Genome Assembly. J Fass UCD Genome Center Bioinformatics Core Friday September, 2015
|
|
- Dulcie Henry
- 6 years ago
- Views:
Transcription
1 Genome Assembly J Fass UCD Genome Center Bioinformatics Core Friday September, 2015
2 From reads to molecules
3 What s the Problem? How to get the best assemblies for the smallest expense (sequencing) and least effort (bioinformatics).
4 What s the Problem? "[...] repeats are the single biggest impediment to all assembly algorithms and sequencing technologies." ~ Koren 2012 Nat Biotech
5 What s the Problem? Repeats larger than the read (or template) length are impossible to resolve unambiguously.
6 What s the Problem? Repeats larger than the read (or template) length are impossible to resolve unambiguously. A R B
7 What s the Problem? Repeats larger than the read (or template) length are impossible to resolve unambiguously. R A R B R?? A R B
8 What s the Problem? Repeats larger than the read (or template) length are impossible to resolve unambiguously. R B R A R?? A R B
9 What s the Problem? Magical FutureSeqTM reads easily resolve these long repetitive regions, but have unfortunately been slow coming to market. R A R B R!! R A R B R
10 What s the Problem? Assembly graphs with perfect reads of length k Koren & Phillippy 2015 Curent Opinions in Microbiology 23:110
11 Software ~timeline Celera Assembler ( OLC assembler used for whole-genome shotgun human assembly, as opposed to NIH BAC-by-BAC approach)... now open source wgs-assembler Velvet (one of 1st de Bruijn graph assemblers) ALLPATHS-LG (de Bruijn, recipe-based) SGA - String Graph Assembler
12 OLC Assemblers
13 OLC Assemblers Overlap
14 OLC Assemblers Overlap Layout A R B
15 OLC Assemblers Overlap Layout Consensus. R OLC A R B R A R B
16 de Bruijn graph assembly To reduce computational challenge from millions of reads, break them up into smaller chunks.?!!
17 Constructing an assembly "graph"
18 Constructing an assembly "graph"
19 Constructing an assembly "graph"
20 Constructing an assembly "graph"
21 Constructing an assembly "graph"
22 de Bruijn graph assembler, Velvet Build graph from 7 bp reads, with ernors... using 4 bp k-mers Tracking k-mers, not reads, essentially compresses the data... important for NextGen era!
23 de Bruijn graph assembler, Velvet Tip Removal Bubble Popping (Coverage Constraints) Cutting at every ambiguity (branch point) yields the final contigs: TAGTCGAG GAGGCTTAGA AGATCGGATGAG AGAGACAG Zerbino 2008 Genome Research 18:
24 K-mer coverage...? Performance (speed, memory, effectiveness of assembly) of de Bruijn-graph assemblers is correlated with k-mer coverage, not base coverage.
25 Base coverage
26 K-mer coverage k-mers tile across reads (L - k + 1) k-mers in a read of length L
27 Error Exclusion Smaller k will increase coverage of true kmers (peak shifts to the right), but not error kmers. Choosing a coverage cutoff that separates the two distributions will simplify the graph, removing noise and leaving signal. Simple graph = longer contigs!
28 Choosing k Smaller k-mers increase the connectivity of the graph by simultaneously increasing the chance of observing an overlap between two reads and the number of ambiguous repeats in the graph. There is therefore a balance between sensitivity and specificity determined by k. ~Zerbino (2008) Genome Research 18:821
29 Choosing k
30 Choosing k
31 Assembly Miscellanea
32 Hierarchical Assembly Amplify Bacterial Artificial Chromosomes, Fosmids, etc.... sequence, assemble (simpler problem for BACs than chromosomes), then assemble the assemblies.
33 Scaffoldering
34 Gap filling / contig extension
35 Gap filling / contig extension IMAGE (Iterative Mapping and Assembly for Gap Elimination) Tsai 2010 Genome Biology 11:R41 PRICE (Paired Read Iterative Contig Extension) DeRisi lab, UCSF
36 Reference-assisted assembly
37 Error Correction (Quake)
38 Error Correction (Quake)
39 Error Correction (Quake)
40 Error Correction Similar correction methods are incorporated into modern assemblers (like SOAPdenovo, SGA, ALLPATHS), and error exclusion (based on k-mer coverage) is an element of some (Velvet...)
41 Digital Normalization K-mer based one-pass filtering/trimming of short reads; discards redundant data to even out uneven coverage, and preferentially discards or trims error-containing reads. This reduces graph size (RAM) and computation time for assemblers. Brown 2012 arxiv: v2
42 Digital Normalization Based on median k-mer abundance / coverage, diginorm discards the majority of errorcontaining k-mers, while retaining nearly all real k-mers - (discards data, not information). Brown 2012 arxiv: v2
43 Diginorm (second pass - trimming) After digital normalization, make a second pass wherein 3'-end of reads are trimmed to remove low frequency k-mers.
44 Diginorm (third pass - normalization) After trimming, do another normalization pass. Trimming in between two normalization passes allows more discrimination between erroneous and real k-mers. Majority of computational time is in first pass (normalization), so three-pass approach is not much more demanding than single-pass approach.
45 Assemblers of note...
46 SPAdes uneven coverage, chimerism ( St. Petersburg Assembler ) Nurk, Bankevich et al. (2013 book chapter) DOI: / _13 Bankevich, Nurk et al. (2012) J Comp Biol DOI: /cmb Deals with highly uneven coverage depth (like IDBA_UD) but also high rates of chimerism in sequencing libraries (more of a problem for single-cell assemblies amplified with Multiple Displacement Amplification - micrometagenomes?). Users of SPAdes report: It just works
47 Allpaths-LG... and its "recipe" Ribeiro (2012) Genome Research doi: /gr Gnerre (2011) PNAS 108:1513 Makes use of a recipe of three (or four) different libraries (see below) can be run without largest scale libraries, but not for best results. Makes sense for an institute that can standardize its sequencing and bioinformatics together. Gnerre 2011: 45x Overlapping PE reads (180 bp ISIZE, >100bp reads) 45x Short jump / MP (3kb) 5x.. Optional long jump / MP (6kb) 1x.. Optional fosmid jump / MP (40kb) Ribeiro 2012: 50x Overlapping PE reads (180bp ISIZE, >100bp reads) 50x 1-3kb PacBio reads 50x Long jump / MP (2-10kb)
48 sga: String Graph Assembler Simpson, J and Durbin, R (2010) Efficient construction of an assembly string graph using the FM-index Bioinformatics 26: i367 String graphs retain the information lost by de Bruijn graphs full read context by building graphs based on the full overlaps between reads (instead of k-mers). But, this requires all-to-all overlap detection! sga utilizes BWT & FM-index to make this tractable, but graph construction is still the most (computationally) expensive step. Compared to de Bruijn graph assemblers, sga uses less memory, but is significantly slower.
49 DISCOVAR de novo Weisenfeld, et al. (2014) Comprehensive variation discovery in single human genomes Nature Genetics 46:1350 (Publication is for DISCOVAR -- assembly and variant finding for smaller organisms -- not DISCOVAR de novo -- assembler for large genomes) Uses a single PCR-free, SPRI bead size selected library, and at least 60x coverage with PE250 reads. The size selection yields a broad spectrum of fragment sizes, and the longer distance read pairs are used for scaffolding. Polymorphic sequences can be pulled from the resulting graph structure, or consensus sequences.
50 Bringing PacBio into the picture
51 PacBio Read Correction "PBcR" (web page at UMd) links to spec files, raw data PBcR (wgs-assembler script) pages in wgs-assembler (Celera Assembler) wiki: http: //wgs-assembler.sourceforge.net/wiki/index.php/pbcr ec-tools code on GitHub: plus data: also in SMRT-analysis software code on GitHub: com/pacificbiosciences/smrt-analysis
52 PacBio Read Correction short, high accuracy reads mapped to PB reads Illumina, 454, PB-CCS small coverage gaps recruit other PB reads to fill them large coverage gaps split reads (maxgap option controls cutoff size) recommended minimum: X PacBio 50 X high accuracy reads
53 PacBio Read Correction maxgap? Gaps shorter than 'maxgap' setting get a chance to recruit multiple PB reads for support / correction Gaps longer than 'maxgap' setting automatically split no yes Koren, personal communication
54 PacBio Read Correction More recent Koren paper available at arxiv.org... check: Discusses PB read self-correction (for long reads from C2 or better chemistry). No independent high-accuracy reads needed; PB reads aligned to each other to infer consensus sequence. Implemented in Celera Assembler (wgs-assembler pacbiotoca script) and in PacBio s HGAP pipeline. Also, MHAP for faster alignment of long, noisy reads (reduces bottleneck in assembly).
55 historic Genome Assemblers Celera Assembler (used for whole-genome shotgun human assembly, as opposed to NIH BAC-by-BAC approach)... now, wgs-assembler (PBcR!) Velvet (one of 1st de Bruijn graph assemblers) ALLPATHS-LG (de Bruijn, recipe-based) SGA - String Graph Assembler With high accuracy long reads, older OLC assemblers become more appropriate
56 How to incorporate PacBio? small-ish (< 10 Mbp) genomes: 100x PacBio PBcR or HGAP medium ( Mbp): x PacBio HGAP moderate (< 1 Gbp): > 20x PacBio, 50x Illumina PBcR or EC Tools, DBG2OLC? large (> 1 Gbp): > 5x PacBio, x Illumina Illumina assembly, then PBSuite
57 PacBio s HGAP (Not shown) - Quiver algorithm polishes assembly by aligning all reads to finished genome, and calling a new consensus Quiver polishing Chin (2013) Nature Methods 10:563 doi: /nmeth.2474
58 Assembly Assessment
59 Assembly Competitions Assemblathon 1: Earl 2011 Genome Research 21:2224 2: ArXiv.org - GAGE - Genome Assembly Gold-standard Evaluations dngasp - de novo Genome Assembly Project
60 Assembly Assessment N50 NG50 Cumulative Length Plots Feature Response Curves (Alignment) Block NG50 (versus a good? reference) Read alignment methods
61 N50
62 N50, confused
63 NG50
64 Cumulative Length Plots
65 Align to Trusted Reference Mauve s contig reorder tool:
66 (Alignment) Block NG50
67 Cumulative (Alignment) Length Plots
68 Read-based Assessment (AMOS-validate), FRCurves, REAPR Vezzi 2012 PLoS One DOI: /journal.pone
69 Questions?
Outline. The types of Illumina data Methods of assembly Repeats Selecting k-mer size Assembly Tools Assembly Diagnostics Assembly Polishing
Illumina Assembly 1 Outline The types of Illumina data Methods of assembly Repeats Selecting k-mer size Assembly Tools Assembly Diagnostics Assembly Polishing 2 Illumina Sequencing Paired end Illumina
More informationDe novo whole genome assembly
De novo whole genome assembly Qi Sun Bioinformatics Facility Cornell University Sequencing platforms Short reads: o Illumina (150 bp, up to 300 bp) Long reads (>10kb): o PacBio SMRT; o Oxford Nanopore
More informationDe novo genome assembly with next generation sequencing data!! "
De novo genome assembly with next generation sequencing data!! " Jianbin Wang" HMGP 7620 (CPBS 7620, and BMGN 7620)" Genomics lectures" 2/7/12" Outline" The need for de novo genome assembly! The nature
More informationIntroduction to metagenome assembly. Bas E. Dutilh Metagenomic Methods for Microbial Ecologists, NIOO September 18 th 2014
Introduction to metagenome assembly Bas E. Dutilh Metagenomic Methods for Microbial Ecologists, NIOO September 18 th 2014 Sequencing specs* Method Read length Accuracy Million reads Time Cost per M 454
More informationA Roadmap to the De-novo Assembly of the Banana Slug Genome
A Roadmap to the De-novo Assembly of the Banana Slug Genome Stefan Prost 1 1 Department of Integrative Biology, University of California, Berkeley, United States of America April 6th-10th, 2015 Outline
More informationAssembly and Validation of Large Genomes from Short Reads Michael Schatz. March 16, 2011 Genome Assembly Workshop / Genome 10k
Assembly and Validation of Large Genomes from Short Reads Michael Schatz March 16, 2011 Genome Assembly Workshop / Genome 10k A Brief Aside 4.7GB / disc ~20 discs / 1G Genome X 10,000 Genomes = 1PB Data
More informationSequence assembly. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequence assembly Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing project Unknown sequence { experimental evidence result read 1 read 4 read 2 read 5 read 3 read 6 read 7 Computational requirements
More informationDe Novo Assembly of High-throughput Short Read Sequences
De Novo Assembly of High-throughput Short Read Sequences Chuming Chen Center for Bioinformatics and Computational Biology (CBCB) University of Delaware NECC Third Skate Genome Annotation Workshop May 23,
More informationDe novo whole genome assembly
De novo whole genome assembly Lecture 1 Qi Sun Minghui Wang Bioinformatics Facility Cornell University DNA Sequencing Platforms Illumina sequencing (100 to 300 bp reads) Overlapping reads ~180bp fragment
More informationshort read genome assembly Sorin Istrail CSCI1820 Short-read genome assembly algorithms 3/6/2014
1 short read genome assembly Sorin Istrail CSCI1820 Short-read genome assembly algorithms 3/6/2014 2 Genomathica Assembler Mathematica notebook for genome assembly simulation Assembler can be found at:
More informationGenome Assembly: Background and Strategy
Genome Assembly: Background and Strategy Monday, February 8, 2016 BIOL 7210: Genome Assembly Group Aroon Chande, Cheng Chen, Alicia Francis, Alli Gombolay, Namrata Kalsi, Ellie Kim, Tyrone Lee, Wilson
More informationDe novo whole genome assembly
De novo whole genome assembly Lecture 1 Qi Sun Bioinformatics Facility Cornell University Data generation Sequencing Platforms Short reads: Illumina Long reads: PacBio; Oxford Nanopore Contiging/Scaffolding
More informationSequence Assembly and Alignment. Jim Noonan Department of Genetics
Sequence Assembly and Alignment Jim Noonan Department of Genetics james.noonan@yale.edu www.yale.edu/noonanlab The assembly problem >>10 9 sequencing reads 36 bp - 1 kb 3 Gb Outline Basic concepts in genome
More informationLecture 18: Single-cell Sequencing and Assembly. Spring 2018 May 1, 2018
Lecture 18: Single-cell Sequencing and Assembly Spring 2018 May 1, 2018 1 SINGLE-CELL SEQUENCING AND ASSEMBLY 2 Single-cell Sequencing Motivation: Vast majority of environmental bacteria are unculturable
More informationDNA Sequencing and Assembly
DNA Sequencing and Assembly CS 262 Lecture Notes, Winter 2016 February 2nd, 2016 Scribe: Mark Berger Abstract In this lecture, we survey a variety of different sequencing technologies, including their
More informationGenome Assembly Software for Different Technology Platforms. PacBio Canu Falcon. Illumina Soap Denovo Discovar Platinus MaSuRCA.
Genome Assembly Software for Different Technology Platforms PacBio Canu Falcon 10x SuperNova Illumina Soap Denovo Discovar Platinus MaSuRCA Experimental design using Illumina Platform Estimate genome size:
More informationDe novo assembly of complex genomes using single molecule sequencing
De novo assembly of complex genomes using single molecule sequencing Michael Schatz Jan 14, 2014 PAG XXII @mike_schatz / #PAGXXII 1. Shear & Sequence DNA Assembling a Genome 2. Construct assembly graph
More informationCurrent'Advances'in'Sequencing' Technology' James'Gurtowski' Schatz'Lab'
Current'Advances'in'Sequencing' Technology' James'Gurtowski' Schatz'Lab' Outline' 1. Assembly'Review' 2. Pacbio' Technology'Overview' Data'CharacterisFcs' Algorithms' Results' 'Assemblies' 3. Oxford'Nanopore'
More informationWorkflow of de novo assembly
Workflow of de novo assembly Experimental Design Clean sequencing data (trim adapter and low quality sequences) Run assembly software for contiging and scaffolding Evaluation of assembly Several iterations:
More informationEfficient de novo assembly of highly heterozygous genomes from whole-genome shotgun short reads. Supplemental Materials
Efficient de novo assembly of highly heterozygous genomes from whole-genome shotgun short reads Supplemental Materials 1. Supplemental Methods... 3 1.1 Algorithm Detail... 3 1.1.1 k-mer coverage distribution
More informationde novo paired-end short reads assembly
1/54 de novo paired-end short reads assembly Rayan Chikhi ENS Cachan Brittany Symbiose, Irisa, France 2/54 THESIS FOCUS Graph theory for assembly models Indexing large sequencing datasets Practical implementation
More informationDe Novo and Hybrid Assembly
On the PacBio RS Introduction The PacBio RS utilizes SMRT technology to generate both Continuous Long Read ( CLR ) and Circular Consensus Read ( CCS ) data. In this document, we describe sequencing the
More informationAssembly of Ariolimax dolichophallus using SOAPdenovo2
Assembly of Ariolimax dolichophallus using SOAPdenovo2 Charles Markello, Thomas Matthew, and Nedda Saremi Image taken from Banana Slug Genome Project, S. Weber SOAPdenovo Assembly Tool Short Oligonucleotide
More informationde novo metagenome assembly
1 de novo metagenome assembly Rayan Chikhi CNRS Univ. Lille 1 Formation metagenomique de novo metagenomics 2 de novo metagenomics Goal: biological sense out of sequencing data Techniques: 1. de novo assembly
More informationHigh-Throughput Bioinformatics: Re-sequencing and de novo assembly. Elena Czeizler
High-Throughput Bioinformatics: Re-sequencing and de novo assembly Elena Czeizler 13.11.2015 Sequencing data Current sequencing technologies produce large amounts of data: short reads The outputted sequences
More informationTruSPAdes: analysis of variations using TruSeq Synthetic Long Reads (TSLR)
tru TruSPAdes: analysis of variations using TruSeq Synthetic Long Reads (TSLR) Anton Bankevich Center for Algorithmic Biotechnology, SPbSU Sequencing costs 1. Sequencing costs do not follow Moore s law
More informationGenome Sequencing and Assembly
Genome Sequencing and Assembly History of Sequencing What was the first fully sequenced nucleic acid? Yeast trna (alanine trna) Robert Holley 1965 Image: Wikipedia History of Sequencing Sequencing began
More informationAlignment and Assembly
Alignment and Assembly Genome assembly refers to the process of taking a large number of short DNA sequences and putting them back together to create a representation of the original chromosomes from which
More informationCourse summary. Today. PCR Polymerase chain reaction. Obtaining molecular data. Sequencing. DNA sequencing. Genome Projects.
Goals Organization Labs Project Reading Course summary DNA sequencing. Genome Projects. Today New DNA sequencing technologies. Obtaining molecular data PCR Typically used in empirical molecular evolution
More informationSupplementary Data for Hybrid error correction and de novo assembly of single-molecule sequencing reads
Supplementary Data for Hybrid error correction and de novo assembly of single-molecule sequencing reads Online Resources Pre&compiledsourcecodeanddatasetsusedforthispublication: http://www.cbcb.umd.edu/software/pbcr
More informationBIOINFORMATICS ORIGINAL PAPER
BIOINFORMATICS ORIGINAL PAPER Vol. 27 no. 21 2011, pages 2957 2963 doi:10.1093/bioinformatics/btr507 Genome analysis Advance Access publication September 7, 2011 : fast length adjustment of short reads
More informationDe novo meta-assembly of ultra-deep sequencing data
De novo meta-assembly of ultra-deep sequencing data Hamid Mirebrahim 1, Timothy J. Close 2 and Stefano Lonardi 1 1 Department of Computer Science and Engineering 2 Department of Botany and Plant Sciences
More informationDe novo assembly of human genomes with massively parallel short read sequencing. Mikk Eelmets Journal Club
De novo assembly of human genomes with massively parallel short read sequencing Mikk Eelmets Journal Club 06.04.2010 Problem DNA sequencing technologies: Sanger sequencing (500-1000 bp) Next-generation
More informationGENOME ASSEMBLY FINAL PIPELINE AND RESULTS
GENOME ASSEMBLY FINAL PIPELINE AND RESULTS Faction 1 Yanxi Chen Carl Dyson Sean Lucking Chris Monaco Shashwat Deepali Nagar Jessica Rowell Ankit Srivastava Camila Medrano Trochez Venna Wang Seyed Alireza
More informationA shotgun introduction to sequence assembly (with Velvet) MCB Brem, Eisen and Pachter
A shotgun introduction to sequence assembly (with Velvet) MCB 247 - Brem, Eisen and Pachter Hot off the press January 27, 2009 06:00 AM Eastern Time llumina Launches Suite of Next-Generation Sequencing
More informationGenome Assembly Workshop Titles and Abstracts
Genome Assembly Workshop Titles and Abstracts TUESDAY, MARCH 15, 2011 08:15 AM Richard Durbin, Wellcome Trust Sanger Institute A generic sequence graph exchange format for assembly and population variation
More informationGenome Assembly Background and Strategy
Genome Assembly Background and Strategy February 6th, 2017 BIOL 7210 - Faction I (Outbreak) - Genome Assembly Group Yanxi Chen Carl Dyson Zhiqiang Lin Sean Lucking Chris Monaco Shashwat Deepali Nagar Jessica
More informationMapping. Main Topics Sept 11. Saving results on RCAC Scaffolding and gap closing Assembly quality
Mapping Main Topics Sept 11 Saving results on RCAC Scaffolding and gap closing Assembly quality Saving results on RCAC Core files When a program crashes, it will produce a "coredump". these are very large
More informationBioinformatics for Genomics
Bioinformatics for Genomics It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material. When I was young my Father
More informationContact us for more information and a quotation
GenePool Information Sheet #1 Installed Sequencing Technologies in the GenePool The GenePool offers sequencing service on three platforms: Sanger (dideoxy) sequencing on ABI 3730 instruments Illumina SOLEXA
More informationMate-pair library data improves genome assembly
De Novo Sequencing on the Ion Torrent PGM APPLICATION NOTE Mate-pair library data improves genome assembly Highly accurate PGM data allows for de Novo Sequencing and Assembly For a draft assembly, generate
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Alla L Lapidus, Ph.D. SPbSU St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as "the study of
More informationDe novo assembly in RNA-seq analysis.
De novo assembly in RNA-seq analysis. Joachim Bargsten Wageningen UR/PRI/Plant Breeding October 2012 Motivation Transcriptome sequencing (RNA-seq) Gene expression / differential expression Reconstruct
More informationNOW GENERATION SEQUENCING. Monday, December 5, 11
NOW GENERATION SEQUENCING 1 SEQUENCING TIMELINE 1953: Structure of DNA 1975: Sanger method for sequencing 1985: Human Genome Sequencing Project begins 1990s: Clinical sequencing begins 1998: NHGRI $1000
More informationLectures 20, 21: Single- cell Sequencing and Assembly. Spring 2017 April 20,25, 2017
Lectures 20, 21: Single- cell Sequencing and Assembly Spring 2017 April 20,25, 2017 1 SINGLE-CELL SEQUENCING AND ASSEMBLY 2 Single-cell Sequencing Motivation: Vast majority of environmental bacteria are
More informationNext Generation Sequences & Chloroplast Assembly. 8 June, 2012 Jongsun Park
Next Generation Sequences & Chloroplast Assembly 8 June, 2012 Jongsun Park Table of Contents 1 History of Sequencing Technologies 2 Genome Assembly Processes With NGS Sequences 3 How to Assembly Chloroplast
More informationGenome Sequencing-- Strategies
Genome Sequencing-- Strategies Bio 4342 Spring 04 What is a genome? A genome can be defined as the entire DNA content of each nucleated cell in an organism Each organism has one or more chromosomes that
More informationSupplementary Figure 1. Design of the control microarray. a, Genomic DNA from the
Supplementary Information Supplementary Figures Supplementary Figure 1. Design of the control microarray. a, Genomic DNA from the strain M8 of S. ruber and a fosmid containing the S. ruber M8 virus M8CR4
More informationConsensus Ensemble Approaches Improve De Novo Transcriptome Assemblies
University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Computer Science and Engineering: Theses, Dissertations, and Student Research Computer Science and Engineering, Department
More informationIntroduction: Methods:
Eason 1 Introduction: Next Generation Sequencing (NGS) is a term that applies to many new sequencing technologies. The drastic increase in speed and cost of these novel methods are changing the world of
More informationDe novo Genome Assembly
De novo Genome Assembly A/Prof Torsten Seemann Winter School in Mathematical & Computational Biology - Brisbane, AU - 3 July 2017 Introduction The human genome has 47 pieces MT (or XY) The shortest piece
More informationThe Diploid Genome Sequence of an Individual Human
The Diploid Genome Sequence of an Individual Human Maido Remm Journal Club 12.02.2008 Outline Background (history, assembling strategies) Who was sequenced in previous projects Genome variations in J.
More informationThe Basics of Understanding Whole Genome Next Generation Sequence Data
The Basics of Understanding Whole Genome Next Generation Sequence Data Heather Carleton-Romer, MPH, Ph.D. ASM-CDC Infectious Disease and Public Health Microbiology Postdoctoral Fellow PulseNet USA Next
More informationCloG: a pipeline for closing gaps in a draft assembly using short reads
CloG: a pipeline for closing gaps in a draft assembly using short reads Xing Yang, Daniel Medvin, Giri Narasimhan Bioinformatics Research Group (BioRG) School of Computing and Information Sciences Miami,
More informationGenome Assembly, part II. Tandy Warnow
Genome Assembly, part II Tandy Warnow How to apply de Bruijn graphs to genome assembly Phillip E C Compeau, Pavel A Pevzner & Glenn Tesler A mathematical concept known as a de Bruijn graph turns the formidable
More informationGenome Projects. Part III. Assembly and sequencing of human genomes
Genome Projects Part III Assembly and sequencing of human genomes All current genome sequencing strategies are clone-based. 1. ordered clone sequencing e.g., C. elegans well suited for repetitive sequences
More informationBuilding and Improving Reference Genome Assemblies
Building and Improving Reference Genome Assemblies This paper reviews the problems and algorithms of assembling a complete genome from millions of short DNA sequencing reads. By K a ry n M e lt z St e
More informationThe MaSuRCA genome Assembler Aleksey Zimin 1,*, Guillaume Marçais 1, Daniela Puiu 2, Michael Roberts 1, Steven L. Salzberg 2, and James A.
Bioinformatics Advance Access published August 29, 2013 Genome Analysis The MaSuRCA genome Assembler Aleksey Zimin 1,*, Guillaume Marçais 1, Daniela Puiu 2, Michael Roberts 1, Steven L. Salzberg 2, and
More informationWe begin with a high-level overview of sequencing. There are three stages in this process.
Lecture 11 Sequence Assembly February 10, 1998 Lecturer: Phil Green Notes: Kavita Garg 11.1. Introduction This is the first of two lectures by Phil Green on Sequence Assembly. Yeast and some of the bacterial
More informationGenomic Technologies. Michael Schatz. Feb 1, 2018 Lecture 2: Applied Comparative Genomics
Genomic Technologies Michael Schatz Feb 1, 2018 Lecture 2: Applied Comparative Genomics Welcome! The primary goal of the course is for students to be grounded in theory and leave the course empowered to
More information10/20/2009 Comp 590/Comp Fall
Lecture 14: DNA Sequencing Study Chapter 8.9 10/20/2009 Comp 590/Comp 790-90 Fall 2009 1 DNA Sequencing Shear DNA into millions of small fragments Read 500 700 nucleotides at a time from the small fragments
More informationNGS developments in tomato genome sequencing
NGS developments in tomato genome sequencing 16-02-2012, Sandra Smit TATGTTTTGGAAAACATTGCATGCGGAATTGGGTACTAGGTTGGACCTTAGTACC GCGTTCCATCCTCAGACCGATGGTCAGTCTGAGAGAACGATTCAAGTGTTGGAAG ATATGCTTCGTGCATGTGTGATAGAGTTTGGTGGCCATTGGGATAGCTTCTTACC
More informationUnderstanding Accuracy in SMRT Sequencing
Understanding Accuracy in SMRT Sequencing Jonas Korlach, Chief Scientific Officer, Pacific Biosciences Introduction Single Molecule, Real-Time (SMRT ) DNA sequencing achieves highly accurate sequencing
More informationGap Filling for a Human MHC Haplotype Sequence
American Journal of Life Sciences 2016; 4(6): 146-151 http://www.sciencepublishinggroup.com/j/ajls doi: 10.11648/j.ajls.20160406.12 ISSN: 2328-5702 (Print); ISSN: 2328-5737 (Online) Gap Filling for a Human
More informationIDBA-UD: A de Novo Assembler for Single-Cell and Metagenomic Sequencing Data with Highly Uneven Depth
Category IDBA-UD: A de Novo Assembler for Single-Cell and Metagenomic Sequencing Data with Highly Uneven Depth Yu Peng 1, Henry C.M. Leung 1, S.M. Yiu 1 and Francis Y.L. Chin 1,* 1 Department of Computer
More informationarxiv: v2 [q-bio.gn] 21 May 2012
1 arxiv:1203.4802v2 [q-bio.gn] 21 May 2012 A Reference-Free Algorithm for Computational Normalization of Shotgun Sequencing Data C. Titus Brown 1,2,, Adina Howe 2, Qingpeng Zhang 1, Alexis B. Pyrkosz 3,
More informationDirect determination of diploid genome sequences. Supplemental material: contents
Direct determination of diploid genome sequences Neil I. Weisenfeld, Vijay Kumar, Preyas Shah, Deanna M. Church, David B. Jaffe Supplemental material: contents Supplemental Note 1. Comparison of performance
More informationNext Generation Sequencing Technologies
Next Generation Sequencing Technologies Julian Pierre, Jordan Taylor, Amit Upadhyay, Bhanu Rekepalli Abstract: The process of generating genome sequence data is constantly getting faster, cheaper, and
More informationState of the art de novo assembly of human genomes from massively parallel sequencing data
State of the art de novo assembly of human genomes from massively parallel sequencing data Yingrui Li, 1 Yujie Hu, 1,2 Lars Bolund 1,3 and Jun Wang 1,2* 1 BGI-Shenzhen, Shenzhen, Guangdong 518083, China
More informationDe Novo Assembly (Pseudomonas aeruginosa MAPO1 ) Sample to Insight
De Novo Assembly (Pseudomonas aeruginosa MAPO1 ) Sample to Insight 1 Workflow Import NGS raw data QC on reads De novo assembly Trim reads Finding Genes BLAST Sample to Insight Case Study Pseudomonas aeruginosa
More informationMicrobiome: Metagenomics 4/4/2018
Microbiome: Metagenomics 4/4/2018 metagenomics is an extension of many things you have already learned! Genomics used to be computationally difficult, and now that s metagenomics! Still developing tools/algorithms
More informationFaction 2: Genome Assembly Lab and Preliminary Data
Faction 2: Genome Assembly Lab and Preliminary Data [Computational Genomics 2017] Christian Colon, Erisa Sula, David Lu, Tian Jin, Lijiang Long, Rohini Mopuri, Bowen Yang, Saminda Wijeratne, Harrison Kim
More informationIntroduction to Short Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016
Introduction to Short Read Alignment UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
More informationFrom Infection to Genbank
From Infection to Genbank How a pathogenic bacterium gets its genome to NCBI Torsten Seemann VLSCI - Life Sciences Computation Centre - Genomics Theme - Lab Meeting - Friday 27 April 2012 The steps 1.
More informationGenome Assembly Using de Bruijn Graphs. Biostatistics 666
Genome Assembly Using de Bruijn Graphs Biostatistics 666 Previously: Reference Based Analyses Individual short reads are aligned to reference Genotypes generated by examining reads overlapping each position
More informationA near perfect de novo assembly of a eukaryotic genome using sequence reads of greater than 10 kilobases generated by the Pacific Biosciences RS II
A near perfect de novo assembly of a eukaryotic genome using sequence reads of greater than 10 kilobases generated by the Pacific Biosciences RS II W. Richard McCombie Disclosures Introduction to the challenge
More informationLooking Ahead: Improving Workflows for SMRT Sequencing
Looking Ahead: Improving Workflows for SMRT Sequencing Jonas Korlach FIND MEANING IN COMPLEXITY Pacific Biosciences, the Pacific Biosciences logo, PacBio, SMRT, and SMRTbell are trademarks of Pacific Biosciences
More informationThe Resurgence of Reference Quality Genome Sequence
The Resurgence of Reference Quality Genome Sequence Michael Schatz Jan 12, 2016 PAG IV @mike_schatz / #PAGIV Genomics Arsenal in the year 2015 Sample Preparation Sequencing Chromosome Mapping Summary &
More informationReevaluating Assembly Evaluations with Feature Response Curves: GAGE and Assemblathons Francesco Vezzi 1,, Giuseppe Narzisi 2, Bud Mishra 2,3,4
1 Reevaluating Assembly Evaluations with Feature Response Curves: GAGE and Assemblathons Francesco Vezzi 1,, Giuseppe Narzisi 2, Bud Mishra 2,3,4 1 School of Computer Science and Communication, KTH Royal
More informationAssembly. Ian Misner, Ph.D. Bioinformatics Crash Course. Bioinformatics Core
Assembly Ian Misner, Ph.D. Bioinformatics Crash Course Multiple flavors to choose from De novo No prior sequence knowledge required Takes what you have and tries to build the best contigs/scaffolds possible
More informationSars International Centre for Marine Molecular Biology, University of Bergen, Bergen, Norway
Joseph F. Ryan* Sars International Centre for Marine Molecular Biology, University of Bergen, Bergen, Norway Current Address: Whitney Laboratory for Marine Bioscience, University of Florida, St. Augustine,
More informationde novo Transcriptome Assembly Nicole Cloonan 1 st July 2013, Winter School, UQ
de novo Transcriptome Assembly Nicole Cloonan 1 st July 2013, Winter School, UQ de novo transcriptome assembly de novo from the Latin expression meaning from the beginning In bioinformatics, we often use
More informationGenomic resources. for non-model systems
Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing
More informationNext Gen Sequencing. Expansion of sequencing technology. Contents
Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND
More informationHaploid Assembly of Diploid Genomes
Haploid Assembly of Diploid Genomes Challenges, Trials, Tribulations 13 October 2011 İnanç Birol Assembly By Short Sequencing IEEE InfoVis 2009 2 3 in Literature ~40 citations on tool comparisons ~20 citations
More informationChIP-Seq Data Analysis. J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015
ChIP-Seq Data Analysis J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015 What s the Question? Where do Transcription Factors (TFs) bind genomic DNA 1? (Where do other things bind DNA
More informationChIP-Seq Tools. J Fass UCD Genome Center Bioinformatics Core Wednesday September 16, 2015
ChIP-Seq Tools J Fass UCD Genome Center Bioinformatics Core Wednesday September 16, 2015 What s the Question? Where do Transcription Factors (TFs) bind genomic DNA 1? (Where do other things bind DNA or
More informationValidation of synthetic long reads for use in constructing variant graphs for dairy cattle breeding
Validation of synthetic long reads for use in constructing variant graphs for dairy cattle breeding M Keehan and C Couldrey Research and Development, Livestock Improvment Corporation, Hamilton, New Zealand
More informationDE NOVO WHOLE GENOME ASSEMBLY AND SEQUENCING OF THE SUPERB FAIRYWREN. (Malurus cyaneus) JOSHUA PEÑALBA LEO JOSEPH CRAIG MORITZ ANDREW COCKBURN
DE NOVO WHOLE GENOME ASSEMBLY AND SEQUENCING OF THE SUPERB FAIRYWREN (Malurus cyaneus) JOSHUA PEÑALBA LEO JOSEPH CRAIG MORITZ ANDREW COCKBURN ... 2014 2015 2016 2017 ... 2014 2015 2016 2017 Synthetic
More informationGenomics and Transcriptomics of Spirodela polyrhiza
Genomics and Transcriptomics of Spirodela polyrhiza Doug Bryant Bioinformatics Core Facility & Todd Mockler Group, Donald Danforth Plant Science Center Desired Outcomes High-quality genomic reference sequence
More informationChIP-Seq Data Analysis. J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014
ChIP-Seq Data Analysis J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014 What s the Question? Where do Transcription Factors (TFs) bind genomic DNA 1? (Where do other things bind
More informationPERGA: A Paired-End Read Guided De Novo Assembler for Extending Contigs Using SVM and Look Ahead Approach
Title for Extending Contigs Using SVM and Look Ahead Approach Author(s) Zhu, X; Leung, HCM; Chin, FYL; Yiu, SM; Quan, G; Liu, B; Wang, Y Citation PLoS ONE, 2014, v. 9 n. 12, article no. e114253 Issued
More informationSCIENCE CHINA Life Sciences. Comparative analysis of de novo transcriptome assembly
SCIENCE CHINA Life Sciences SPECIAL TOPIC February 2013 Vol.56 No.2: 156 162 RESEARCH PAPER doi: 10.1007/s11427-013-4444-x Comparative analysis of de novo transcriptome assembly CLARKE Kaitlin 1, YANG
More informationLecture 14: DNA Sequencing
Lecture 14: DNA Sequencing Study Chapter 8.9 10/17/2013 COMP 465 Fall 2013 1 Shear DNA into millions of small fragments Read 500 700 nucleotides at a time from the small fragments (Sanger method) DNA Sequencing
More informationAssembling metagenomes: a not so practical guide
Assembling metagenomes: a not so practical guide C. Titus Brown Assistant Professor CSE, MMG, BEACON Michigan State University September 2013 ctb@msu.edu Acknowledgements Lab members involved Adina Howe
More informationDe novo genome assembly. Dr Torsten Seemann
De novo genome assembly Dr Torsten Seemann IMB Winter School - Brisbane Mon 1 July 2013 Introduction Ideal world I would not need to give this talk! Human DNA Non-existent USB3 device AGTCTAGGATTCGCTA
More informationGenome Assembly With Next Generation Sequencers
Genome Assembly With Next Generation Sequencers Personal Genomics Institute 3 May, 2011 Jongsun Park Table of Contents 1 Central Dogma and Omics Studies 2 History of Sequencing Technologies 3 Genome Assembly
More informationOutline General NGS background and terms 11/14/2016 CONFLICT OF INTEREST. HLA region targeted enrichment. NGS library preparation methodologies
Eric T. Weimer, PhD, D(ABMLI) Assistant Professor, Pathology & Laboratory Medicine, UNC School of Medicine Director, Molecular Immunology Associate Director, Clinical Flow Cytometry, HLA, and Immunology
More informationAMOS Assembly Validation and Visualization
AMOS Assembly Validation and Visualization Michael Schatz Center for Bioinformatics and Computational Biology University of Maryland August 13, 2006 University of Hawaii Outline AMOS Validation Pipeline
More informationExperimental Design. Sequencing. Data Quality Control. Read mapping. Differential Expression analysis
-Seq Analysis Quality Control checks Reproducibility Reliability -seq vs Microarray Higher sensitivity and dynamic range Lower technical variation Available for all species Novel transcript identification
More information