Fundamentals of Next-Generation Sequencing: Technologies and Applications

Size: px
Start display at page:

Download "Fundamentals of Next-Generation Sequencing: Technologies and Applications"

Transcription

1 Fundamentals of Next-Generation Sequencing: Technologies and Applications Society for Hematopathology European Association for Haematopathology 2017 Workshop Eric Duncavage, MD Washington University in St. Louis

2 None Disclosures

3 Outline Technologies NGS data generation Enrichment methods Basic Analysis Applications Diagnostic sequencing in myeloid malignancies Sequencing for measurable residual disease (MRD) Sequencing based karyotyping

4 Clinical NGS Overview (in one slide) NGS Library Generation

5 DNA Sequencing Enrichment Methods Multiplex PCR based enrichment Advantage: lower input DNA amounts, rapid, workflow Disadvantage: cannot target large regions, or unique reads Hybrid capture based enrichment Advantage: large target space, identifies unique reads Disadvantage: slower, more DNA input, lower on target Ligation based enrichment Advantage: fast, large target space Disadvantage: some regions difficult to target

6 Capture-Based Enrichment Blood/ marrow or tissue Capture Enrichment DNA purification/qc Fragmentation (~200 bp) Enriched library adapter A adapter B Ligation of universal adapters Selective PCR amplification fwd read rev read Paired end sequencing

7 PCR-Based Enrichment Blood/ marrow or tissue Digest primers and add sequence adapters DNA purification/qc Multiplex PCR of genomic DNA with primers of interest Limited cycle PCR Amplified genes of interest fwd read rev read Paired end sequencing

8 Clinical Cancer Panel 5x10 5 bp Gene Targeting Strategies Whole genome sequencing Advantages: Unbiased, detects fusions, CNVs, etc Disadvantages: Expensive, limited sensitivity Exome Sequencing Advantages: Detects any coding mutation, CNVs Disadvantages: Expensive, limited sensitivity, no fusions Hematologic Malignancy Panels Range from <50 genes to >400 genes May use amplion, capture, or ligation based enrichment Advantages: inexpensive, rapid, highly sensitive Disadvantages: biased to targeted genes, limited structural variant detection Whole Genome 3x10 9 bp Exome 5x10 7 bp * Not to scale

9 Sequencing

10 Next Generation Sequencing NGS or massively parallel sequencing refers to a group of sequencing technologies that: Perform numerous sequencing reactions simultaneously through nano-scale engineering Use of a sequencing by synthesis approach Generate short reads Two major platforms in clinical labs ThermoFisher Ion Torrent Illumina Instruments

11 Instrumentation ThermoFisher Higher throughput Higher cost per run Lower cost per base Illumina

12 NGS Data Generation (Illumina) Mardis ER. Annu Rev Genomics Hum Genet, 2018

13 Data Analysis

14 Sample De-multiplexing For most clinical applications, multiple cases are sequenced in the same NGS lane. FASTQs must first be demultiplexed based on sample-specific barcodes and split into separate files. B Total Reads A B A Reads A A B Reads B B B

15 Read Mapping and Variant Calling To make sense of short reads they have to first be aligned to the human genome Most computationally intensive step of the process Variant Calling Raw Reads Aligned Reads FLT3 A position with 22 reads aligned: -10 with the reference T allele -12 with an alternate C allele

16 NGS can Identify all Mutations Types Copy Number Alterations + (1) Normalized Coverage (black) + (8) CNV calls (red) Heterozygous deletion in all cells Del(5q) Del(7) Del(16) partial Heterozygous deletion in 50% of cells Translocations

17 Variant Calls

18 NGS coverage What s the advantage of high coverage? Gives confidence in the variants identified Makes it possible to detect tumor mutations despite admixture of nontumor tissue Makes it possible to detect variants in subclones of tumor cells

19 Coverage and Sensitivity To a large extent coverage determines the sensitivity of an NGS assay 50% VAF 10% VAF ~125x for >99% chance of seeing 10% VAF mutation twice

20 Variant Allele Fraction (VAF) Mutant U2AF1 Reference Sequence TGTGCAACCGAGAGCACCTG TGTGCAACCGAG GTGCAACCGAGA TGCAACCGAGAG CAACCGAGAGC AACCGAGAGCA ACCGAGAGCAC CCGAAAGCACC CGAAAGCACCT GAAAGCACCTG AAAGCACCTGT Mutant ASXL1 Reference Sequence CTGCCTACTACAGAGGGCTA CTGCCTACTAC TGCCTACTACA GCCTACTACAG CCTACTACAGA CTACTACAGAG TACTACAGAGG ACTACAGAGGG CTATAGAGGGC TATAGAGGGCT ATAGAGGGCTA ASXL1 U2AF1 ASXL1 U2AF1 U2AF1 WT ASXL1 U2AF1 VAF=4/(4+6)=40% Heterozygous mutation in 80% of cells VAF=3/(3+7)=30% 60% of cells VAF=Variant Allele Fraction=variant reads/total reads Jacoby et al, Expert Reviews, 2016

21 Myeloid Sequencing Panels Sequencing for Measurable Residual Disease Sequencing Based Karyotyping APPLICATIONS

22 Application #1 Sequencing Panels for Myeloid Malignancy The first AML genome was reported in 2009 for an approximate cost of $2M Identified 12 coding region mutations including NRAS, NPM1, and IDH1 In less than 10 years clinical sequencing is commonly performed on MDS and AML Small sequencing panels work great for myeloid malignancies due to the small number of recurrently mutated genes

23 Limited Number of Recurrent Mutations in AML Exome/WGS (n=200) AML TCGA Data, NEJM 2013

24 Limited Number of Recurrent Mutations in AML n=1,540 patients 111 genes sequenced Papaemmanuil et al, NEJM 2016

25 Limited Number of Recurrent Mutations in MDS Percentage of MDS Cases with Mutation ~10 Frequently mutated genes Long tail of less frequently mutated genes n=1,839 patients Papaemmanuil et al, Blood, 2013; Haferlach, Leukemia, 2014; Walter, Leukemia, 2013

26 Adapted from Haferlach, Leukemia, 2014 Small Diagnostic Sequencing Panels are Ideally Suited to AML and MDS Evaluation AML TCGA data, 40 gene panel MDS, 40 Gene Panel

27 Sequencing Blood is Equivalent to Marrow Blood Dx-CR Relapse Marrow Dx-CR Relapse Duncavage et al, Blood, 2017

28 Clinical Sequencing Panels Metric Range Consideration Sequencing Coverage 500x to > 2,000x Higher coverage result in high sensitivities VAF Sensitivity Number of genes Spectrum of reported mutations 3-10% VAF genes SNV and indels to translocation and CNAs Sensitivity depends on coverage and analysis approach More genes is not necessarily better Some labs my report rearrangements and CNAs [e.g. del(5), del(7)] or translocations from NGS panel data Cost $1,000-$3,000 Generally reimbursed by private insurance and Medicare Turn around Time ~2 weeks May be as long as 4 weeks

29 Application #2 Measurable Residual Disease Molecular risk stratification systems in AML rely on the prognostic significance of recurrent mutations identified at initial diagnosis In tumor clearance methods of risk stratification AML is sequencing at diagnosis and again 30 days after 7+3 induction to determine if mutations have been cleared Patients in which mutations (VAF >2.5%) could be detected 30 days after treatment almost all died within 5 years Doesn't matter what the mutations are if they are detectable after treatment it is a bad prognostic indicator Klco et al, JAMA, 2015

30 Error Corrected UMI-based Methods Genomic DNA PCR & sequencing errors 33% VAF Barcoded DNA Library Barcode Families Collapse Families Variant Calling True mutation VAF, Variant Allele Fraction

31 UMI Based Error Correction for Ultra Sensitive Sequencing BRAF V600E mutated cell line diluted to a VAF of 1.3% Sequenced to 10,000x coverage using amplicon-based enrichment High background noise below 2% VAF No Error Correction With Error Correction Which mutation is real?

32 Sequencing Based MRD We can now use error corrected sequencing methods (UMIs) to find low level MRD representing one mutated cell in 1,000 normal cells.

33 Application #3 Sequencing Based Karyotyping WGS can be used to recapitulate cytogenetic findings including gains/losses and rearrangements Cost of WGS continues to fall currently $1000 Karyotype WGS

34 Patients Acknowledgements McDonnell Genome Institute WU Oncology Division Richard Wilson Haley Abel Matt Walter Elaine Mardis Gue Su Chang Tim Ley Li Ding Vince Magrini John DiPersio Robert Fulton Heather Schmidt Dan Link Dave Larson Joelle Kalicki-Veizer John Welch Chris Miller Michelle O Laughlin Peter Westervelt Meagan Jacoby Funding NCI R33 CA Edward P. Evans Foundation SPORE in Myeloid Malignancies Career Enhancement Award Geoff Uy Jin Shao, Josh Robinson David Spencer

HaloPlex HS. Get to Know Your DNA. Every Single Fragment. Kevin Poon, Ph.D.

HaloPlex HS. Get to Know Your DNA. Every Single Fragment. Kevin Poon, Ph.D. HaloPlex HS Get to Know Your DNA. Every Single Fragment. Kevin Poon, Ph.D. Sr. Global Product Manager Diagnostics & Genomics Group Agilent Technologies For Research Use Only. Not for Use in Diagnostic

More information

Welcome to the NGS webinar series

Welcome to the NGS webinar series Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic

More information

Sample to Insight. Dr. Bhagyashree S. Birla NGS Field Application Scientist

Sample to Insight. Dr. Bhagyashree S. Birla NGS Field Application Scientist Dr. Bhagyashree S. Birla NGS Field Application Scientist bhagyashree.birla@qiagen.com NGS spans a broad range of applications DNA Applications Human ID Liquid biopsy Biomarker discovery Inherited and somatic

More information

Get to Know Your DNA. Every Single Fragment.

Get to Know Your DNA. Every Single Fragment. HaloPlex HS NGS Target Enrichment System Get to Know Your DNA. Every Single Fragment. High sensitivity detection of rare variants using molecular barcodes How Does Molecular Barcoding Work? HaloPlex HS

More information

A Crash Course in NGS for GI Pathologists. Sandra O Toole

A Crash Course in NGS for GI Pathologists. Sandra O Toole A Crash Course in NGS for GI Pathologists Sandra O Toole The Sanger Technique First generation sequencing Uses dideoxynucleotides (dideoxyadenine, dideoxyguanine, etc) These are molecules that resemble

More information

Enterprise Interest I am an employee of ThermoFisher Scientific.

Enterprise Interest I am an employee of ThermoFisher Scientific. Enterprise Interest I am an employee of ThermoFisher Scientific. Developing a multiplex next-generation sequencing assay to study highly clonal tumor samples Dumitru Brinza, Ph.D Clinical Next-Generation

More information

NUCLEOTIDE RESOLUTION STRUCTURAL VARIATION DETECTION USING NEXT- GENERATION WHOLE GENOME RESEQUENCING

NUCLEOTIDE RESOLUTION STRUCTURAL VARIATION DETECTION USING NEXT- GENERATION WHOLE GENOME RESEQUENCING NUCLEOTIDE RESOLUTION STRUCTURAL VARIATION DETECTION USING NEXT- GENERATION WHOLE GENOME RESEQUENCING Ken Chen, Ph.D. kchen@genome.wustl.edu The Genome Center, Washington University in St. Louis The path

More information

DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.

DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel. DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private

More information

Advances in B Lymphblastic Leukemia MRD. Brent Wood MD PhD Departments of Laboratory Medicine and Pathology University of Washington.

Advances in B Lymphblastic Leukemia MRD. Brent Wood MD PhD Departments of Laboratory Medicine and Pathology University of Washington. Advances in B Lymphblastic Leukemia MRD Brent Wood MD PhD Departments of Laboratory Medicine and Pathology University of Washington Measures of Response Clinical outcome OS, EFS, RFS, etc. Blast count

More information

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s

More information

Agilent NGS Solutions : Addressing Today s Challenges

Agilent NGS Solutions : Addressing Today s Challenges Agilent NGS Solutions : Addressing Today s Challenges Charmian Cher, Ph.D Director, Global Marketing Programs 1 10 years of Next-Gen Sequencing 2003 Completion of the Human Genome Project 2004 Pyrosequencing

More information

Next Generation Sequencing. Target Enrichment

Next Generation Sequencing. Target Enrichment Next Generation Sequencing Target Enrichment Next Generation Sequencing Your Partner in Every Step from Sample to Data NGS: Revolutionizing Genetic Analysis with Single-Molecule Resolution Next generation

More information

Detection of Rare Variants in Degraded FFPE Samples Using the HaloPlex Target Enrichment System

Detection of Rare Variants in Degraded FFPE Samples Using the HaloPlex Target Enrichment System Detection of Rare Variants in Degraded FFPE Samples Using the HaloPlex Target Enrichment System Application Note Author Linus Forsmark Henrik Johansson Agilent Technologies Inc. Santa Clara, CA USA Abstract

More information

Outline General NGS background and terms 11/14/2016 CONFLICT OF INTEREST. HLA region targeted enrichment. NGS library preparation methodologies

Outline General NGS background and terms 11/14/2016 CONFLICT OF INTEREST. HLA region targeted enrichment. NGS library preparation methodologies Eric T. Weimer, PhD, D(ABMLI) Assistant Professor, Pathology & Laboratory Medicine, UNC School of Medicine Director, Molecular Immunology Associate Director, Clinical Flow Cytometry, HLA, and Immunology

More information

Analytical verification methods for the Oncomine Lung cfdna Assay using the Ion S5 XL System

Analytical verification methods for the Oncomine Lung cfdna Assay using the Ion S5 XL System WHITE PAPER Oncomine Lung cfdna Assay and Ion S5 XL System Analytical verification methods for the Oncomine Lung cfdna Assay using the Ion S5 XL System Key highlights Investigate tumor heterogeneity and

More information

NGS, a suitable approach for TP53 screening in CLL?

NGS, a suitable approach for TP53 screening in CLL? NGS, a suitable approach for TP53 screening in CLL? Ferran Nadeu 2nd ERIC WORKSHOP ON TP53 ANALYSIS IN CHRONIC LYMPHOCYTIC LEUKEMIA 7-8 November 2017, Stresa (Italy) The Sanger sequencing bottleneck 1

More information

Course Overview: Mutation Detection Using Massively Parallel Sequencing

Course Overview: Mutation Detection Using Massively Parallel Sequencing Course Overview: Mutation Detection Using Massively Parallel Sequencing From Data Generation to Variant Annotation Eliot Shearer The Iowa Initiative in Human Genetics Bioinformatics Short Course 2012 August

More information

Next-generation sequencing technologies

Next-generation sequencing technologies Next-generation sequencing technologies NGS applications Illumina sequencing workflow Overview Sequencing by ligation Short-read NGS Sequencing by synthesis Illumina NGS Single-molecule approach Long-read

More information

DNA. Clinical Trials. Research RNA. Custom. Reports CLIA CAP GCP. Tumor Genomic Profiling Services for Clinical Trials

DNA. Clinical Trials. Research RNA. Custom. Reports CLIA CAP GCP. Tumor Genomic Profiling Services for Clinical Trials Tumor Genomic Profiling Services for Clinical Trials Custom Reports DNA RNA Focused Gene Sets Clinical Trials Accuracy and Content Enhanced NGS Sequencing Extended Panel, Exomes, Transcriptomes Research

More information

Your Best Data: Teaming QIAGEN Chemistry & Bioinformatics to Drive Samples to Insight

Your Best Data: Teaming QIAGEN Chemistry & Bioinformatics to Drive Samples to Insight Your Best Data: Teaming QIAGEN Chemistry & Bioinformatics to Drive Samples to Insight Aysel Heckel Director Clinical Solutions Sales Dr. Anne Arens Field Application Scientist Course on Variant Detection

More information

DNA concentration and purity were initially measured by NanoDrop 2000 and verified on Qubit 2.0 Fluorometer.

DNA concentration and purity were initially measured by NanoDrop 2000 and verified on Qubit 2.0 Fluorometer. DNA Preparation and QC Extraction DNA was extracted from whole blood or flash frozen post-mortem tissue using a DNA mini kit (QIAmp #51104 and QIAmp#51404, respectively) following the manufacturer s recommendations.

More information

Performance Characteristics drmid Dx for Illumina NGS systems

Performance Characteristics drmid Dx for Illumina NGS systems Performance Characteristics drmid Dx for Illumina NGS systems MANUFACTURER Multiplicom N.V. Galileïlaan 18 2845 Niel BELGIUM Revision date: August, 2017 Page 1 of 7 TABLE OF CONTENTS 1. TEST PRINCIPLE...

More information

Accessible answers. Targeted sequencing: accelerating and amplifying answers for oncology research

Accessible answers. Targeted sequencing: accelerating and amplifying answers for oncology research Accessible answers Targeted sequencing: accelerating and amplifying answers for oncology research Help advance precision medicine Accelerate results with Ion Torrent NGS Life without cancer. This is our

More information

Impact of gdna Integrity on the Outcome of DNA Methylation Studies

Impact of gdna Integrity on the Outcome of DNA Methylation Studies Impact of gdna Integrity on the Outcome of DNA Methylation Studies Application Note Nucleic Acid Analysis Authors Emily Putnam, Keith Booher, and Xueguang Sun Zymo Research Corporation, Irvine, CA, USA

More information

CAPTURE-BASED APPROACH FOR COMPREHENSIVE DETECTION OF IMPORTANT ALTERATIONS

CAPTURE-BASED APPROACH FOR COMPREHENSIVE DETECTION OF IMPORTANT ALTERATIONS CAPTURE-BASE APPROACH FOR COMPREHENSIVE ETECTION OF IMPORTANT ALTERATIONS SEQUENCE MUTATIONS MICROSATELLITE INSTABILITY AMPLIFICATIONS GENOMIC REARRANGEMENTS For Research Use Only. Not for iagnostic Purposes.

More information

Next-Generation Sequencing. Technologies

Next-Generation Sequencing. Technologies Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062

More information

Towards detection of minimal residual disease in multiple myeloma through circulating tumour DNA sequence analysis

Towards detection of minimal residual disease in multiple myeloma through circulating tumour DNA sequence analysis Towards detection of minimal residual disease in multiple myeloma through circulating tumour DNA sequence analysis Trevor Pugh, PhD, FACMG Princess Margaret Cancer Centre, University Health Network Dept.

More information

Targeted Sequencing in the NBS Laboratory

Targeted Sequencing in the NBS Laboratory Targeted Sequencing in the NBS Laboratory Christopher Greene, PhD Newborn Screening and Molecular Biology Branch Division of Laboratory Sciences Gene Sequencing in Public Health Newborn Screening February

More information

Human Genome Sequencing Over the Decades The capacity to sequence all 3.2 billion bases of the human genome (at 30X coverage) has increased

Human Genome Sequencing Over the Decades The capacity to sequence all 3.2 billion bases of the human genome (at 30X coverage) has increased Human Genome Sequencing Over the Decades The capacity to sequence all 3.2 billion bases of the human genome (at 30X coverage) has increased exponentially since the 1990s. In 2005, with the introduction

More information

Maximizing your NGS sequencing with IDT. Adam Chernick, PhD Field Applications Manager, Functional Genomics

Maximizing your NGS sequencing with IDT. Adam Chernick, PhD Field Applications Manager, Functional Genomics Maximizing your NGS sequencing with IDT Adam Chernick, PhD Field Applications Manager, Functional Genomics 1 Contents Expanding our NGS portfolio what s next? xgen technology and Lockdown probe advantages

More information

SureSelect XT HS. Target Enrichment

SureSelect XT HS. Target Enrichment SureSelect XT HS Target Enrichment What Is It? SureSelect XT HS joins the SureSelect library preparation reagent family as Agilent s highest sensitivity hybrid capture-based library prep and target enrichment

More information

Introducing QIAseq. Accelerate your NGS performance through Sample to Insight solutions. Sample to Insight

Introducing QIAseq. Accelerate your NGS performance through Sample to Insight solutions. Sample to Insight Introducing QIAseq Accelerate your NGS performance through Sample to Insight solutions Sample to Insight From Sample to Insight let QIAGEN enhance your NGS-based research High-throughput next-generation

More information

Corporate Overview. December Erik Holmlin President & CEO

Corporate Overview. December Erik Holmlin President & CEO Corporate Overview December 2018 Erik Holmlin President & CEO Forward-Looking Statements This presentation contains forward-looking statements. Forward-looking statements describe future expectations,

More information

Nuts & Bolts of Informatics Infrastructure for Clinical Next Generation Sequencing (NGS)

Nuts & Bolts of Informatics Infrastructure for Clinical Next Generation Sequencing (NGS) Nuts & Bolts of Informatics Infrastructure for Clinical Next Generation Sequencing (NGS) Somak Roy, MD Director Molecular Informatics & Genetics Services Molecular & Genomic Pathology Department of Pathology

More information

Target Enrichment Strategies for Next Generation Sequencing

Target Enrichment Strategies for Next Generation Sequencing Target Enrichment Strategies for Next Generation Sequencing Anuj Gupta, PhD Agilent Technologies, New Delhi Genotypic Conference, Sept 2014 NGS Timeline Information burst Nearly 30,000 human genomes sequenced

More information

Unique, dual-matched adapters mitigate index hopping between NGS samples. Kristina Giorda, PhD

Unique, dual-matched adapters mitigate index hopping between NGS samples. Kristina Giorda, PhD Unique, dual-matched adapters mitigate index hopping between NGS samples Kristina Giorda, PhD 1 Outline NGS workflow and cross-talk Sources of sample cross-talk and mitigation strategies Adapter recommendations

More information

Assay Validation Services

Assay Validation Services Overview PierianDx s assay validation services bring clinical genomic tests to market more rapidly through experimental design, sample requirements, analytical pipeline optimization, and criteria tuning.

More information

G E N OM I C S S E RV I C ES

G E N OM I C S S E RV I C ES GENOMICS SERVICES ABOUT T H E N E W YOR K G E NOM E C E N T E R NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. Through

More information

Lab methods: Exome / Genome. Ewart de Bruijn

Lab methods: Exome / Genome. Ewart de Bruijn Lab methods: Exome / Genome 27 06 2013 Ewart de Bruijn Library prep is only a small part of the complete DNA analysis workflow DNA isolation library prep enrichment flowchip prep sequencing bioinformatics

More information

Bioinformatics Advice on Experimental Design

Bioinformatics Advice on Experimental Design Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics

More information

Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie. Sander van Boheemen Medical Microbiology

Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie. Sander van Boheemen Medical Microbiology Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie Sander van Boheemen Medical Microbiology Next-generation sequencing Next-generation sequencing (NGS), also known as

More information

KAPA hgdna QUANTIFICATION AND QC KIT:

KAPA hgdna QUANTIFICATION AND QC KIT: Poster Note As presented at AGBT 2015, Marco Island, FL KAPA hgdna QUANTIFICATION AND QC KIT: The KAPA Human Genomic DNA Quantification and QC Kit Enables Prediction of Sequencing Performance through User-Defined

More information

Quality assurance in NGS (diagnostics)

Quality assurance in NGS (diagnostics) Quality assurance in NGS (diagnostics) Chris Mattocks National Genetics Reference Laboratory (Wessex) Research Diagnostics Quality assurance Any systematic process of checking to see whether a product

More information

QIAseq SPE technology for Illumina : Redefining amplicon sequencing

QIAseq SPE technology for Illumina : Redefining amplicon sequencing Application Note QIAseq SPE technology for Illumina : Redefining amplicon sequencing Amplicon-based enrichment and sequencing takes advantage of PCR workflows to turn amplicons that represent regions of

More information

Functional DNA Quality Analysis Improves the Accuracy of Next Generation Sequencing from Clinical Specimens

Functional DNA Quality Analysis Improves the Accuracy of Next Generation Sequencing from Clinical Specimens Functional DNA Quality Analysis Improves the Accuracy of Next Generation Sequencing from Clinical Specimens Overview We have developed a novel QC, the SuraSeq DNA Quantitative Functional Index (QFI ).

More information

Novel methods for RNA and DNA- Seq analysis using SMART Technology. Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc.

Novel methods for RNA and DNA- Seq analysis using SMART Technology. Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc. Novel methods for RNA and DNA- Seq analysis using SMART Technology Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc. Agenda Enabling Single Cell RNA-Seq using SMART Technology SMART

More information

Lecture 7. Next-generation sequencing technologies

Lecture 7. Next-generation sequencing technologies Lecture 7 Next-generation sequencing technologies Next-generation sequencing technologies General principles of short-read NGS Construct a library of fragments Generate clonal template populations Massively

More information

Efficient. Fast. Extensive.

Efficient. Fast. Extensive. Discover why cytogeneticists are using NGS in tandem with FISH Lab directors are inundated with cases, so gaining efficiency is critical. Next-generation sequencing (NGS) can complement FISH, saving you

More information

Next Generation Sequencing

Next Generation Sequencing Educational Session 28th EFI Conference, Stockholm Kaimo Hirv ZENTRUM FÜR HUMANGENETIK UND LABORATORIUMSDIAGNOSTIK (MVZ) Dr. Klein, Dr. Rost und Kollegen Lochhamer Str. 29 82152 Martinsried Tel: 0800-GENETIK

More information

14 March, 2016: Introduction to Genomics

14 March, 2016: Introduction to Genomics 14 March, 2016: Introduction to Genomics Genome Genome within Ensembl browser http://www.ensembl.org/homo_sapiens/location/view?db=core;g=ensg00000139618;r=13:3231547432400266 Genome within Ensembl browser

More information

Controlling Chaos in Oncology Testing

Controlling Chaos in Oncology Testing HORIZON DISCOVERY Controlling Chaos in Oncology Testing 16 th March 2016 Brian Burke PhD Disclaimer This Presentation does not constitute or form any part of an offer to sell, or invitation to purchase

More information

Surely Better Target Enrichment from Sample to Sequencer

Surely Better Target Enrichment from Sample to Sequencer sureselect TARGET ENRICHMENT solutions Surely Better Target Enrichment from Sample to Sequencer Agilent s market leading SureSelect platform provides a complete portfolio of catalog to custom products,

More information

SureSelect Target Enrichment for the Ion Proton TM Next Generation Sequencing System

SureSelect Target Enrichment for the Ion Proton TM Next Generation Sequencing System SureSelect Target Enrichment for the Ion Proton TM Next Generation Sequencing System Demonstrated performance you can count on Christina Chiu Product Manager, SureSelect Kyeong Jeong Ph.D. R&D Scientist

More information

Introducing combined CGH and SNP arrays for cancer characterisation and a unique next-generation sequencing service. Dr. Ruth Burton Product Manager

Introducing combined CGH and SNP arrays for cancer characterisation and a unique next-generation sequencing service. Dr. Ruth Burton Product Manager Introducing combined CGH and SNP arrays for cancer characterisation and a unique next-generation sequencing service Dr. Ruth Burton Product Manager Today s agenda Introduction CytoSure arrays and analysis

More information

Digital DNA/RNA sequencing enables highly accurate and sensitive biomarker detection and quantification

Digital DNA/RNA sequencing enables highly accurate and sensitive biomarker detection and quantification Digital DNA/RNA sequencing enables highly accurate and sensitive biomarker detection and quantification Erwin Chen ( 陳立德 ) Technical Product Specialist QIAGEN Taiwan Precision medicine: Right drug, right

More information

Cancer Genetics Solutions

Cancer Genetics Solutions Cancer Genetics Solutions Cancer Genetics Solutions Pushing the Boundaries in Cancer Genetics Cancer is a formidable foe that presents significant challenges. The complexity of this disease can be daunting

More information

Authors: Vivek Sharma and Ram Kunwar

Authors: Vivek Sharma and Ram Kunwar Molecular markers types and applications A genetic marker is a gene or known DNA sequence on a chromosome that can be used to identify individuals or species. Why we need Molecular Markers There will be

More information

Complementary Technologies for Precision Genetic Analysis

Complementary Technologies for Precision Genetic Analysis Complementary NGS, CGH and Workflow Featured Publication Zhu, J. et al. Duplication of C7orf58, WNT16 and FAM3C in an obese female with a t(7;22)(q32.1;q11.2) chromosomal translocation and clinical features

More information

Surely Better Target Enrichment from Sample to Sequencer and Analysis

Surely Better Target Enrichment from Sample to Sequencer and Analysis sureselect TARGET ENRIChment solutions Surely Better Target Enrichment from Sample to Sequencer and Analysis Agilent s market leading SureSelect platform provides a complete portfolio of catalog to custom

More information

Incorporating Molecular ID Technology. Accel-NGS 2S MID Indexing Kits

Incorporating Molecular ID Technology. Accel-NGS 2S MID Indexing Kits Incorporating Molecular ID Technology Accel-NGS 2S MID Indexing Kits Molecular Identifiers (MIDs) MIDs are indices used to label unique library molecules MIDs can assess duplicate molecules in sequencing

More information

Overview of techniques in Molecular Diagnostics ELKE BOONE 23 MAART 2017

Overview of techniques in Molecular Diagnostics ELKE BOONE 23 MAART 2017 Overview of techniques in Molecular Diagnostics ELKE BOONE 23 MAART 2017 Molecular Diagnostics Molecular Diagnostics? Molecular Diagnostics FISH or CISH techniques FISH or CISH techniques FISH or CISH

More information

QIAseq Targeted Panel Analysis Plugin USER MANUAL

QIAseq Targeted Panel Analysis Plugin USER MANUAL QIAseq Targeted Panel Analysis Plugin USER MANUAL User manual for QIAseq Targeted Panel Analysis 1.1 Windows, macos and Linux June 18, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej

More information

Outline. General principles of clonal sequencing Analysis principles Applications CNV analysis Genome architecture

Outline. General principles of clonal sequencing Analysis principles Applications CNV analysis Genome architecture The use of new sequencing technologies for genome analysis Chris Mattocks National Genetics Reference Laboratory (Wessex) NGRL (Wessex) 2008 Outline General principles of clonal sequencing Analysis principles

More information

Summary of Proposed Revisions to the 2013 Standards November 2014

Summary of Proposed Revisions to the 2013 Standards November 2014 Summary of Proposed Revisions to the 2013 Standards November 2014 The following revisions are proposed to the 2013 ASHI Standards. These revisions went through multiple reviews by the ASHI Board of Directors

More information

SEQUENCING. M Ataei, PhD. Feb 2016

SEQUENCING. M Ataei, PhD. Feb 2016 CLINICAL NEXT GENERATION SEQUENCING M Ataei, PhD Tehran Medical Genetics Laboratory Feb 2016 Overview 2 Background NGS in non-invasive prenatal diagnosis (NIPD) 3 Background Background 4 In the 1970s,

More information

Performance of the Newly Developed Non-Invasive Prenatal Multi- Gene Sequencing Screen

Performance of the Newly Developed Non-Invasive Prenatal Multi- Gene Sequencing Screen 1 // Performance of the Newly Developed Non-Invasive Prenatal Multi- Gene Sequencing Screen ABSTRACT Here we describe the analytical performance of the newly developed non-invasive prenatal multi-gene

More information

Matthew Tinning Australian Genome Research Facility. July 2012

Matthew Tinning Australian Genome Research Facility. July 2012 Next-Generation Sequencing: an overview of technologies and applications Matthew Tinning Australian Genome Research Facility July 2012 History of Sequencing Where have we been? 1869 Discovery of DNA 1909

More information

NGS-based innovations within the Leiden Network

NGS-based innovations within the Leiden Network NGS-based innovations within the Leiden Network A strong bridge between two partners Dr. Mark de Jong 2017-09-29 Design accurate and robust NGS tests and generate data sets essential for Diagnostics &

More information

resequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics

resequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics RNA Sequencing T TM variation genetics validation SNP ncrna metagenomics private trio de novo exome mendelian ChIP-seq RNA DNA bioinformatics custom target high-throughput resequencing storage ncrna comparative

More information

Understanding the science and technology of whole genome sequencing

Understanding the science and technology of whole genome sequencing Understanding the science and technology of whole genome sequencing Dag Undlien Department of Medical Genetics Oslo University Hospital University of Oslo and The Norwegian Sequencing Centre d.e.undlien@medisin.uio.no

More information

HLA-Typing Strategies

HLA-Typing Strategies HLA-Typing Strategies Cologne, 13.5.2017 Joannis Mytilineos MD, PhD Department of Transplantation Immunology Institute for Clinical Transfusion Medicine and Immunogenetics German Red Cross Blood Transfusion

More information

Next-Generation Sequencing Services à la carte

Next-Generation Sequencing Services à la carte Next-Generation Sequencing Services à la carte www.seqme.eu ngs@seqme.eu SEQme 2017 All rights reserved The trademarks and names of other companies and products mentioned in this brochure are the property

More information

SEQUENCING FROM SAMPLE TO SEQUENCE READY

SEQUENCING FROM SAMPLE TO SEQUENCE READY SEQUENCING FROM SAMPLE TO SEQUENCE READY ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES NOT ONCE, BUT EVERY TIME n The highest quality amplicons more sensitive, accurate, and specific n Full support for all

More information

NGS in Pathology Webinar

NGS in Pathology Webinar NGS in Pathology Webinar NGS Data Analysis March 10 2016 1 Topics for today s presentation 2 Introduction Next Generation Sequencing (NGS) is becoming a common and versatile tool for biological and medical

More information

An Automated Pipeline for NGS Testing and Reporting in a Commercial Molecular Pathology Lab: The Genoptix Case

An Automated Pipeline for NGS Testing and Reporting in a Commercial Molecular Pathology Lab: The Genoptix Case Cartagenia Bench Lab Case Study An Automated Pipeline for NGS Testing and Reporting in a Commercial Molecular Pathology Lab: The Genoptix Case At a Glance In this case study, you will learn: How the Molecular

More information

Access Array BRCA1 / BRCA2 / TP53 Target-Specific Panel Build the highest quality amplicon libraries with qualified assays

Access Array BRCA1 / BRCA2 / TP53 Target-Specific Panel Build the highest quality amplicon libraries with qualified assays DATA SHEET PN 100-3489 B1 Access Array BRCA1 / BRCA2 / TP53 Target-Specific Panel Build the highest quality amplicon libraries with qualified assays Covers 100% of the exons within the genes Supported

More information

Single Nucleotide Variant Analysis. H3ABioNet May 14, 2014

Single Nucleotide Variant Analysis. H3ABioNet May 14, 2014 Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide

More information

Next Generation Oncology Sequencing in your Laboratory. Built by pioneers in cancer genomics and liquid biopsy approaches PROGENEUS

Next Generation Oncology Sequencing in your Laboratory. Built by pioneers in cancer genomics and liquid biopsy approaches PROGENEUS PROGENEUS Next Generation Oncology Sequencing in your Laboratory Built by pioneers in cancer genomics and liquid biopsy approaches For Research Use Only. Not for iagnostic Purposes. personalgenome.com/progeneus

More information

with drmid Dx for Illumina NGS systems

with drmid Dx for Illumina NGS systems Performance Characteristics BRCA MASTR Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Revision date: July 27, 2017 Page 1 of 8 Table of Contents

More information

Illumina s Suite of Targeted Resequencing Solutions

Illumina s Suite of Targeted Resequencing Solutions Illumina s Suite of Targeted Resequencing Solutions Colin Baron Sr. Product Manager Sequencing Applications 2011 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life,

More information

Genetic Units (GenUs) 2016 version: Instructions for use and table of GenU bands General instructions

Genetic Units (GenUs) 2016 version: Instructions for use and table of GenU bands General instructions Genetic Units (GenUs) 2016 version: Instructions for use and table of GenU bands The following notes are designed to ensure laboratories collect and report workload data consistently for UKGTN annual returns

More information

Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4

Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4 WHITE PAPER Oncomine Comprehensive Assay Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4 Contents Scope and purpose of document...2 Content...2 How Torrent

More information

SURESELECTXT LOW INPUT TARGET ENRICHMENT

SURESELECTXT LOW INPUT TARGET ENRICHMENT SURESELECTXT LOW INPUT TARGET ENRICHMENT Low Input FFPE Optimized Streamlined Workflow SureSelect XT Low Input What is it? SureSelect XT Low Input is a low-input, FFPE-optimized library preparation kit.

More information

These products are sold FOR RESEARCH USE ONLY; not for use in diagnostic procedures.

These products are sold FOR RESEARCH USE ONLY; not for use in diagnostic procedures. Minimal Residual Disease (MRD) testing by Next- Generation Sequencing (NGS) has become an important methodology demonstrating clear potential to optimize therapeutic management of lymphoproliferative diseases.

More information

Genome Resequencing. Rearrangements. SNPs, Indels CNVs. De novo genome Sequencing. Metagenomics. Exome Sequencing. RNA-seq Gene Expression

Genome Resequencing. Rearrangements. SNPs, Indels CNVs. De novo genome Sequencing. Metagenomics. Exome Sequencing. RNA-seq Gene Expression Genome Resequencing De novo genome Sequencing SNPs, Indels CNVs Rearrangements Metagenomics RNA-seq Gene Expression Splice Isoform Abundance High Throughput Short Read Sequencing: Illumina Exome Sequencing

More information

Emma Huxley. Principal Clinical Scientist West Midlands Regional Genetics Laboratory

Emma Huxley. Principal Clinical Scientist West Midlands Regional Genetics Laboratory Genetic Analysis Using a High Density SNP Array in Myelodysplastic Syndrome: Clinical Utility and Comparative Analysis Study Compared to Metaphase Chromosome Analysis. Emma Huxley Principal Clinical Scientist

More information

Analytics Behind Genomic Testing

Analytics Behind Genomic Testing A Quick Guide to the Analytics Behind Genomic Testing Elaine Gee, PhD Director, Bioinformatics ARUP Laboratories 1 Learning Objectives Catalogue various types of bioinformatics analyses that support clinical

More information

Highly Sensitive, Multiplexed ctdna Mutation Detection on MassARRAY :

Highly Sensitive, Multiplexed ctdna Mutation Detection on MassARRAY : Highly Sensitive, Multiplexed ctdna Mutation Detection on MassARRAY : Lung & Colon Cancer Panel Pre-Launch & Data Sharing 栾晓辉, Ph.D. Senior Scientist, Application Development Agena Bioscience, Greater

More information

A new paradigm in testing for NSCLC-targeted therapies

A new paradigm in testing for NSCLC-targeted therapies A new paradigm in testing for NSCLC-targeted therapies Accelerate results, from sample to report, with the first IVD NGS-based test NEW Oncomine Dx Target Test The Ion Torrent Oncomine Dx Target Test is

More information

FFPE in your NGS Study

FFPE in your NGS Study FFPE in your NGS Study Richard Corbett Canada s Michael Smith Genome Sciences Centre Vancouver, British Columbia Dec 6, 2017 Our mandate is to advance knowledge about cancer and other diseases and to use

More information

Ion S5 and Ion S5 XL Systems

Ion S5 and Ion S5 XL Systems Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Explore the Ion S5 and Ion S5 XL Systems Adopting next-generation sequencing (NGS) in your lab is now simpler than ever The Ion S5

More information

Genomic Technologies. Michael Schatz. Feb 1, 2018 Lecture 2: Applied Comparative Genomics

Genomic Technologies. Michael Schatz. Feb 1, 2018 Lecture 2: Applied Comparative Genomics Genomic Technologies Michael Schatz Feb 1, 2018 Lecture 2: Applied Comparative Genomics Welcome! The primary goal of the course is for students to be grounded in theory and leave the course empowered to

More information

Powering the Synthetic Biology and Genomics Revolutions

Powering the Synthetic Biology and Genomics Revolutions Powering the Synthetic Biology and Genomics Revolutions Advances in Genome Biology and Technology Marco Island, Florida February 28, 2019 Safe Harbor Statement This presentation contains forward-looking

More information

Normal-Tumor Comparison using Next-Generation Sequencing Data

Normal-Tumor Comparison using Next-Generation Sequencing Data Normal-Tumor Comparison using Next-Generation Sequencing Data Chun Li Vanderbilt University Taichung, March 16, 2011 Next-Generation Sequencing First-generation (Sanger sequencing): 115 kb per day per

More information

Mutation analysis in cell-free DNA from cancer patients

Mutation analysis in cell-free DNA from cancer patients Mutation analysis in cell-free DNA from cancer patients dr. Anneleen Beckers project manager & product manager at Biogazelle CRIG s digital PCR mini-symposium, May 15, 2018 2018 Biogazelle. All rights

More information

Whole genome sequencing in the UK Biobank

Whole genome sequencing in the UK Biobank Whole genome sequencing in the UK Biobank Part of the UK Government s Industrial Strategy Challenge Fund (ISCF) for the Data to Early Diagnosis and Precision Medicine initiative Aim to produce deep characterisation

More information

Practical Considerations for Implementation of Clinical Sequencing. Emily Winn-Deen, Ph.D. April 2017

Practical Considerations for Implementation of Clinical Sequencing. Emily Winn-Deen, Ph.D. April 2017 Practical Considerations for Implementation of Clinical Sequencing Emily Winn-Deen, Ph.D. April 2017 1. DEFINE THE CLINICAL PROBLEM TO BE ADDRESSED Focused panels Targeted Gene Panels Gene or disease-based

More information

Samantha Court Genetic Technologist (Birmingham)

Samantha Court Genetic Technologist (Birmingham) National Genetic Technologist/Healthcare Science Practitioner Training Day Cardiff - 22 nd November 2017 Samantha Court Genetic Technologist (Birmingham) ccf DNA is released from all cells undergoing apoptosis

More information

Genomic & RNA Profiling Core Facility

Genomic & RNA Profiling Core Facility Baylor College of Medicine Genomic & RNA Profiling Core Facility Services Price List Effective July 2018 PLEASE NOTE: All prices listed are for internal Baylor College of Medicine researchers with the

More information

ACCEL-NGS 2S DNA LIBRARY KITS

ACCEL-NGS 2S DNA LIBRARY KITS ACCEL-NGS 2S DNA LIBRARY KITS Accel-NGS 2S DNA Library Kits produce high quality libraries with an all-inclusive, easy-to-use format. The kits contain all reagents necessary to build high complexity libraries

More information