Recombinant DNA Technology

Size: px
Start display at page:

Download "Recombinant DNA Technology"

Transcription

1 History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists i named Boyer and Cohen in Recombinant DNA Formed when two genes from two different sources - often different species are combined in vitro into the same molecule This process is called genetic engineering g Lead to a new field called biotechnology, the manipulation of organisms or their components to make useful products Fig. 1.2 Many scientific disciplines contribute to molecular biotechnology, which generates a wide range of commercial products DNA cloning gene cloning - prepare multiple identical copies of gene-sized pieces of DNA. Generation of DNA fragment Joining into a vector or carrier molecule Introduction into host cell to amplification Selection of required sequences ١

2 Genes can be cloned into recombinant DNA vectors Generation of DNA fragment Mechanical shearing Restriction enzymatic digestion Joining into a vector Blunt end ligation Sticky end ligation Introduction into host cell Transformation with recombinant plasmid Five steps: Isolation of vector and gene Insert gene into vector Transform bacteria with vector Plate bacteria under selection Identify clones carrying vector Direct chemical synthesis PCR RT-PCR Homopolymer tailing Use of linker Ligase independent cloning Transfection with recombinant phage Packaging DNA in vitro Generation of DNA fragment Enzymatic digestion of purified DNA PCR RT-PCR Restriction enzymes are used to make recombinant DNA Cut DNA at specific DNA sequences symmetrical series of four to eight bases Sticky or blunt ends Restriction fragments-specific for each DNA Origin bacteria How do they protect their own DNA? Combined by DNA ligase Methods of Introducing Foreign DNA Transformation Electroporation Conjugation How can you identify which clones carry the vector? 1) Nucleic acid hybridization 2) Isolation of plasmid DNA from individual clones and restriction mapping PCR ٢

3 PCR: History PCR Invention: 1987 Kary Mullis PCR is essentially DNA replication in a tube. Series of repetitive steps enabling amplification of target DNA from a complex mixture of DNA The major advantages of PCR Speed and ease of use 30 cycles each taking 3-5 mins Sensitivity Can amplify from a single cell, great care must be taken to avoid contamination Robustness Will even work on degraded DNA or fixed DNA Disadvantages of PCR Need for Target DNA sequence information To construct primers you need to know your target Short size limit for product There is an upper limit to the size of DNA synthesized by PCR Infidelity of replication Because the PCR polymerases are heat stable they ten not to have the 3 ->5 exonuclease activity Target dntp s Buffer Primers DNA Taq polymerase Basics Denature C-95 0 C (94 0 C) Anneal-50 0 C-72 0 C Aim for 5 0 C below calculated Tm (52 0 C-58 0 C generally best) Extension C-80 0 C (72 0 C) highest efficiency 70 0 C-80 0 C Plasmid cdna (RT-PCR) Genomic DNA P C P C Plasmid Genomic Template Purified (P) Crude Lysate (C) 40ng 10ng 1ng ٣

4 dntps Mixture of datp, dctp, dgtp, dttp or dutp Purity- chemical or enzymatic synthesis Stability- concentration Li or Na salt form Buffer All 10x Buffers are not the same Salt mm Tris ph 8.3 Monovalent cation mm KCl or NaCl Divalent cation Mg2+, Mn2+ Additives 1.5uM or > MgCl 2+ Detergent, Glycerol, Gelatin Modifications: Mg ph Ionic strength Additives Buffer Systems Mg2+ Q-solution-Betaine DMSO BSA Glycerol Gelatin PEG GC-melt Formamide Detergents Buffer Additives Q D B G P Q/D F D Ionic strength Primers Pair complementary to opposite strands 5 3 sense primer 3 5 anti-sense primer Features nucleotides Match Tm of primers Equal mix GC to AT bases Tm o C= 2(A/T) + 4(G/C) 3 Stability GG or GC clamps Additional Considerations Secondary structure- avoid hairpins, self-dimers, cross- homology Avoid di-nucleotide repeats that occur consecutively- ATATATAT Avoid long runs of single bases- ACGGGGGGAT Avoid cross-homology homology- BLAST Test ۴

5 Primer Variation Example Forward primers Primer 1: GAGGGCAGATTCGGGAATG Primer 2: TCGGGAGAGGCCCTTCCC Primer 3: CAGTTTCCCGGGTTCGGC PCR 1 st Round vary primer pairs Sets A-F A= Primer 1F Primer 1R B= Primer 2F Primer 1R C= Primer 3F Primer 1R D= Primer 1F Primer 2R E= Primer 2F Primer 2R F= Primer 3F Primer 2R Tm=60 0 c Tm=62 0 c Tm=60 0 c DNA Taq Polymerases Considerations: Aim of experiment Thermal stability Processivity Fidelity Reverse primers Primer 1: AGCCTAATCAAGTCACTATCAAG Primer 2: GCAAGTGAGAAAATGGGGAG Tm=62 0 C Tm=60 0 C DNA Taq Polymerases Standard polymerase Standard polymerase with loading dye Hot Start polymerase Polymerase blends or cocktails works for most applications aids in higher through-put inhibits non-specific primer extension combine polymerases for fidelity with speed Fidelity PCR product sequence Taq blend Standard Taq Hot Start Taq PCR product T/A cloned Individual isolates sequenced PCR Cycling Modified PCR Methods Hot Start PCR Manual Hot Start Physical Barrier Modified dt Taq DNA polymerase Oligo Inhibitors Modified dntp s Semi-Nested or Nested PCR Touch down PCR ۵

6 Semi-Nested or Nested-PCR Specificity Sensitivity Additional PCR Methods Allele-specific PCR Assembly PCR (PCA) Breakpoint PCR Intersequence-specific specific PCR (ISSR) Inverse-PCR (IPCR or RE-PCR) Ligation Mediated PCR (LM-PCR) Long distance PCR Multiplex-PCR Methylation Specific PCR Mini-primer PCR Quantitative PCR or Real-time PCR Reverse Transcriptase PCR (RT-PCR) Quality of RNA Reverse Transcriptase-QC oligo dt random hexamers gene specific primers RT-PCR Multiplex-PCR Increase throughput Increase data with limited material Exon 7 and 8 Exon 9 Exon 3 Exon 5 Exon 1 Exon 2 Exon 6 Exon 4 Long-PCR Analyze large area in single reaction Tool to analyze inserts and breakpoints 14kb 3kb Breakpoint-PCR Isolate low frequency event 20kb 1.6kb ۶

7 Inverse-PCR and RE-Inverse PCR Isolate unknown flanking region Digest with restriction enzyme Ligate with T4 DNA ligase Restriction fragment length polymorphism Allele specific PCR Genomic Walking TaqMan assay Allele specific PCR using the 5 to 3 exo activity and a third primer with a Fluor and dquencher. Real-Time PCR or Q-PCR Increased Sensitivity Increased Specificity Increased Throughput ٧

8 Designing of primers PCR reaction Identification of restriction map: Primer Design Evaluation of primers specifity Introducing of restriction sites PCR cycle Cloning of PCR products transformation Plasmid digestion PCR product digestion Measurement of molar concentration of DNA th t /bi t / li ocalc.html Ligation transformation Heat shock electroporation ٨

9 Preparing medium Antibiotic selection Liquid culture Plasmid extraction ti Plasmid identity confirmation Sequencing subcloning Extraction of plasmid ٩

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY. !! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which

More information

Molecular Genetics II - Genetic Engineering Course (Supplementary notes)

Molecular Genetics II - Genetic Engineering Course (Supplementary notes) 1 von 12 21.02.2015 15:13 Molecular Genetics II - Genetic Engineering Course (Supplementary notes) Figures showing examples of cdna synthesis (currently 11 figures) cdna is a DNA copy synthesized from

More information

Recitation CHAPTER 9 DNA Technologies

Recitation CHAPTER 9 DNA Technologies Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

Computational Biology 2. Pawan Dhar BII

Computational Biology 2. Pawan Dhar BII Computational Biology 2 Pawan Dhar BII Lecture 1 Introduction to terms, techniques and concepts in molecular biology Molecular biology - a primer Human body has 100 trillion cells each containing 3 billion

More information

Genetics and Genomics in Medicine Chapter 3. Questions & Answers

Genetics and Genomics in Medicine Chapter 3. Questions & Answers Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical

More information

PCR KIT/REAGENTS/BUFFERS/PRIMERS

PCR KIT/REAGENTS/BUFFERS/PRIMERS PCR KIT/REAGENTS/BUFFERS/PRIMERS 114330 DNA Amplification Kit DNA amplification kit is suitable for amplification of DNA size about 100bp to 5kb. It can be also used to RAPD PCR. This kit contains all

More information

Polymerase Chain Reaction

Polymerase Chain Reaction Polymerase Chain Reaction = multiple rounds of in vitro DNA replication = a region of DNA lying between two regions of known sequence is amplified hundreds of millions of time within a matter of several

More information

Chapter 6 - Molecular Genetic Techniques

Chapter 6 - Molecular Genetic Techniques Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting

More information

Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design

Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design The Polymerase Chain Reaction (PCR) is a powerful technique used for the amplification of a specific segment of a nucleic acid

More information

PCR OPTIMIZATION AND TROUBLESHOOTING

PCR OPTIMIZATION AND TROUBLESHOOTING PCR OPTIMIZATION AND TROUBLESHOOTING Amplification of each DNA fragment can occur only under the defined conditions which are provided by a reaction mixture. If no positive PCR result can be obtained,

More information

Experiment (5): Polymerase Chain Reaction (PCR)

Experiment (5): Polymerase Chain Reaction (PCR) BCH361 [Practical] Experiment (5): Polymerase Chain Reaction (PCR) Aim: Amplification of a specific region on DNA. Primer design. Determine the parameters that may affect he specificity, fidelity and efficiency

More information

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau 7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial

More information

Associate Professor Chatchawan Srisawat MD. Ph.D

Associate Professor Chatchawan Srisawat MD. Ph.D POLYMERASE CHAIN REACTION Associate Professor Chatchawan Srisawat MD. Ph.D POLYMERASE CHAIN REACTION In vitro technique for amplification of the specified DNA sequences. It enables us to produce enormous

More information

Bootcamp: Molecular Biology Techniques and Interpretation

Bootcamp: Molecular Biology Techniques and Interpretation Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing

More information

Polymerase Chain Reaction-361 BCH

Polymerase Chain Reaction-361 BCH Polymerase Chain Reaction-361 BCH 1-Polymerase Chain Reaction Nucleic acid amplification is an important process in biotechnology and molecular biology and has been widely used in research, medicine, agriculture

More information

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death

More information

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright

More information

The Polymerase Chain Reaction. Chapter 6: Background

The Polymerase Chain Reaction. Chapter 6: Background The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for

More information

Lecture 18. PCR Technology. Growing PCR Industry

Lecture 18. PCR Technology. Growing PCR Industry Lecture 18 PCR Technology Growing PCR Industry Basic PCR, Cloning of PCR product, RT-PCR, RACE, Quantitative PCR, Multiplex PCR, Hot start PCR, Touchdown PCR,PCR sequencing.. How PCR started The DNA duplex

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology

2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes

More information

Guidelines for Preventing Contamination of PCR Reference Guidelines for Primer Design Estimation of Primer Melting Temperature

Guidelines for Preventing Contamination of PCR Reference Guidelines for Primer Design Estimation of Primer Melting Temperature Guidelines for Preventing Contamination of PCR During PCR more than 10 million copies of a template DNA are generated. Therefore, care must be taken to avoid contamination with other templates and amplicons

More information

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics

More information

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR

More information

BEST QUALITY HIGHEST PURITY. Recombinant ENZYMES & PROTEINS

BEST QUALITY HIGHEST PURITY. Recombinant ENZYMES & PROTEINS BEST QUALITY HIGHEST PURITY Recombinant ENZYMES & PROTEINS We offer a wide range of highest quality enzymes and proteins for molecular biology including DNA polymerases, reverse transcriptases, DNA ligases,

More information

B. Incorrect! Ligation is also a necessary step for cloning.

B. Incorrect! Ligation is also a necessary step for cloning. Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease

More information

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc. Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers

More information

PCR. CSIBD Molecular Genetics Course July 12, 2011 Michael Choi, M.D.

PCR. CSIBD Molecular Genetics Course July 12, 2011 Michael Choi, M.D. PCR CSIBD Molecular Genetics Course July 12, 2011 Michael Choi, M.D. General Outline of the Lecture I. Background II. Basic Principles III. Detection and Analysis of PCR Products IV. Common Applications

More information

CH 8: Recombinant DNA Technology

CH 8: Recombinant DNA Technology CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes

More information

Factors affecting PCR

Factors affecting PCR Lec. 11 Dr. Ahmed K. Ali Factors affecting PCR The sequences of the primers are critical to the success of the experiment, as are the precise temperatures used in the heating and cooling stages of the

More information

Polymerase Chain Reaction

Polymerase Chain Reaction Polymerase Chain Reaction Problem Suppose you have a patient with an infection or a heritable disease. You want to know which infection or disease it is and.. you want to know it fast and... from as little

More information

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) Laboratory for Environmental Pathogens Research Department of Environmental Sciences University of Toledo Polymerase Chain Reaction (PCR) Background information The polymerase chain reaction (PCR) is an

More information

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing

More information

Polymerase Chain Reaction PCR

Polymerase Chain Reaction PCR Polymerase Chain Reaction PCR What is PCR? An in vitro process that detects, identifies, and copies (amplifies) a specific piece of DNA in a biological sample. Discovered by Dr. Kary Mullis in 1983. A

More information

STANDARD CLONING PROCEDURES. Shotgun cloning (using a plasmid vector and E coli as a host).

STANDARD CLONING PROCEDURES. Shotgun cloning (using a plasmid vector and E coli as a host). STANDARD CLONING PROCEDURES Shotgun cloning (using a plasmid vector and E coli as a host). 1) Digest donor DNA and plasmid DNA with the same restriction endonuclease 2) Mix the fragments together and treat

More information

Overview: The DNA Toolbox

Overview: The DNA Toolbox Overview: The DNA Toolbox Sequencing of the genomes of more than 7,000 species was under way in 2010 DNA sequencing has depended on advances in technology, starting with making recombinant DNA In recombinant

More information

Laboratory #7 PCR PCR

Laboratory #7 PCR PCR 1 Laboratory #7 Polymerase chain reaction () is DNA replication in a test tube. In vitro enzymatic amplification of a specific segment of DNA. Many Applications. direct cloning from DNA or cdna. Mutagenesis

More information

13-2 Manipulating DNA Slide 1 of 32

13-2 Manipulating DNA Slide 1 of 32 1 of 32 The Tools of Molecular Biology The Tools of Molecular Biology How do scientists make changes to DNA? Scientists use their knowledge of the structure of DNA and its chemical properties to study

More information

Polymerase chain reaction

Polymerase chain reaction Core course BMS361N Genetic Engineering Polymerase chain reaction Prof. Narkunaraja Shanmugam Dept. Of Biomedical Science School of Basic Medical Sciences Bharathidasan University The polymerase chain

More information

The Polymerase Chain Reaction. Chapter 6: Background

The Polymerase Chain Reaction. Chapter 6: Background The Polymerase Chain Reaction Chapter 6: Background PCR Amplify= Polymerase Chain Reaction (PCR) Invented in 1984 Applications Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off

More information

Reverse Transcription & RT-PCR

Reverse Transcription & RT-PCR Creating Gene Expression Solutions Reverse Transcription & RT-PCR Reverse transcription, a process that involves a reverse transcriptase (RTase) which uses RNA as the template to make complementary DNA

More information

Chapter 20 Biotechnology

Chapter 20 Biotechnology Chapter 20 Biotechnology Manipulation of DNA In 2007, the first entire human genome had been sequenced. The ability to sequence an organisms genomes were made possible by advances in biotechnology, (the

More information

Journal Club & MSc Seminar

Journal Club & MSc Seminar Journal Club & MSc Seminar 2 The Polymerase Chain Reaction (PCR) was not a discovery, but rather an invention A special DNA polymerase (Taq) is used to make many copies of a short length of DNA (100-10,000

More information

PLNT2530 (2018) Unit 6b Sequence Libraries

PLNT2530 (2018) Unit 6b Sequence Libraries PLNT2530 (2018) Unit 6b Sequence Libraries Molecular Biotechnology (Ch 4) Analysis of Genes and Genomes (Ch 5) Unless otherwise cited or referenced, all content of this presenataion is licensed under the

More information

DNA Replication. DNA Replication. Meselson & Stahl Experiment. Contents

DNA Replication. DNA Replication. Meselson & Stahl Experiment. Contents DNA Replication Contents 1 DNA Replication 1.1 Meselson & Stahl Experiment 1.2 Replication Machinery 2 Polymerase Chain Reaction (PCR) 3 External Resources: DNA Replication Meselson & Stahl Experiment

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

Basic PCR Technique. Presented by : Noorul Hidayah Badri

Basic PCR Technique. Presented by : Noorul Hidayah Badri Basic PCR Technique Presented by : Noorul Hidayah Badri What is PCR? PCR is aninvitro technique which allow the amplification of a specific DNA region. PCR is like selecting a specific page from book and

More information

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology. PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?

More information

XXII DNA cloning and sequencing. Outline

XXII DNA cloning and sequencing. Outline XXII DNA cloning and sequencing 1) Deriving DNA for cloning Outline 2) Vectors; forming recombinant DNA; cloning DNA; and screening for clones containing recombinant DNA [replica plating and autoradiography;

More information

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE. Instruction manual for KOD -Multi & Epi- 1612 F1440K KOD -Multi & Epi- KME-101 200 U 200 reactions Store at 20 C Contents [1] Introduction [2] Components [3] Primer design [4] Template [5] Cloning of PCR

More information

POLYMERASE CHAIN REACTION PCR. (Biotechnology and Genetic Engineering) Edemhanria, Lawrence

POLYMERASE CHAIN REACTION PCR. (Biotechnology and Genetic Engineering) Edemhanria, Lawrence POLYMERASE CHAIN REACTION PCR. (Biotechnology and Genetic Engineering) Edemhanria, Lawrence Biochemistry Unit Chemical Sciences Department Samuel Adegboyega University Ogwa, Edo State, Nigeria. Outline

More information

Polymerase Chain Reaction PCR

Polymerase Chain Reaction PCR 1 Description of Module Subject Name Paper Name Module Name/Title Dr. Vijaya Khader Dr. MC Varadaraj 2 1. Objectives 1. To understand principle of 2. Types 3. Applications 2. Lay Out 3 Types of Qualitative

More information

Amplification Products for PCR and RT-PCR

Amplification Products for PCR and RT-PCR Selection guide Polymerase Hot start Comment UptiTherm DNA pol. no Most economic. Lower error rate than Taq polymerase Available in several formats, master mix including or not dntp, Mg 2+..., in gel format

More information

Fun with DNA polymerase

Fun with DNA polymerase Fun with DNA polymerase Why would we want to be able to make copies of DNA? Can you think of a situation where you have only a small amount and would like more? Enzymatic DNA synthesis To use DNA polymerase

More information

The Biotechnology Toolbox

The Biotechnology Toolbox Chapter 15 The Biotechnology Toolbox Cutting and Pasting DNA Cutting DNA Restriction endonuclease or restriction enzymes Cellular protection mechanism for infected foreign DNA Recognition and cutting specific

More information

KAPA HiFi HotStart ReadyMix PCR Kit

KAPA HiFi HotStart ReadyMix PCR Kit KAPA HiFi HotStart ReadyMix PCR Kit KR0370 v10.19 This provides product information and a detailed protocol for the KAPA HiFi HotStart ReadyMix PCR Kit. This document applies to the following kits: 07958919001,

More information

SuperiorScript III cdna Synthesis Kit Instruction Manual

SuperiorScript III cdna Synthesis Kit Instruction Manual SuperiorScript III cdna Synthesis Kit Instruction Manual Cat.# EZ405S, EZ405M SuperiorScript III cdna Synthesis Kit Table of Contents I. Description... 3 II. Kit... 4 III. Procedure... 5 IV. Control Experiment

More information

10x Hot-Taq Buffer 1 ml 1 ml x 2ea 1 ml x 10ea. dntp Mix (each 10 mm) None / 0.2 ml None / 0.4 ml None / 0.4 ml x 5ea

10x Hot-Taq Buffer 1 ml 1 ml x 2ea 1 ml x 10ea. dntp Mix (each 10 mm) None / 0.2 ml None / 0.4 ml None / 0.4 ml x 5ea HelixAmp TM Hot-Taq Polymerase (Ver. 2.0) CERTIFICATE OF ANALYSIS (1603-V01R03) Contents HelixAmp TM Hot-Taq Polymerase (Ver. 2.0) Cat. No. HT250/HT250N HT500/HT500N HT2500/HT2500N Hot-Taq (2.5 units/μl)

More information

Chapter 1. Introduction

Chapter 1. Introduction Chapter Introduction Table of Contents Introduction Page. Principles of PCR and RT-PCR...9.2 The Evolution of PCR....3 Purpose of this PCR Applications Manual...5 8 PCR Applications Manual Principles of

More information

Session 3 Cloning Overview & Polymerase Chain Reaction

Session 3 Cloning Overview & Polymerase Chain Reaction Session 3 Cloning Overview & Polymerase Chain Reaction Learning Objective: In this lab exercise, you will become familiar with the steps of a polymerase chain reaction, the required reagents for a successful

More information

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

Basics of Recombinant DNA Technology Biochemistry 302. March 5, 2004 Bob Kelm

Basics of Recombinant DNA Technology Biochemistry 302. March 5, 2004 Bob Kelm Basics of Recombinant DNA Technology Biochemistry 302 March 5, 2004 Bob Kelm Applications of recombinant DNA technology Mapping and identifying genes (DNA cloning) Propagating genes (DNA subcloning) Modifying

More information

FAQs: PCR Polymerases from Takara Bio

FAQs: PCR Polymerases from Takara Bio FAQs: PCR Polymerases from Takara Bio Contents: PCR Basics Q1 Q2 Q3 What parameters do I need to consider when designing primers? What is the optimum amount of template to use? Which conditions are particularly

More information

Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami

Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques

More information

California Institute of Technology. Directed evolution. Dr. F.H. Arnold s lab

California Institute of Technology. Directed evolution. Dr. F.H. Arnold s lab Directed evolution. Dr. F.H. Arnold s lab May 4, 1999 Mutagenic PCR -[Mn] The amount of Mn used in the reaction should be titrated to produce the desired mutagenic rate. Libraries that have close to 30%

More information

1

1 1 2 3 4 5 Cosmids are plasmid vectors that contain cos sites. The cos site is the only requirement for DNA to be packaged into a phage particle 6 7 8 9 10 11 12 13 14 15 16 For de novo sequencing using

More information

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain

More information

Chapter 9 Genetic Engineering

Chapter 9 Genetic Engineering Chapter 9 Genetic Engineering Biotechnology: use of microbes to make a protein product Recombinant DNA Technology: Insertion or modification of genes to produce desired proteins Genetic engineering: manipulation

More information

winter savings one place High Quality Costs Less Look inside to find great deals on Thermo Scientific products for all your molecular biology needs

winter savings one place High Quality Costs Less Look inside to find great deals on Thermo Scientific products for all your molecular biology needs A quarterly publication containing special offers for significant savings on a variety of molecular biology products CDA winter savings High Quality Costs Less RNAi PCR / qpcr Look inside to find great

More information

PCR Introduction. Biochemistry Laboratory

PCR Introduction. Biochemistry Laboratory PCR Introduction Biochemistry Laboratory 2010. 11 Mechanism of DNA Synthesis DNA polymerase extends the primer by sequentially adding a single dntp (datp, dgtp, dctp or dttp) that is complementary to the

More information

Procomcure Biotech. PCR Reagents

Procomcure Biotech. PCR Reagents Procomcure Biotech PCR Reagents valid for 2018 VitaTaq DNA Polymerase is a standard Taq DNA polymerase suitable for all common PCR applications like colonypcr, cloning applications, high-throughput PCR

More information

Design. Construction. Characterization

Design. Construction. Characterization Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication

More information

Introduction to PCR. ABCF Training Module. Leah Kago Research Associate BecA-ILRI Hub

Introduction to PCR. ABCF Training Module. Leah Kago Research Associate BecA-ILRI Hub Introduction to PCR ABCF Training Module Leah Kago Research Associate BecA-ILRI Hub What is PCR? Polymerase Chain Reaction An in vitro process that detects, identifies, and copies (amplifies) a specific

More information

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) Polymerase Chain Reaction (PCR) PCR protocols Polymerase Chain Reaction (PCR) A technique for the in vitro amplification of specific DNA sequences by the simultaneous primer extension of complementary

More information

Cat. # R006A. For Research Use. TaKaRa Z-Taq DNA Polymerase. Product Manual. v201411da

Cat. # R006A. For Research Use. TaKaRa Z-Taq DNA Polymerase. Product Manual. v201411da Cat. # R006A For Research Use TaKaRa Z-Taq DNA Polymerase Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Specifications... 3 IV. Optimization of Reaction Conditions... 4

More information

Guidelines for Developing Robust and Reliable PCR Assays

Guidelines for Developing Robust and Reliable PCR Assays Guidelines for Developing Robust and Reliable PCR Assays Leta Steffen, PhD Applications Scientist Promega Corporation Outline 1) PCR reaction components What is in the reaction? How does it affect assay

More information

Chapter 15 Recombinant DNA and Genetic Engineering. Restriction Enzymes Function as Nature s Pinking Shears

Chapter 15 Recombinant DNA and Genetic Engineering. Restriction Enzymes Function as Nature s Pinking Shears Chapter 15 Recombinant DNA and Genetic Engineering In this chapter you will learn How restriction enzyme work and why they are essential to DNA technology. About various procedures such as cloning and

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Common General Cloning Strategy Target DNA from donor organism extracted, cut with restriction endonuclease and ligated into a cloning vector cut with compatible restriction

More information

Biotechnology. Explorer Program. Serious About Science Education 5/17/09 1

Biotechnology. Explorer Program. Serious About Science Education 5/17/09 1 Biotechnology Explorer Program Serious About Science Education 5/17/09 1 Chromosome 8: PCR TM PCR Workshop Kirk Brown,, Tracy High School; Tracy, Ca Stan Hitomi,, Monte Vista High School; Danville, CA

More information

Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual

Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual Fusion Cloning technology Cold Fusion Cloning Kit Store the master mixture and positive controls at -20 C Store the competent cells at -80 C. (ver. 120909) A limited-use label license covers this product.

More information

Chapter 4. Recombinant DNA Technology

Chapter 4. Recombinant DNA Technology Chapter 4 Recombinant DNA Technology 5. Plasmid Cloning Vectors Plasmid Plasmids Self replicating Double-stranded Mostly circular DNA ( 500 kb) Linear : Streptomyces, Borrelia burgdorferi Replicon

More information

CHAPTER 9 DNA Technologies

CHAPTER 9 DNA Technologies CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes

More information

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries

More information

3 Designing Primers for Site-Directed Mutagenesis

3 Designing Primers for Site-Directed Mutagenesis 3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed

More information

USB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr

USB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr USB HotStart-IT for increased specificity and consistent results PCR, qpcr and qrt-pcr USB PCR Reagents Choose USB HotStart-IT products for increased specificity and consistent results. Long and Accurate

More information

VOLUME 2. Molecular Clonin g A LABORATORY MANUA L THIRD EDITIO N. Joseph Sambrook. David W. Russell

VOLUME 2. Molecular Clonin g A LABORATORY MANUA L THIRD EDITIO N. Joseph Sambrook. David W. Russell VOLUME 2 Molecular Clonin g A LABORATORY MANUA L THIRD EDITIO N Joseph Sambrook David W. Russell Chapter 8 In Vitro Amplification of DNA by the Polymerase 8. 1 Chain Reaction 1 The Basic Polymerase Chain

More information

NEW PARADIGM of BIOTECHNOLOGY - GENET BIO. GeNet Bio Global Gene Network

NEW PARADIGM of BIOTECHNOLOGY - GENET BIO. GeNet Bio Global Gene Network NEW PARADIGM of BIOTECHNOLOGY - GENET BIO GeNet Bio Global Gene Network GENET BIO DNA AMPLIFICATION PRODUCTS GUIDE Keynote of Products Prime TaqTM DNA Polymerase Prime TaqTM Premix ExPrime TaqTM DNA Polymerase

More information

BINF 6350 ITSC 8350 Fall 2011 Biotechnology & Genomics Lab PCR.

BINF 6350 ITSC 8350 Fall 2011 Biotechnology & Genomics Lab PCR. BINF 6350 ITSC 8350 Fall 2011 Biotechnology & Genomics Lab PCR http://webpages.uncc.edu/~jweller2 Polymerase Chain Reaction Paper 1988 Nobel: 1993 How do you make enough genetic material to characterize

More information

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8 Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically

More information

NB536: Bioinformatics

NB536: Bioinformatics NB536: Bioinformatics Instructor Prof. Jong Kyoung Kim Department of New Biology Office: E4-613 E-mail: jkkim@dgist.ac.kr Homepage: https://scg.dgist.ac.kr Course website https://scg.dgist.ac.kr/index.php/courses

More information

Chapter 20 DNA Technology & Genomics. If we can, should we?

Chapter 20 DNA Technology & Genomics. If we can, should we? Chapter 20 DNA Technology & Genomics If we can, should we? Biotechnology Genetic manipulation of organisms or their components to make useful products Humans have been doing this for 1,000s of years plant

More information

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright

More information

Recombinant DNA recombinant DNA DNA cloning gene cloning

Recombinant DNA recombinant DNA DNA cloning gene cloning DNA Technology Recombinant DNA In recombinant DNA, DNA from two different sources, often two species, are combined into the same DNA molecule. DNA cloning permits production of multiple copies of a specific

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for :

Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for : Transformation Insertion of DNA of interest Amplification Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for : DNA Sequence. Understand relatedness of genes and

More information

DNA Technology. Asilomar Singer, Zinder, Brenner, Berg

DNA Technology. Asilomar Singer, Zinder, Brenner, Berg DNA Technology Asilomar 1973. Singer, Zinder, Brenner, Berg DNA Technology The following are some of the most important molecular methods we will be using in this course. They will be used, among other

More information

PCR-ReIated Products User's Instruction

PCR-ReIated Products User's Instruction ISO 9001:2000 Certified PCR-ReIated Products User's Instruction SBS Genetech Co.,Ltd. Table of Contents Cat. No. Product Name Page EUT-500 ER-500 EP-500 EQ2.2-100/2.5-100/5.2-100/5.5-100 EN-1/2 U-Taq DNA

More information