Fundamentals of Next-Generation Sequencing: Technologies and Applications
|
|
- Thomas Jack Norton
- 6 years ago
- Views:
Transcription
1 Fundamentals of Next-Generation Sequencing: Technologies and Applications Society for Hematopathology European Association for Haematopathology 2017 Workshop Eric Duncavage, MD Washington University in St. Louis
2 None Disclosures
3 Outline Technologies NGS data generation Enrichment methods Basic Analysis Applications Diagnostic sequencing in myeloid malignancies Sequencing for measurable residual disease (MRD) Sequencing based karyotyping
4 Clinical NGS Overview (in one slide) NGS Library Generation
5 DNA Sequencing Enrichment Methods Multiplex PCR based enrichment Advantage: lower input DNA amounts, rapid, workflow Disadvantage: cannot target large regions, or unique reads Hybrid capture based enrichment Advantage: large target space, identifies unique reads Disadvantage: slower, more DNA input, lower on target Ligation based enrichment Advantage: fast, large target space Disadvantage: some regions difficult to target
6 Capture-Based Enrichment Blood/ marrow or tissue Capture Enrichment DNA purification/qc Fragmentation (~200 bp) Enriched library adapter A adapter B Ligation of universal adapters Selective PCR amplification fwd read rev read Paired end sequencing
7 PCR-Based Enrichment Blood/ marrow or tissue Digest primers and add sequence adapters DNA purification/qc Multiplex PCR of genomic DNA with primers of interest Limited cycle PCR Amplified genes of interest fwd read rev read Paired end sequencing
8 Clinical Cancer Panel 5x10 5 bp Gene Targeting Strategies Whole genome sequencing Advantages: Unbiased, detects fusions, CNVs, etc Disadvantages: Expensive, limited sensitivity Exome Sequencing Advantages: Detects any coding mutation, CNVs Disadvantages: Expensive, limited sensitivity, no fusions Hematologic Malignancy Panels Range from <50 genes to >400 genes May use amplion, capture, or ligation based enrichment Advantages: inexpensive, rapid, highly sensitive Disadvantages: biased to targeted genes, limited structural variant detection Whole Genome 3x10 9 bp Exome 5x10 7 bp * Not to scale
9 Sequencing
10 Next Generation Sequencing NGS or massively parallel sequencing refers to a group of sequencing technologies that: Perform numerous sequencing reactions simultaneously through nano-scale engineering Use of a sequencing by synthesis approach Generate short reads Two major platforms in clinical labs ThermoFisher Ion Torrent Illumina Instruments
11 Instrumentation ThermoFisher Higher throughput Higher cost per run Lower cost per base Illumina
12 NGS Data Generation (Illumina) Mardis ER. Annu Rev Genomics Hum Genet, 2018
13 Data Analysis
14 Sample De-multiplexing For most clinical applications, multiple cases are sequenced in the same NGS lane. FASTQs must first be demultiplexed based on sample-specific barcodes and split into separate files. B Total Reads A B A Reads A A B Reads B B B
15 Read Mapping and Variant Calling To make sense of short reads they have to first be aligned to the human genome Most computationally intensive step of the process Variant Calling Raw Reads Aligned Reads FLT3 A position with 22 reads aligned: -10 with the reference T allele -12 with an alternate C allele
16 NGS can Identify all Mutations Types Copy Number Alterations + (1) Normalized Coverage (black) + (8) CNV calls (red) Heterozygous deletion in all cells Del(5q) Del(7) Del(16) partial Heterozygous deletion in 50% of cells Translocations
17 Variant Calls
18 NGS coverage What s the advantage of high coverage? Gives confidence in the variants identified Makes it possible to detect tumor mutations despite admixture of nontumor tissue Makes it possible to detect variants in subclones of tumor cells
19 Coverage and Sensitivity To a large extent coverage determines the sensitivity of an NGS assay 50% VAF 10% VAF ~125x for >99% chance of seeing 10% VAF mutation twice
20 Variant Allele Fraction (VAF) Mutant U2AF1 Reference Sequence TGTGCAACCGAGAGCACCTG TGTGCAACCGAG GTGCAACCGAGA TGCAACCGAGAG CAACCGAGAGC AACCGAGAGCA ACCGAGAGCAC CCGAAAGCACC CGAAAGCACCT GAAAGCACCTG AAAGCACCTGT Mutant ASXL1 Reference Sequence CTGCCTACTACAGAGGGCTA CTGCCTACTAC TGCCTACTACA GCCTACTACAG CCTACTACAGA CTACTACAGAG TACTACAGAGG ACTACAGAGGG CTATAGAGGGC TATAGAGGGCT ATAGAGGGCTA ASXL1 U2AF1 ASXL1 U2AF1 U2AF1 WT ASXL1 U2AF1 VAF=4/(4+6)=40% Heterozygous mutation in 80% of cells VAF=3/(3+7)=30% 60% of cells VAF=Variant Allele Fraction=variant reads/total reads Jacoby et al, Expert Reviews, 2016
21 Myeloid Sequencing Panels Sequencing for Measurable Residual Disease Sequencing Based Karyotyping APPLICATIONS
22 Application #1 Sequencing Panels for Myeloid Malignancy The first AML genome was reported in 2009 for an approximate cost of $2M Identified 12 coding region mutations including NRAS, NPM1, and IDH1 In less than 10 years clinical sequencing is commonly performed on MDS and AML Small sequencing panels work great for myeloid malignancies due to the small number of recurrently mutated genes
23 Limited Number of Recurrent Mutations in AML Exome/WGS (n=200) AML TCGA Data, NEJM 2013
24 Limited Number of Recurrent Mutations in AML n=1,540 patients 111 genes sequenced Papaemmanuil et al, NEJM 2016
25 Limited Number of Recurrent Mutations in MDS Percentage of MDS Cases with Mutation ~10 Frequently mutated genes Long tail of less frequently mutated genes n=1,839 patients Papaemmanuil et al, Blood, 2013; Haferlach, Leukemia, 2014; Walter, Leukemia, 2013
26 Adapted from Haferlach, Leukemia, 2014 Small Diagnostic Sequencing Panels are Ideally Suited to AML and MDS Evaluation AML TCGA data, 40 gene panel MDS, 40 Gene Panel
27 Sequencing Blood is Equivalent to Marrow Blood Dx-CR Relapse Marrow Dx-CR Relapse Duncavage et al, Blood, 2017
28 Clinical Sequencing Panels Metric Range Consideration Sequencing Coverage 500x to > 2,000x Higher coverage result in high sensitivities VAF Sensitivity Number of genes Spectrum of reported mutations 3-10% VAF genes SNV and indels to translocation and CNAs Sensitivity depends on coverage and analysis approach More genes is not necessarily better Some labs my report rearrangements and CNAs [e.g. del(5), del(7)] or translocations from NGS panel data Cost $1,000-$3,000 Generally reimbursed by private insurance and Medicare Turn around Time ~2 weeks May be as long as 4 weeks
29 Application #2 Measurable Residual Disease Molecular risk stratification systems in AML rely on the prognostic significance of recurrent mutations identified at initial diagnosis In tumor clearance methods of risk stratification AML is sequencing at diagnosis and again 30 days after 7+3 induction to determine if mutations have been cleared Patients in which mutations (VAF >2.5%) could be detected 30 days after treatment almost all died within 5 years Doesn't matter what the mutations are if they are detectable after treatment it is a bad prognostic indicator Klco et al, JAMA, 2015
30 Error Corrected UMI-based Methods Genomic DNA PCR & sequencing errors 33% VAF Barcoded DNA Library Barcode Families Collapse Families Variant Calling True mutation VAF, Variant Allele Fraction
31 UMI Based Error Correction for Ultra Sensitive Sequencing BRAF V600E mutated cell line diluted to a VAF of 1.3% Sequenced to 10,000x coverage using amplicon-based enrichment High background noise below 2% VAF No Error Correction With Error Correction Which mutation is real?
32 Sequencing Based MRD We can now use error corrected sequencing methods (UMIs) to find low level MRD representing one mutated cell in 1,000 normal cells.
33 Application #3 Sequencing Based Karyotyping WGS can be used to recapitulate cytogenetic findings including gains/losses and rearrangements Cost of WGS continues to fall currently $1000 Karyotype WGS
34 Patients Acknowledgements McDonnell Genome Institute WU Oncology Division Richard Wilson Haley Abel Matt Walter Elaine Mardis Gue Su Chang Tim Ley Li Ding Vince Magrini John DiPersio Robert Fulton Heather Schmidt Dan Link Dave Larson Joelle Kalicki-Veizer John Welch Chris Miller Michelle O Laughlin Peter Westervelt Meagan Jacoby Funding NCI R33 CA Edward P. Evans Foundation SPORE in Myeloid Malignancies Career Enhancement Award Geoff Uy Jin Shao, Josh Robinson David Spencer
HaloPlex HS. Get to Know Your DNA. Every Single Fragment. Kevin Poon, Ph.D.
HaloPlex HS Get to Know Your DNA. Every Single Fragment. Kevin Poon, Ph.D. Sr. Global Product Manager Diagnostics & Genomics Group Agilent Technologies For Research Use Only. Not for Use in Diagnostic
More informationWelcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
More informationSample to Insight. Dr. Bhagyashree S. Birla NGS Field Application Scientist
Dr. Bhagyashree S. Birla NGS Field Application Scientist bhagyashree.birla@qiagen.com NGS spans a broad range of applications DNA Applications Human ID Liquid biopsy Biomarker discovery Inherited and somatic
More informationGet to Know Your DNA. Every Single Fragment.
HaloPlex HS NGS Target Enrichment System Get to Know Your DNA. Every Single Fragment. High sensitivity detection of rare variants using molecular barcodes How Does Molecular Barcoding Work? HaloPlex HS
More informationA Crash Course in NGS for GI Pathologists. Sandra O Toole
A Crash Course in NGS for GI Pathologists Sandra O Toole The Sanger Technique First generation sequencing Uses dideoxynucleotides (dideoxyadenine, dideoxyguanine, etc) These are molecules that resemble
More informationEnterprise Interest I am an employee of ThermoFisher Scientific.
Enterprise Interest I am an employee of ThermoFisher Scientific. Developing a multiplex next-generation sequencing assay to study highly clonal tumor samples Dumitru Brinza, Ph.D Clinical Next-Generation
More informationNUCLEOTIDE RESOLUTION STRUCTURAL VARIATION DETECTION USING NEXT- GENERATION WHOLE GENOME RESEQUENCING
NUCLEOTIDE RESOLUTION STRUCTURAL VARIATION DETECTION USING NEXT- GENERATION WHOLE GENOME RESEQUENCING Ken Chen, Ph.D. kchen@genome.wustl.edu The Genome Center, Washington University in St. Louis The path
More informationDNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.
DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private
More informationAdvances in B Lymphblastic Leukemia MRD. Brent Wood MD PhD Departments of Laboratory Medicine and Pathology University of Washington.
Advances in B Lymphblastic Leukemia MRD Brent Wood MD PhD Departments of Laboratory Medicine and Pathology University of Washington Measures of Response Clinical outcome OS, EFS, RFS, etc. Blast count
More informationQIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd
QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s
More informationAgilent NGS Solutions : Addressing Today s Challenges
Agilent NGS Solutions : Addressing Today s Challenges Charmian Cher, Ph.D Director, Global Marketing Programs 1 10 years of Next-Gen Sequencing 2003 Completion of the Human Genome Project 2004 Pyrosequencing
More informationNext Generation Sequencing. Target Enrichment
Next Generation Sequencing Target Enrichment Next Generation Sequencing Your Partner in Every Step from Sample to Data NGS: Revolutionizing Genetic Analysis with Single-Molecule Resolution Next generation
More informationDetection of Rare Variants in Degraded FFPE Samples Using the HaloPlex Target Enrichment System
Detection of Rare Variants in Degraded FFPE Samples Using the HaloPlex Target Enrichment System Application Note Author Linus Forsmark Henrik Johansson Agilent Technologies Inc. Santa Clara, CA USA Abstract
More informationOutline General NGS background and terms 11/14/2016 CONFLICT OF INTEREST. HLA region targeted enrichment. NGS library preparation methodologies
Eric T. Weimer, PhD, D(ABMLI) Assistant Professor, Pathology & Laboratory Medicine, UNC School of Medicine Director, Molecular Immunology Associate Director, Clinical Flow Cytometry, HLA, and Immunology
More informationAnalytical verification methods for the Oncomine Lung cfdna Assay using the Ion S5 XL System
WHITE PAPER Oncomine Lung cfdna Assay and Ion S5 XL System Analytical verification methods for the Oncomine Lung cfdna Assay using the Ion S5 XL System Key highlights Investigate tumor heterogeneity and
More informationNGS, a suitable approach for TP53 screening in CLL?
NGS, a suitable approach for TP53 screening in CLL? Ferran Nadeu 2nd ERIC WORKSHOP ON TP53 ANALYSIS IN CHRONIC LYMPHOCYTIC LEUKEMIA 7-8 November 2017, Stresa (Italy) The Sanger sequencing bottleneck 1
More informationCourse Overview: Mutation Detection Using Massively Parallel Sequencing
Course Overview: Mutation Detection Using Massively Parallel Sequencing From Data Generation to Variant Annotation Eliot Shearer The Iowa Initiative in Human Genetics Bioinformatics Short Course 2012 August
More informationNext-generation sequencing technologies
Next-generation sequencing technologies NGS applications Illumina sequencing workflow Overview Sequencing by ligation Short-read NGS Sequencing by synthesis Illumina NGS Single-molecule approach Long-read
More informationDNA. Clinical Trials. Research RNA. Custom. Reports CLIA CAP GCP. Tumor Genomic Profiling Services for Clinical Trials
Tumor Genomic Profiling Services for Clinical Trials Custom Reports DNA RNA Focused Gene Sets Clinical Trials Accuracy and Content Enhanced NGS Sequencing Extended Panel, Exomes, Transcriptomes Research
More informationYour Best Data: Teaming QIAGEN Chemistry & Bioinformatics to Drive Samples to Insight
Your Best Data: Teaming QIAGEN Chemistry & Bioinformatics to Drive Samples to Insight Aysel Heckel Director Clinical Solutions Sales Dr. Anne Arens Field Application Scientist Course on Variant Detection
More informationDNA concentration and purity were initially measured by NanoDrop 2000 and verified on Qubit 2.0 Fluorometer.
DNA Preparation and QC Extraction DNA was extracted from whole blood or flash frozen post-mortem tissue using a DNA mini kit (QIAmp #51104 and QIAmp#51404, respectively) following the manufacturer s recommendations.
More informationPerformance Characteristics drmid Dx for Illumina NGS systems
Performance Characteristics drmid Dx for Illumina NGS systems MANUFACTURER Multiplicom N.V. Galileïlaan 18 2845 Niel BELGIUM Revision date: August, 2017 Page 1 of 7 TABLE OF CONTENTS 1. TEST PRINCIPLE...
More informationAccessible answers. Targeted sequencing: accelerating and amplifying answers for oncology research
Accessible answers Targeted sequencing: accelerating and amplifying answers for oncology research Help advance precision medicine Accelerate results with Ion Torrent NGS Life without cancer. This is our
More informationImpact of gdna Integrity on the Outcome of DNA Methylation Studies
Impact of gdna Integrity on the Outcome of DNA Methylation Studies Application Note Nucleic Acid Analysis Authors Emily Putnam, Keith Booher, and Xueguang Sun Zymo Research Corporation, Irvine, CA, USA
More informationCAPTURE-BASED APPROACH FOR COMPREHENSIVE DETECTION OF IMPORTANT ALTERATIONS
CAPTURE-BASE APPROACH FOR COMPREHENSIVE ETECTION OF IMPORTANT ALTERATIONS SEQUENCE MUTATIONS MICROSATELLITE INSTABILITY AMPLIFICATIONS GENOMIC REARRANGEMENTS For Research Use Only. Not for iagnostic Purposes.
More informationNext-Generation Sequencing. Technologies
Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062
More informationTowards detection of minimal residual disease in multiple myeloma through circulating tumour DNA sequence analysis
Towards detection of minimal residual disease in multiple myeloma through circulating tumour DNA sequence analysis Trevor Pugh, PhD, FACMG Princess Margaret Cancer Centre, University Health Network Dept.
More informationTargeted Sequencing in the NBS Laboratory
Targeted Sequencing in the NBS Laboratory Christopher Greene, PhD Newborn Screening and Molecular Biology Branch Division of Laboratory Sciences Gene Sequencing in Public Health Newborn Screening February
More informationHuman Genome Sequencing Over the Decades The capacity to sequence all 3.2 billion bases of the human genome (at 30X coverage) has increased
Human Genome Sequencing Over the Decades The capacity to sequence all 3.2 billion bases of the human genome (at 30X coverage) has increased exponentially since the 1990s. In 2005, with the introduction
More informationMaximizing your NGS sequencing with IDT. Adam Chernick, PhD Field Applications Manager, Functional Genomics
Maximizing your NGS sequencing with IDT Adam Chernick, PhD Field Applications Manager, Functional Genomics 1 Contents Expanding our NGS portfolio what s next? xgen technology and Lockdown probe advantages
More informationSureSelect XT HS. Target Enrichment
SureSelect XT HS Target Enrichment What Is It? SureSelect XT HS joins the SureSelect library preparation reagent family as Agilent s highest sensitivity hybrid capture-based library prep and target enrichment
More informationIntroducing QIAseq. Accelerate your NGS performance through Sample to Insight solutions. Sample to Insight
Introducing QIAseq Accelerate your NGS performance through Sample to Insight solutions Sample to Insight From Sample to Insight let QIAGEN enhance your NGS-based research High-throughput next-generation
More informationCorporate Overview. December Erik Holmlin President & CEO
Corporate Overview December 2018 Erik Holmlin President & CEO Forward-Looking Statements This presentation contains forward-looking statements. Forward-looking statements describe future expectations,
More informationNuts & Bolts of Informatics Infrastructure for Clinical Next Generation Sequencing (NGS)
Nuts & Bolts of Informatics Infrastructure for Clinical Next Generation Sequencing (NGS) Somak Roy, MD Director Molecular Informatics & Genetics Services Molecular & Genomic Pathology Department of Pathology
More informationTarget Enrichment Strategies for Next Generation Sequencing
Target Enrichment Strategies for Next Generation Sequencing Anuj Gupta, PhD Agilent Technologies, New Delhi Genotypic Conference, Sept 2014 NGS Timeline Information burst Nearly 30,000 human genomes sequenced
More informationUnique, dual-matched adapters mitigate index hopping between NGS samples. Kristina Giorda, PhD
Unique, dual-matched adapters mitigate index hopping between NGS samples Kristina Giorda, PhD 1 Outline NGS workflow and cross-talk Sources of sample cross-talk and mitigation strategies Adapter recommendations
More informationAssay Validation Services
Overview PierianDx s assay validation services bring clinical genomic tests to market more rapidly through experimental design, sample requirements, analytical pipeline optimization, and criteria tuning.
More informationG E N OM I C S S E RV I C ES
GENOMICS SERVICES ABOUT T H E N E W YOR K G E NOM E C E N T E R NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. Through
More informationLab methods: Exome / Genome. Ewart de Bruijn
Lab methods: Exome / Genome 27 06 2013 Ewart de Bruijn Library prep is only a small part of the complete DNA analysis workflow DNA isolation library prep enrichment flowchip prep sequencing bioinformatics
More informationBioinformatics Advice on Experimental Design
Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics
More informationIntroductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie. Sander van Boheemen Medical Microbiology
Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie Sander van Boheemen Medical Microbiology Next-generation sequencing Next-generation sequencing (NGS), also known as
More informationKAPA hgdna QUANTIFICATION AND QC KIT:
Poster Note As presented at AGBT 2015, Marco Island, FL KAPA hgdna QUANTIFICATION AND QC KIT: The KAPA Human Genomic DNA Quantification and QC Kit Enables Prediction of Sequencing Performance through User-Defined
More informationQuality assurance in NGS (diagnostics)
Quality assurance in NGS (diagnostics) Chris Mattocks National Genetics Reference Laboratory (Wessex) Research Diagnostics Quality assurance Any systematic process of checking to see whether a product
More informationQIAseq SPE technology for Illumina : Redefining amplicon sequencing
Application Note QIAseq SPE technology for Illumina : Redefining amplicon sequencing Amplicon-based enrichment and sequencing takes advantage of PCR workflows to turn amplicons that represent regions of
More informationFunctional DNA Quality Analysis Improves the Accuracy of Next Generation Sequencing from Clinical Specimens
Functional DNA Quality Analysis Improves the Accuracy of Next Generation Sequencing from Clinical Specimens Overview We have developed a novel QC, the SuraSeq DNA Quantitative Functional Index (QFI ).
More informationNovel methods for RNA and DNA- Seq analysis using SMART Technology. Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc.
Novel methods for RNA and DNA- Seq analysis using SMART Technology Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc. Agenda Enabling Single Cell RNA-Seq using SMART Technology SMART
More informationLecture 7. Next-generation sequencing technologies
Lecture 7 Next-generation sequencing technologies Next-generation sequencing technologies General principles of short-read NGS Construct a library of fragments Generate clonal template populations Massively
More informationEfficient. Fast. Extensive.
Discover why cytogeneticists are using NGS in tandem with FISH Lab directors are inundated with cases, so gaining efficiency is critical. Next-generation sequencing (NGS) can complement FISH, saving you
More informationNext Generation Sequencing
Educational Session 28th EFI Conference, Stockholm Kaimo Hirv ZENTRUM FÜR HUMANGENETIK UND LABORATORIUMSDIAGNOSTIK (MVZ) Dr. Klein, Dr. Rost und Kollegen Lochhamer Str. 29 82152 Martinsried Tel: 0800-GENETIK
More information14 March, 2016: Introduction to Genomics
14 March, 2016: Introduction to Genomics Genome Genome within Ensembl browser http://www.ensembl.org/homo_sapiens/location/view?db=core;g=ensg00000139618;r=13:3231547432400266 Genome within Ensembl browser
More informationControlling Chaos in Oncology Testing
HORIZON DISCOVERY Controlling Chaos in Oncology Testing 16 th March 2016 Brian Burke PhD Disclaimer This Presentation does not constitute or form any part of an offer to sell, or invitation to purchase
More informationSurely Better Target Enrichment from Sample to Sequencer
sureselect TARGET ENRICHMENT solutions Surely Better Target Enrichment from Sample to Sequencer Agilent s market leading SureSelect platform provides a complete portfolio of catalog to custom products,
More informationSureSelect Target Enrichment for the Ion Proton TM Next Generation Sequencing System
SureSelect Target Enrichment for the Ion Proton TM Next Generation Sequencing System Demonstrated performance you can count on Christina Chiu Product Manager, SureSelect Kyeong Jeong Ph.D. R&D Scientist
More informationIntroducing combined CGH and SNP arrays for cancer characterisation and a unique next-generation sequencing service. Dr. Ruth Burton Product Manager
Introducing combined CGH and SNP arrays for cancer characterisation and a unique next-generation sequencing service Dr. Ruth Burton Product Manager Today s agenda Introduction CytoSure arrays and analysis
More informationDigital DNA/RNA sequencing enables highly accurate and sensitive biomarker detection and quantification
Digital DNA/RNA sequencing enables highly accurate and sensitive biomarker detection and quantification Erwin Chen ( 陳立德 ) Technical Product Specialist QIAGEN Taiwan Precision medicine: Right drug, right
More informationCancer Genetics Solutions
Cancer Genetics Solutions Cancer Genetics Solutions Pushing the Boundaries in Cancer Genetics Cancer is a formidable foe that presents significant challenges. The complexity of this disease can be daunting
More informationAuthors: Vivek Sharma and Ram Kunwar
Molecular markers types and applications A genetic marker is a gene or known DNA sequence on a chromosome that can be used to identify individuals or species. Why we need Molecular Markers There will be
More informationComplementary Technologies for Precision Genetic Analysis
Complementary NGS, CGH and Workflow Featured Publication Zhu, J. et al. Duplication of C7orf58, WNT16 and FAM3C in an obese female with a t(7;22)(q32.1;q11.2) chromosomal translocation and clinical features
More informationSurely Better Target Enrichment from Sample to Sequencer and Analysis
sureselect TARGET ENRIChment solutions Surely Better Target Enrichment from Sample to Sequencer and Analysis Agilent s market leading SureSelect platform provides a complete portfolio of catalog to custom
More informationIncorporating Molecular ID Technology. Accel-NGS 2S MID Indexing Kits
Incorporating Molecular ID Technology Accel-NGS 2S MID Indexing Kits Molecular Identifiers (MIDs) MIDs are indices used to label unique library molecules MIDs can assess duplicate molecules in sequencing
More informationOverview of techniques in Molecular Diagnostics ELKE BOONE 23 MAART 2017
Overview of techniques in Molecular Diagnostics ELKE BOONE 23 MAART 2017 Molecular Diagnostics Molecular Diagnostics? Molecular Diagnostics FISH or CISH techniques FISH or CISH techniques FISH or CISH
More informationQIAseq Targeted Panel Analysis Plugin USER MANUAL
QIAseq Targeted Panel Analysis Plugin USER MANUAL User manual for QIAseq Targeted Panel Analysis 1.1 Windows, macos and Linux June 18, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej
More informationOutline. General principles of clonal sequencing Analysis principles Applications CNV analysis Genome architecture
The use of new sequencing technologies for genome analysis Chris Mattocks National Genetics Reference Laboratory (Wessex) NGRL (Wessex) 2008 Outline General principles of clonal sequencing Analysis principles
More informationSummary of Proposed Revisions to the 2013 Standards November 2014
Summary of Proposed Revisions to the 2013 Standards November 2014 The following revisions are proposed to the 2013 ASHI Standards. These revisions went through multiple reviews by the ASHI Board of Directors
More informationSEQUENCING. M Ataei, PhD. Feb 2016
CLINICAL NEXT GENERATION SEQUENCING M Ataei, PhD Tehran Medical Genetics Laboratory Feb 2016 Overview 2 Background NGS in non-invasive prenatal diagnosis (NIPD) 3 Background Background 4 In the 1970s,
More informationPerformance of the Newly Developed Non-Invasive Prenatal Multi- Gene Sequencing Screen
1 // Performance of the Newly Developed Non-Invasive Prenatal Multi- Gene Sequencing Screen ABSTRACT Here we describe the analytical performance of the newly developed non-invasive prenatal multi-gene
More informationMatthew Tinning Australian Genome Research Facility. July 2012
Next-Generation Sequencing: an overview of technologies and applications Matthew Tinning Australian Genome Research Facility July 2012 History of Sequencing Where have we been? 1869 Discovery of DNA 1909
More informationNGS-based innovations within the Leiden Network
NGS-based innovations within the Leiden Network A strong bridge between two partners Dr. Mark de Jong 2017-09-29 Design accurate and robust NGS tests and generate data sets essential for Diagnostics &
More informationresequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics
RNA Sequencing T TM variation genetics validation SNP ncrna metagenomics private trio de novo exome mendelian ChIP-seq RNA DNA bioinformatics custom target high-throughput resequencing storage ncrna comparative
More informationUnderstanding the science and technology of whole genome sequencing
Understanding the science and technology of whole genome sequencing Dag Undlien Department of Medical Genetics Oslo University Hospital University of Oslo and The Norwegian Sequencing Centre d.e.undlien@medisin.uio.no
More informationHLA-Typing Strategies
HLA-Typing Strategies Cologne, 13.5.2017 Joannis Mytilineos MD, PhD Department of Transplantation Immunology Institute for Clinical Transfusion Medicine and Immunogenetics German Red Cross Blood Transfusion
More informationNext-Generation Sequencing Services à la carte
Next-Generation Sequencing Services à la carte www.seqme.eu ngs@seqme.eu SEQme 2017 All rights reserved The trademarks and names of other companies and products mentioned in this brochure are the property
More informationSEQUENCING FROM SAMPLE TO SEQUENCE READY
SEQUENCING FROM SAMPLE TO SEQUENCE READY ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES NOT ONCE, BUT EVERY TIME n The highest quality amplicons more sensitive, accurate, and specific n Full support for all
More informationNGS in Pathology Webinar
NGS in Pathology Webinar NGS Data Analysis March 10 2016 1 Topics for today s presentation 2 Introduction Next Generation Sequencing (NGS) is becoming a common and versatile tool for biological and medical
More informationAn Automated Pipeline for NGS Testing and Reporting in a Commercial Molecular Pathology Lab: The Genoptix Case
Cartagenia Bench Lab Case Study An Automated Pipeline for NGS Testing and Reporting in a Commercial Molecular Pathology Lab: The Genoptix Case At a Glance In this case study, you will learn: How the Molecular
More informationAccess Array BRCA1 / BRCA2 / TP53 Target-Specific Panel Build the highest quality amplicon libraries with qualified assays
DATA SHEET PN 100-3489 B1 Access Array BRCA1 / BRCA2 / TP53 Target-Specific Panel Build the highest quality amplicon libraries with qualified assays Covers 100% of the exons within the genes Supported
More informationSingle Nucleotide Variant Analysis. H3ABioNet May 14, 2014
Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide
More informationNext Generation Oncology Sequencing in your Laboratory. Built by pioneers in cancer genomics and liquid biopsy approaches PROGENEUS
PROGENEUS Next Generation Oncology Sequencing in your Laboratory Built by pioneers in cancer genomics and liquid biopsy approaches For Research Use Only. Not for iagnostic Purposes. personalgenome.com/progeneus
More informationwith drmid Dx for Illumina NGS systems
Performance Characteristics BRCA MASTR Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Revision date: July 27, 2017 Page 1 of 8 Table of Contents
More informationIllumina s Suite of Targeted Resequencing Solutions
Illumina s Suite of Targeted Resequencing Solutions Colin Baron Sr. Product Manager Sequencing Applications 2011 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life,
More informationGenetic Units (GenUs) 2016 version: Instructions for use and table of GenU bands General instructions
Genetic Units (GenUs) 2016 version: Instructions for use and table of GenU bands The following notes are designed to ensure laboratories collect and report workload data consistently for UKGTN annual returns
More informationVariant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4
WHITE PAPER Oncomine Comprehensive Assay Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4 Contents Scope and purpose of document...2 Content...2 How Torrent
More informationSURESELECTXT LOW INPUT TARGET ENRICHMENT
SURESELECTXT LOW INPUT TARGET ENRICHMENT Low Input FFPE Optimized Streamlined Workflow SureSelect XT Low Input What is it? SureSelect XT Low Input is a low-input, FFPE-optimized library preparation kit.
More informationThese products are sold FOR RESEARCH USE ONLY; not for use in diagnostic procedures.
Minimal Residual Disease (MRD) testing by Next- Generation Sequencing (NGS) has become an important methodology demonstrating clear potential to optimize therapeutic management of lymphoproliferative diseases.
More informationGenome Resequencing. Rearrangements. SNPs, Indels CNVs. De novo genome Sequencing. Metagenomics. Exome Sequencing. RNA-seq Gene Expression
Genome Resequencing De novo genome Sequencing SNPs, Indels CNVs Rearrangements Metagenomics RNA-seq Gene Expression Splice Isoform Abundance High Throughput Short Read Sequencing: Illumina Exome Sequencing
More informationEmma Huxley. Principal Clinical Scientist West Midlands Regional Genetics Laboratory
Genetic Analysis Using a High Density SNP Array in Myelodysplastic Syndrome: Clinical Utility and Comparative Analysis Study Compared to Metaphase Chromosome Analysis. Emma Huxley Principal Clinical Scientist
More informationAnalytics Behind Genomic Testing
A Quick Guide to the Analytics Behind Genomic Testing Elaine Gee, PhD Director, Bioinformatics ARUP Laboratories 1 Learning Objectives Catalogue various types of bioinformatics analyses that support clinical
More informationHighly Sensitive, Multiplexed ctdna Mutation Detection on MassARRAY :
Highly Sensitive, Multiplexed ctdna Mutation Detection on MassARRAY : Lung & Colon Cancer Panel Pre-Launch & Data Sharing 栾晓辉, Ph.D. Senior Scientist, Application Development Agena Bioscience, Greater
More informationA new paradigm in testing for NSCLC-targeted therapies
A new paradigm in testing for NSCLC-targeted therapies Accelerate results, from sample to report, with the first IVD NGS-based test NEW Oncomine Dx Target Test The Ion Torrent Oncomine Dx Target Test is
More informationFFPE in your NGS Study
FFPE in your NGS Study Richard Corbett Canada s Michael Smith Genome Sciences Centre Vancouver, British Columbia Dec 6, 2017 Our mandate is to advance knowledge about cancer and other diseases and to use
More informationIon S5 and Ion S5 XL Systems
Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Explore the Ion S5 and Ion S5 XL Systems Adopting next-generation sequencing (NGS) in your lab is now simpler than ever The Ion S5
More informationGenomic Technologies. Michael Schatz. Feb 1, 2018 Lecture 2: Applied Comparative Genomics
Genomic Technologies Michael Schatz Feb 1, 2018 Lecture 2: Applied Comparative Genomics Welcome! The primary goal of the course is for students to be grounded in theory and leave the course empowered to
More informationPowering the Synthetic Biology and Genomics Revolutions
Powering the Synthetic Biology and Genomics Revolutions Advances in Genome Biology and Technology Marco Island, Florida February 28, 2019 Safe Harbor Statement This presentation contains forward-looking
More informationNormal-Tumor Comparison using Next-Generation Sequencing Data
Normal-Tumor Comparison using Next-Generation Sequencing Data Chun Li Vanderbilt University Taichung, March 16, 2011 Next-Generation Sequencing First-generation (Sanger sequencing): 115 kb per day per
More informationMutation analysis in cell-free DNA from cancer patients
Mutation analysis in cell-free DNA from cancer patients dr. Anneleen Beckers project manager & product manager at Biogazelle CRIG s digital PCR mini-symposium, May 15, 2018 2018 Biogazelle. All rights
More informationWhole genome sequencing in the UK Biobank
Whole genome sequencing in the UK Biobank Part of the UK Government s Industrial Strategy Challenge Fund (ISCF) for the Data to Early Diagnosis and Precision Medicine initiative Aim to produce deep characterisation
More informationPractical Considerations for Implementation of Clinical Sequencing. Emily Winn-Deen, Ph.D. April 2017
Practical Considerations for Implementation of Clinical Sequencing Emily Winn-Deen, Ph.D. April 2017 1. DEFINE THE CLINICAL PROBLEM TO BE ADDRESSED Focused panels Targeted Gene Panels Gene or disease-based
More informationSamantha Court Genetic Technologist (Birmingham)
National Genetic Technologist/Healthcare Science Practitioner Training Day Cardiff - 22 nd November 2017 Samantha Court Genetic Technologist (Birmingham) ccf DNA is released from all cells undergoing apoptosis
More informationGenomic & RNA Profiling Core Facility
Baylor College of Medicine Genomic & RNA Profiling Core Facility Services Price List Effective July 2018 PLEASE NOTE: All prices listed are for internal Baylor College of Medicine researchers with the
More informationACCEL-NGS 2S DNA LIBRARY KITS
ACCEL-NGS 2S DNA LIBRARY KITS Accel-NGS 2S DNA Library Kits produce high quality libraries with an all-inclusive, easy-to-use format. The kits contain all reagents necessary to build high complexity libraries
More information