept Measure the level of transcript from a very large number of genes in one go Microarrays - The Concept Measure
More informationIntroduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationFACTORS CONTRIBUTING TO VARIABILITY IN DNA MICROARRAY RESULTS: THE ABRF MICROARRAY RESEARCH GROUP 2002 STUDY
FACTORS CONTRIBUTING TO VARIABILITY IN DNA MICROARRAY RESULTS: THE ABRF MICROARRAY RESEARCH GROUP 2002 STUDY K. L. Knudtson 1, C. Griffin 2, A. I. Brooks 3, D. A. Iacobas 4, K. Johnson 5, G. Khitrov 6,
More informationAnalysis of Cancer Gene Expression Profiling in DNA Microarray Data using Clustering Technique
Analysis of Cancer Gene Expression Profiling in DNA Microarray Data using Clustering Technique 1 C. Premalatha, 2 D. Devikanniga 1, 2 Assistant Professor, Department of Information Technology Sri Ramakrishna
More informationDeoxyribonucleic Acid DNA
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationCAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1
CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing
More informationUsing Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application
Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Gene Expression Author Michelle M. Chen Agilent Technologies, Inc. 3500 Deer Creek Road, MS 25U-7 Palo Alto,
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Vocabulary Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 Gene: Genetics: Genome: Genomics: hereditary
More informationBioinformatics and Genomics: A New SP Frontier?
Bioinformatics and Genomics: A New SP Frontier? A. O. Hero University of Michigan - Ann Arbor http://www.eecs.umich.edu/ hero Collaborators: G. Fleury, ESE - Paris S. Yoshida, A. Swaroop UM - Ann Arbor
More informationMeasuring gene expression (Microarrays) Ulf Leser
Measuring gene expression (Microarrays) Ulf Leser This Lecture Gene expression Microarrays Idea Technologies Problems Quality control Normalization Analysis next week! 2 http://learn.genetics.utah.edu/content/molecules/transcribe/
More informationClones. Glass Slide PCR. Purification. Array Printing. Post-process. Hybridize. Scan. Array Fabrication. Sample Preparation/Hybridization.
Terminologies Reporter: the nucleotide sequence present in a particular location on the array (a.k.a. probe) Feature: the location of a reporter on the array Composite sequence: a set of reporters used
More informationIntroduction to Bioinformatics. Fabian Hoti 6.10.
Introduction to Bioinformatics Fabian Hoti 6.10. Analysis of Microarray Data Introduction Different types of microarrays Experiment Design Data Normalization Feature selection/extraction Clustering Introduction
More informationMeasuring and Understanding Gene Expression
Measuring and Understanding Gene Expression Dr. Lars Eijssen Dept. Of Bioinformatics BiGCaT Sciences programme 2014 Why are genes interesting? TRANSCRIPTION Genome Genomics Transcriptome Transcriptomics
More informationINTRODUCTION. The Technology of Microarrays January Hanne Jarmer
INTRODUCTION The Technology of Microarrays January 2009 - Hanne Jarmer The Concept gene mrna gene specific DNA probes labeled target Spotted arrays High-density arrays 13-16 micron features ~60 micron
More informationThis place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.
G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic
More informationSGN-6106 Computational Systems Biology I
SGN-6106 Computational Systems Biology I A View of Modern Measurement Systems in Cell Biology Kaisa-Leena Taattola 21.2.2007 1 The cell a complex system (Source: Lehninger Principles of Biochemistry 4th
More informationA Current Profile of Microarray Laboratories: the ABRF Microarray Research Group Survey of Laboratories Using Microarray Technologies
A Current Prile Microarray Laboratories: the 2002-2003 2003 ABRF Microarray Research Group Survey Laboratories Using Microarray Technologies K.L. Knudtson 1, C. Griffin 2, D.A. Iacobas 3, K. Johnson 4,
More informationExam 1 from a Past Semester
Exam from a Past Semester. Provide a brief answer to each of the following questions. a) What do perfect match and mismatch mean in the context of Affymetrix GeneChip technology? Be as specific as possible
More informationOutline. Array platform considerations: Comparison between the technologies available in microarrays
Microarray overview Outline Array platform considerations: Comparison between the technologies available in microarrays Differences in array fabrication Differences in array organization Applications of
More informationThe Agilent Total RNA Isolation Kit
Better RNA purity. Better data. Without DNase treatment. The Agilent Total RNA Isolation Kit Now you can isolate highly purified, intact RNA without DNase treatment Introducing the Agilent Total RNA Isolation
More informationIntroduction to Microarray Technique, Data Analysis, Databases Maryam Abedi PhD student of Medical Genetics
Introduction to Microarray Technique, Data Analysis, Databases Maryam Abedi PhD student of Medical Genetics abedi777@ymail.com Outlines Technology Basic concepts Data analysis Printed Microarrays In Situ-Synthesized
More informationIdentification of biological themes in microarray data from a mouse heart development time series using GeneSifter
Identification of biological themes in microarray data from a mouse heart development time series using GeneSifter VizX Labs, LLC Seattle, WA 98119 Abstract Oligonucleotide microarrays were used to study
More informationDNA Microarray Technology
CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic
More informationadvanced analysis of gene expression microarray data aidong zhang World Scientific State University of New York at Buffalo, USA
advanced analysis of gene expression microarray data aidong zhang State University of New York at Buffalo, USA World Scientific NEW JERSEY LONDON SINGAPORE BEIJING SHANGHAI HONG KONG TAIPEI CHENNAI Contents
More informationOptimizing crna fragmentation for microarray experiments using the Agilent 2100 bioanalyzer. Application Deborah Vitale.
Optimizing crna fragmentation for microarray experiments using the Agilent 2100 bioanalyzer Application Deborah Vitale Introduction Oligonucleotide arrays are a powerful tool for gene expression studies.
More informationSeven Keys to Successful Microarray Data Analysis
Seven Keys to Successful Microarray Data Analysis Experiment Design Platform Selection Data Management System Access Differential Expression Biological Significance Data Publication Type of experiment
More informationChapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
More informationSTATC 141 Spring 2005, April 5 th Lecture notes on Affymetrix arrays. Materials are from
STATC 141 Spring 2005, April 5 th Lecture notes on Affymetrix arrays Materials are from http://www.ohsu.edu/gmsr/amc/amc_technology.html The GeneChip high-density oligonucleotide arrays are fabricated
More informationExpression summarization
Expression Quantification: Affy Affymetrix Genechip is an oligonucleotide array consisting of a several perfect match (PM) and their corresponding mismatch (MM) probes that interrogate for a single gene.
More informationGene expression analysis: Introduction to microarrays
Gene expression analysis: Introduction to microarrays Adam Ameur The Linnaeus Centre for Bioinformatics, Uppsala University February 15, 2006 Overview Introduction Part I: How a microarray experiment is
More informationGene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays
Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays Application Note Authors Bahram Arezi, Nilanjan Guha and Anne Bergstrom Lucas Agilent Technologies Inc. Santa
More informationDNA Chip Technology Benedikt Brors Dept. Intelligent Bioinformatics Systems German Cancer Research Center
DNA Chip Technology Benedikt Brors Dept. Intelligent Bioinformatics Systems German Cancer Research Center Why DNA Chips? Functional genomics: get information about genes that is unavailable from sequence
More information3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
More informationIntroduction to biology and measurement of gene expression
Introduction to biology and measurement of gene expression Statistical analysis of gene expression data with R and Bioconductor University of Copenhagen, 17-21 August, 2009 Margaret Taub University of
More informationSoybean Microarrays. An Introduction. By Steve Clough. November Common Microarray platforms
Soybean Microarrays Microarray construction An Introduction By Steve Clough November 2005 Common Microarray platforms cdna: spotted collection of PCR products from different cdna clones, each representing
More informationGoals of pharmacogenomics
Goals of pharmacogenomics Use drugs better and use better drugs! People inherit/exhibit differences in drug: Absorption Metabolism and degradation of the drug Transport of drug to the target molecule Excretion
More informationMicroarray Data Analysis. Normalization
Microarray Data Analysis Normalization Outline General issues Normalization for two colour microarrays Normalization and other stuff for one color microarrays 2 Preprocessing: normalization The word normalization
More informationMicroarrays: since we use probes we obviously must know the sequences we are looking at!
These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression
More informationProbe-Level Data Normalisation: RMA and GC-RMA Sam Robson Images courtesy of Neil Ward, European Application Engineer, Agilent Technologies.
Probe-Level Data Normalisation: RMA and GC-RMA Sam Robson Images courtesy of Neil Ward, European Application Engineer, Agilent Technologies. References Summaries of Affymetrix Genechip Probe Level Data,
More informationGene expression: Microarray data analysis. Copyright notice. Outline: microarray data analysis. Schedule
Gene expression: Microarray data analysis Copyright notice Many of the images in this powerpoint presentation are from Bioinformatics and Functional Genomics by Jonathan Pevsner (ISBN -47-4-8). Copyright
More informationDNA/RNA MICROARRAYS NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT.
DNA/RNA MICROARRAYS This protocol is based on the EDVOTEK protocol DNA/RNA Microarrays. 10 groups of students NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT. 1. EXPERIMENT OBJECTIVE The objective of this
More informationIntroduction to microarrays
Bayesian modelling of gene expression data Alex Lewin Sylvia Richardson (IC Epidemiology) Tim Aitman (IC Microarray Centre) Philippe Broët (INSERM, Paris) In collaboration with Anne-Mette Hein, Natalia
More informationWu et al., Determination of genetic identity in therapeutic chimeric states. We used two approaches for identifying potentially suitable deletion loci
SUPPLEMENTARY METHODS AND DATA General strategy for identifying deletion loci We used two approaches for identifying potentially suitable deletion loci for PDP-FISH analysis. In the first approach, we
More informationIntro to Microarray Analysis. Courtesy of Professor Dan Nettleton Iowa State University (with some edits)
Intro to Microarray Analysis Courtesy of Professor Dan Nettleton Iowa State University (with some edits) Some Basic Biology Genes are DNA sequences that code for proteins. (e.g. gene lengths perhaps 1000
More informationImage Analysis. Based on Information from Terry Speed s Group, UC Berkeley. Lecture 3 Pre-Processing of Affymetrix Arrays. Affymetrix Terminology
Image Analysis Lecture 3 Pre-Processing of Affymetrix Arrays Stat 697K, CS 691K, Microbio 690K 2 Affymetrix Terminology Probe: an oligonucleotide of 25 base-pairs ( 25-mer ). Based on Information from
More informationSIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology.
SIMS2003 Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School Introduction to Microarray Technology. Lecture 1 I. EXPERIMENTAL DETAILS II. ARRAY CONSTRUCTION III. IMAGE ANALYSIS Lecture
More informationChapter 1. from genomics to proteomics Ⅱ
Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationCodeLink Human Whole Genome Bioarray
CodeLink Human Whole Genome Bioarray 55,000 human gene targets on a single bioarray The CodeLink Human Whole Genome Bioarray comprises one of the most comprehensive coverages of the human genome, as it
More informationAFFYMETRIX c Technology and Preprocessing Methods
Analysis of Genomic and Proteomic Data AFFYMETRIX c Technology and Preprocessing Methods bhaibeka@ulb.ac.be Université Libre de Bruxelles Institut Jules Bordet Table of Contents AFFYMETRIX c Technology
More informationWeb-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide.
Page 1 of 24 Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. When and Where---Wednesdays at 1pm-2pmRoom 438 Library Admin Building Beginning September
More informationFEATURE-LEVEL EXPLORATION OF THE CHOE ET AL. AFFYMETRIX GENECHIP CONTROL DATASET
Johns Hopkins University, Dept. of Biostatistics Working Papers 3-17-2006 FEATURE-LEVEL EXPLORATION OF THE CHOE ET AL. AFFYETRIX GENECHIP CONTROL DATASET Rafael A. Irizarry Johns Hopkins Bloomberg School
More informationPlease purchase PDFcamp Printer on to remove this watermark. DNA microarray
DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of
More informationMeasuring gene expression
Measuring gene expression Grundlagen der Bioinformatik SS2018 https://www.youtube.com/watch?v=v8gh404a3gg Agenda Organization Gene expression Background Technologies FISH Nanostring Microarrays RNA-seq
More information6. GENE EXPRESSION ANALYSIS MICROARRAYS
6. GENE EXPRESSION ANALYSIS MICROARRAYS BIOINFORMATICS COURSE MTAT.03.239 16.10.2013 GENE EXPRESSION ANALYSIS MICROARRAYS Slides adapted from Konstantin Tretyakov s 2011/2012 and Priit Adlers 2010/2011
More informationCS-E5870 High-Throughput Bioinformatics Microarray data analysis
CS-E5870 High-Throughput Bioinformatics Microarray data analysis Harri Lähdesmäki Department of Computer Science Aalto University September 20, 2016 Acknowledgement for J Salojärvi and E Czeizler for the
More informationIntroduction to Microarray Analysis
Introduction to Microarray Analysis Methods Course: Gene Expression Data Analysis -Day One Rainer Spang Microarrays Highly parallel measurement devices for gene expression levels 1. How does the microarray
More informationSome Principles for the Design and Analysis of Experiments using Gene Expression Arrays and Other High-Throughput Assay Methods
Some Principles for the Design and Analysis of Experiments using Gene Expression Arrays and Other High-Throughput Assay Methods EPP 245/298 Statistical Analysis of Laboratory Data October 11, 2005 1 The
More information3. Microarrays: experimental design, statistical analysis and gene clustering
WUEMED Drought Course 3. Microarrays: experimental design, statistical analysis and gene clustering John Bennett International Rice Research Institute Los Baños, Philippines 3.1: Experimental overview
More informationBi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8
Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically
More informationSTATISTICAL CHALLENGES IN GENE DISCOVERY
STATISTICAL CHALLENGES IN GENE DISCOVERY THROUGH MICROARRAY DATA ANALYSIS 1 Central Tuber Crops Research Institute,Kerala, India 2 Dept. of Statistics, St. Thomas College, Pala, Kerala, India email:sreejyothi
More informationWhat is a microarray
DNA Microarrays What is a microarray A surface on which sequences from thousands of different genes are covalently attached to fixed locations (probes). Glass slides Silicon chips Utilize the selective
More informationBackground Correction and Normalization. Lecture 3 Computational and Statistical Aspects of Microarray Analysis June 21, 2005 Bressanone, Italy
Background Correction and Normalization Lecture 3 Computational and Statistical Aspects of Microarray Analysis June 21, 2005 Bressanone, Italy Feature Level Data Outline Affymetrix GeneChip arrays Two
More informationHigh Performance Labeling Kits for cdna and Oligo Microarrays
Agilent in Life Sciences > Genomics > Proteomics > Drug Discovery > Development > QA/QC High Performance Labeling Kits for cdna and Oligo Microarrays Get more from one experiment Agilent has perfected
More informationExperimental Design for Gene Expression Microarray. Jing Yi 18 Nov, 2002
Experimental Design for Gene Expression Microarray Jing Yi 18 Nov, 2002 Human Genome Project The HGP continued emphasis is on obtaining by 2003 a complete and highly accurate reference sequence(1 error
More informationAgilent GeneSpring GX 10: Beyond. Pam Tangvoranuntakul Product Manager, GeneSpring October 1, 2008
Agilent GeneSpring GX 10: Gene Expression and Beyond Pam Tangvoranuntakul Product Manager, GeneSpring October 1, 2008 GeneSpring GX 10 in the News Our Goals for GeneSpring GX 10 Goal 1: Bring back GeneSpring
More informationOutline. Analysis of Microarray Data. Most important design question. General experimental issues
Outline Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization Introduction to microarrays Experimental design Data normalization Other data transformation Exercises George Bell,
More informationIntroduction to gene expression microarray data analysis
Introduction to gene expression microarray data analysis Outline Brief introduction: Technology and data. Statistical challenges in data analysis. Preprocessing data normalization and transformation. Useful
More informationScanned chip images were analyzed in two ways: levels and obtain Presence /Absence (P/A) calls for targeted genes. The metrics sheets
Supplementary Methods Microarray Data Analysis Scanned chip images were analyzed in two ways: 1. The Affymetrix Microarray Suite (MAS) 5.0 was used to quantitate expression levels and obtain Presence /Absence
More information