Stefano Monti. Workshop Format
|
|
- Pearl Reeves
- 6 years ago
- Views:
Transcription
1 Gad Getz Stefano Monti Michael Reich Broad Institute of MIT & Harvard October 18-20, 2006 Cambridge, MA Workshop Format Morning lectures: Principles of statistics, machine learning and pattern recognition. Their application to the analysis of gene expression data. Afternoon hands-on on s: Practice sessions w/ GenePattern. Application of the concepts presented in the lectures. 1
2 User Profile Knowledge of basic mathematical concepts assumed (square root, log, function, ) No (or little) previous analysis experience required. Basic familiarity with microarrays and expression analysis terms. Mixed audience: nobody satisfied. Outline of the course Lectures Day 1: Introduction: Functional Genomics GenePattern mini-tutorial FG Pipeline: Data Acquisition Preprocessing & Visualization Day 2: Supervised Analysis Differential analysis/gsea Class Prediction/Classification Validation Day 3: [Survival analysis] Unsupervised Analysis Clustering, Bi-clustering Annotation Hands-on on s Day 1: Preprocessing Data visualization/dimensionality reduction: HeatMaps PCA,NMF,MDS Day 2: Differential Analysis/Annotation Classification: Model building/selection Evaluation Day 3: Day 3: Clustering: HC, NMF, CC, Bi-clustering GO Annotation Final Project 2
3 The use of high-throughput gene expression micro-arrays and computational tools for molecular profiling. Functional genomics definition The use of systematic approaches to answer questions for the majority of genes in a genome, including when is a gene expressed? with which other genes does it interact? what phenotype results if a gene is switched-on/-off/mutated? Functional genomics aspires to answer such questions systematically for all genes in a genome in contrast to conventional approaches that do so for one gene at a time. 3
4 Paradigm for Functional Genomics Biological States/ Phenotypes Tumor vs. Normal Chemical treatment vs. untreated Remission vs. Refractory Disease Successful vs. unsuccessful Treatment i Time courses Readouts Polymorphism Mutation Loss of Heterozigosity Expression Levels Analysis and Understanding Protein Relative abundance Modification Activity Statistical What pathways inference are affected by a disease? Statistics Classification/Prediction Machine Learning What pathways are modulated by a specific drug? Clustering Pattern Recognition What signatures predict tumor type or patient Feature outcome? extraction / projection Pattern discovery What genes confer susceptibility to disease? Network extraction High-throughput assays technologies Polymorphism Copy number variation Loss of Heterozigosity SNP arrays CGH arrays sequencing Expression levels Microarrays SAGE Protein Relative abundance Modification Activity Mass Spectrometry ChIP2chip 4
5 High-throughput assays technologies Polymorphism Copy number variation Loss of Heterozigosity SNP arrays CGH arrays Expression levels Microarrays SAGE Protein Relative abundance Modification Activity Mass Spectrometry ChIP2chip m micro-array Measures the gene activity of 10K of genes at once Read out organized in a high-dimensional numerical matrix Samples Genes Transcription translation Traits Diseases Proteins Physiology m Metabolism Drug Resistance Computational analysis 5
6 Number of articles PubMed query: microarray in title/abstract No. of articles Year Extrapolated from first 5 months The functional genomics pipeline Experimental design affects outcome data analysis Data acquisition microarray processing Data preprocessing scaling/normalization/filtering Data analysis/hypothesis generation Supervised Analysis Differential analysis, Classification, Unsupervised Analysis Clustering, Bi-clustering, Enrichment analysis GO annotation, GSEA, Validation/Annotation In silico testing Cross validation, train/test, etc, In vitro testing Back to the lab 6
7 Introductory references 1. Hastie, T, Tibshirani R, and Friedman J. The Elements of Statistical Learning. Springer-Verlag, Nature Genetics supplements: The Chipping Forecast I [Nat Genet, 21(1s), 1999], II [Nat Genet, 32(4s), 2002], III [Nat Genet, 37(6s), 2005]. 3. Allison, D. B., Cui, X., Page, G. P., and Sabripour, M. Microarray data analysis: from disarray to consolidation and consensus. Nat Rev Genet, 7: 55-65, Hoffman, E. P., Awad, T., et al. Expression Profiling - Best Practices for Data Generation and Interpretation in Clinical Trials. Nat Rev Genet, 5: , Larkin, J. E., Frank, B. C., et al. Independence and reproducibility across microarray platforms. Nat Meth, 2: , Irizarry, R. A., Warren, D., et al. Multiple-laboratory comparison of microarray platforms. Nat Meth, 2: ,
Biology 644: Bioinformatics
Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review Visualizing
More informationResearch Powered by Agilent s GeneSpring
Research Powered by Agilent s GeneSpring Agilent Technologies, Inc. Carolina Livi, Bioinformatics Segment Manager Research Powered by GeneSpring Topics GeneSpring (GS) platform New features in GS 13 What
More information11/22/13. Proteomics, functional genomics, and systems biology. Biosciences 741: Genomics Fall, 2013 Week 11
Proteomics, functional genomics, and systems biology Biosciences 741: Genomics Fall, 2013 Week 11 1 Figure 6.1 The future of genomics Functional Genomics The field of functional genomics represents the
More informationGene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis
Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods
More informationComprehensive Extensible Reproducible Accessible Available. Jill P. Mesirov
Comprehensive Extensible Reproducible Accessible Available Jill P. Mesirov ITCR PI Meeting June 14, 2016 Outline GenePattern: overview and activity The GenePattern electronic notebook: overview and status
More informationFrom Proteomics to Systems Biology. Integration of omics - information
From Proteomics to Systems Biology Integration of omics - information Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - data What
More informationEcological genomics and molecular adaptation: state of the Union and some research goals for the near future.
Ecological genomics and molecular adaptation: state of the Union and some research goals for the near future. Louis Bernatchez Genomics and Conservation of Aquatic Resources Université LAVAL! Molecular
More informationKnowledge-Guided Analysis with KnowEnG Lab
Han Sinha Song Weinshilboum Knowledge-Guided Analysis with KnowEnG Lab KnowEnG Center Powerpoint by Charles Blatti Knowledge-Guided Analysis KnowEnG Center 2017 1 Exercise In this exercise we will be doing
More informationOur website:
Biomedical Informatics Summer Internship Program (BMI SIP) The Department of Biomedical Informatics hosts an annual internship program each summer which provides high school, undergraduate, and graduate
More informationPioneering Clinical Omics
Pioneering Clinical Omics Clinical Genomics Strand NGS An analysis tool for data generated by cutting-edge Next Generation Sequencing(NGS) instruments. Strand NGS enables read alignment and analysis of
More informationEngineering Genetic Circuits
Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art
More informationThis place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.
G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic
More informationOutline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information
From to Systems Biology Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - What can we learn Limitations Integration of omics - In-class
More informationFrumkin, 2e Part 1: Methods and Paradigms. Chapter 6: Genetics and Environmental Health
Frumkin, 2e Part 1: Methods and Paradigms Chapter 6: Genetics and Environmental Health Genetics Genetics, the study of individual genes, has expanded to include genomics, which is the study of all the
More informationMicroarrays & Gene Expression Analysis
Microarrays & Gene Expression Analysis Contents DNA microarray technique Why measure gene expression Clustering algorithms Relation to Cancer SAGE SBH Sequencing By Hybridization DNA Microarrays 1. Developed
More informationShort Course Instructors
Short Course Instructors Andrew Allen, Ph.D., Professor of Biostatistics and Bioinformatics and Director of the new Duke Center of Statistical Genetics and Genomics, Duke University, has expertise in statistical
More informationMicrobial Metabolism Systems Microbiology
1 Microbial Metabolism Systems Microbiology Ching-Tsan Huang ( 黃慶璨 ) Office: Agronomy Hall, Room 111 Tel: (02) 33664454 E-mail: cthuang@ntu.edu.tw MIT OCW Systems Microbiology aims to integrate basic biological
More informationCapabilities & Services
Capabilities & Services Accelerating Research & Development Table of Contents Introduction to DHMRI 3 Services and Capabilites: Genomics 4 Proteomics & Protein Characterization 5 Metabolomics 6 In Vitro
More informationPersonalized Human Genome Sequencing
Personalized Human Genome Sequencing Dr. Stefan Platz DABT, Global Head Drug Safety & Metabolism Biomedical research: strengths & limitations of non-animal alternatives 06 December 2016 The Human Genome
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru
More informationGREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
More informationGenetics and Bioinformatics
Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s
More informationMachine Learning in Computational Biology CSC 2431
Machine Learning in Computational Biology CSC 2431 Lecture 9: Combining biological datasets Instructor: Anna Goldenberg What kind of data integration is there? What kind of data integration is there? SNPs
More informationMicroarray Gene Expression Analysis at CNIO
Microarray Gene Expression Analysis at CNIO Orlando Domínguez Genomics Unit Biotechnology Program, CNIO 8 May 2013 Workflow, from samples to Gene Expression data Experimental design user/gu/ubio Samples
More informationIdentification of biological themes in microarray data from a mouse heart development time series using GeneSifter
Identification of biological themes in microarray data from a mouse heart development time series using GeneSifter VizX Labs, LLC Seattle, WA 98119 Abstract Oligonucleotide microarrays were used to study
More informationWhat is Bioinformatics?
What is Bioinformatics? Bioinformatics is the field of science in which biology, computer science, and information technology merge to form a single discipline. - NCBI The ultimate goal of the field is
More informationROAD TO STATISTICAL BIOINFORMATICS CHALLENGE 1: MULTIPLE-COMPARISONS ISSUE
CHAPTER1 ROAD TO STATISTICAL BIOINFORMATICS Jae K. Lee Department of Public Health Science, University of Virginia, Charlottesville, Virginia, USA There has been a great explosion of biological data and
More informationExpression Profiling for
RNAi Screen, NGS and Expression Profiling for Biomarker Discovery Namjin Chung Applied Genomics Bristol-Myers Squibb 2012 DOT Oct 2, 2012 Boston, MA Pharmacogenomics Study of the role of inheritance in
More informationBIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology. Lecture 2: Microarray analysis
BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology Lecture 2: Microarray analysis Genome wide measurement of gene transcription using DNA microarray Bruce Alberts, et al., Molecular Biology
More informationChapter 1. from genomics to proteomics Ⅱ
Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more
More informationBayer Pharma s High Tech Platform integrates technology experts worldwide establishing one of the leading drug discovery research platforms
Bayer Pharma s High Tech Platform integrates technology experts worldwide establishing one of the leading drug discovery research platforms Genomics Bioinformatics HTS Combinatorial chemistry Protein drugs
More informationMICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE
MICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE National Center for Biotechnology Information With only a few exceptions, every
More informationIntegrative Genomics 1a. Introduction
2016 Course Outline Integrative Genomics 1a. Introduction ggibson.gt@gmail.com http://www.cig.gatech.edu 1a. Experimental Design and Hypothesis Testing (GG) 1b. Normalization (GG) 2a. RNASeq (MI) 2b. Clustering
More informationAGILENT S BIOINFORMATICS ANALYSIS SOFTWARE
ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS
More informationBIMM 143: Introduction to Bioinformatics (Winter 2018)
BIMM 143: Introduction to Bioinformatics (Winter 2018) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bimm143_w18/ DRAFT: 2017-12-02 (20:48:10 PST
More informationPh.D. Program in Genetics, Genomics, and Cancer Biology
Ph.D. Program in Genetics, Genomics, and Cancer Biology Program Requirements Required Courses Credits GE 501, 511, 521, 531 Experimental Methods Pre-entry, I, II, III (3 research rotations are usually
More informationEstimating Cell Cycle Phase Distribution of Yeast from Time Series Gene Expression Data
2011 International Conference on Information and Electronics Engineering IPCSIT vol.6 (2011) (2011) IACSIT Press, Singapore Estimating Cell Cycle Phase Distribution of Yeast from Time Series Gene Expression
More informationSupervised Learning from Micro-Array Data: Datamining with Care
November 18, 2002 Stanford Statistics 1 Supervised Learning from Micro-Array Data: Datamining with Care Trevor Hastie Stanford University November 18, 2002 joint work with Robert Tibshirani, Balasubramanian
More informationAn Automated Pipeline for NGS Testing and Reporting in a Commercial Molecular Pathology Lab: The Genoptix Case
Cartagenia Bench Lab Case Study An Automated Pipeline for NGS Testing and Reporting in a Commercial Molecular Pathology Lab: The Genoptix Case At a Glance In this case study, you will learn: How the Molecular
More informationMotivation From Protein to Gene
MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein
More informationCharacterizing DNA binding sites high throughput approaches Biol4230 Tues, April 24, 2018 Bill Pearson Pinn 6-057
Characterizing DNA binding sites high throughput approaches Biol4230 Tues, April 24, 2018 Bill Pearson wrp@virginia.edu 4-2818 Pinn 6-057 Reviewing sites: affinity and specificity representation binding
More informationBiomedical Big Data and Precision Medicine
Biomedical Big Data and Precision Medicine Jie Yang Department of Mathematics, Statistics, and Computer Science University of Illinois at Chicago October 8, 2015 1 Explosion of Biomedical Data 2 Types
More informationCan Semantic Web Technologies enable Translational Medicine? (Or Can Translational Medicine help enrich the Semantic Web?)
Can Semantic Web Technologies enable Translational Medicine? (Or Can Translational Medicine help enrich the Semantic Web?) Vipul Kashyap 1, Tonya Hongsermeier 1, Samuel Aronson 2 1 Clinical Informatics
More informationRecent years have witnessed an expansion in the disciplines encompassing drug
Course overview Recent years have witnessed an expansion in the disciplines encompassing drug discovery outside the pharmaceutical industry. This is most notable with a significant number of Universities
More informationMeasuring gene expression
Measuring gene expression Grundlagen der Bioinformatik SS2018 https://www.youtube.com/watch?v=v8gh404a3gg Agenda Organization Gene expression Background Technologies FISH Nanostring Microarrays RNA-seq
More informationIntroduction to BIOINFORMATICS
COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/
More informationComplex Adaptive Systems Forum: Transformative CAS Initiatives in Biomedicine
Complex Adaptive Systems Forum: Transformative CAS Initiatives in Biomedicine January 18, 2013 Anna D. Barker, Ph.D. Director, Transformative Healthcare Networks C-Director, Complex Adaptive Systems Initiative
More informationProgress and Future Directions in Integrated Systems Toxicology. Mary McBride Agilent Technologies
Progress and Future Directions in Integrated Systems Toxicology Mary McBride Agilent Technologies 1 Toxicity testing tools of the late 20 th century Patchwork approach to testing dates back to the 1930
More informationIntroduction to Microarray Technique, Data Analysis, Databases Maryam Abedi PhD student of Medical Genetics
Introduction to Microarray Technique, Data Analysis, Databases Maryam Abedi PhD student of Medical Genetics abedi777@ymail.com Outlines Technology Basic concepts Data analysis Printed Microarrays In Situ-Synthesized
More informationGoals of pharmacogenomics
Goals of pharmacogenomics Use drugs better and use better drugs! People inherit/exhibit differences in drug: Absorption Metabolism and degradation of the drug Transport of drug to the target molecule Excretion
More informationIntroduction to Bioinformatics and Gene Expression Technology
Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA
More informationOutline. Analysis of Microarray Data. Most important design question. General experimental issues
Outline Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization Introduction to microarrays Experimental design Data normalization Other data transformation Exercises George Bell,
More informationadvanced analysis of gene expression microarray data aidong zhang World Scientific State University of New York at Buffalo, USA
advanced analysis of gene expression microarray data aidong zhang State University of New York at Buffalo, USA World Scientific NEW JERSEY LONDON SINGAPORE BEIJING SHANGHAI HONG KONG TAIPEI CHENNAI Contents
More informationGenomes contain all of the information needed for an organism to grow and survive.
Section 3: Genomes contain all of the information needed for an organism to grow and survive. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the components of the
More informationBenno Pütz. MPI of Psychiatry
Benno Pütz Lifetime prevalence ~20% Treatment response CC CT TT Binder et al., Nature Genetics 2004 Drug transport Dosierung Drug transport Text Uhr et al., Neuron, 2008 150 years ago Gregor Mendel Inheritance
More informationBIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM)
BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM) PROGRAM TITLE DEGREE TITLE Master of Science Program in Bioinformatics and System Biology (International Program) Master of Science (Bioinformatics
More informationThe first and only fully-integrated microarray instrument for hands-free array processing
The first and only fully-integrated microarray instrument for hands-free array processing GeneTitan Instrument Transform your lab with a GeneTitan Instrument and experience the unparalleled power of streamlining
More informationMM12-A ISBN Volume 26 Number 20 ISSN Diagnostic Nucleic Acid Microarrays; Approved Guideline
ISBN 1-56238-608-5 Number 20 ISSN 0273-3099 Diagnostic Nucleic Acid Microarrays; Approved Guideline Joseph L. Hackett, PhD Kellie J. Archer, PhD Adolfas K. Gaigalas, PhD Carleton T. Garrett, MD, PhD Loren
More informationIntroduction to Microarray Analysis
Introduction to Microarray Analysis Methods Course: Gene Expression Data Analysis -Day One Rainer Spang Microarrays Highly parallel measurement devices for gene expression levels 1. How does the microarray
More informationExpressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes
Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Genes can be regulated at many levels Usually, gene regulation, are referring to transcriptional
More informationWhat we ll do today. Types of stem cells. Do engineered ips and ES cells have. What genes are special in stem cells?
Do engineered ips and ES cells have similar molecular signatures? What we ll do today Research questions in stem cell biology Comparing expression and epigenetics in stem cells asuring gene expression
More informationI.1 The Principle: Identification and Application of Molecular Markers
I.1 The Principle: Identification and Application of Molecular Markers P. Langridge and K. Chalmers 1 1 Introduction Plant breeding is based around the identification and utilisation of genetic variation.
More informationGene expression connectivity mapping and its application to Cat-App
Gene expression connectivity mapping and its application to Cat-App Shu-Dong Zhang Northern Ireland Centre for Stratified Medicine University of Ulster Outline TITLE OF THE PRESENTATION Gene expression
More informationAn Automated Pipeline for NGS Testing and Reporting in a Commercial Molecular Pathology Lab: The Genoptix Case
Bench Lab CASE STUDY An Automated Pipeline for NGS Testing and Reporting in a Commercial Molecular Pathology Lab: The Genoptix Case Authors: Matthew J. McGinniss 1, PhD FACMG, Executive Director, Molecular
More informationDo engineered ips and ES cells have similar molecular signatures?
Do engineered ips and ES cells have similar molecular signatures? Comparing expression and epigenetics in stem cells George Bell, Ph.D. Bioinformatics and Research Computing 2012 Spring Lecture Series
More informationAdvancing Life Sciences
Advancing Life Sciences Sweden s largest center for life sciences A national resource SciLifeLab, Science for Life Laboratory, is a Swedish national center for molecular biosciences, with the mission to
More informationUnderstanding life WITH NEXT GENERATION PROTEOMICS SOLUTIONS
Innovative services and products for highly multiplexed protein discovery and quantification to help you understand the biological processes that shape life. Understanding life WITH NEXT GENERATION PROTEOMICS
More informationMachine Learning. HMM applications in computational biology
10-601 Machine Learning HMM applications in computational biology Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Biological data is rapidly
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationFundamentals of Clinical Genomics
Fundamentals of Clinical Genomics Wellcome Genome Campus Hinxton, Cambridge, UK 17-19 January 2018 Lectures and Workshops to be held in the Rosalind Franklin Pavilion Lunch and Dinner to be held in the
More informationFrom Genotype to Phenotype
From Genotype to Phenotype Johanna Vilkki Green technology, Natural Resources Institute Finland Systems biology Genome Transcriptome genes mrna Genotyping methodology SNP TOOLS, WG SEQUENCING Functional
More informationBasics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility
2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,
More informationStatistical Methods for Network Analysis of Biological Data
The Protein Interaction Workshop, 8 12 June 2015, IMS Statistical Methods for Network Analysis of Biological Data Minghua Deng, dengmh@pku.edu.cn School of Mathematical Sciences Center for Quantitative
More informationMeasuring and Understanding Gene Expression
Measuring and Understanding Gene Expression Dr. Lars Eijssen Dept. Of Bioinformatics BiGCaT Sciences programme 2014 Why are genes interesting? TRANSCRIPTION Genome Genomics Transcriptome Transcriptomics
More informationDNA Studies (Genetic Studies) Disclosure Statement. Definition of Genomics. Outline. Immediate Present and Near Future
Advances in Genetic Marker Evaluation Prior to Vascular Access Creation Timmy Lee, M.D., M.S.P.H., F.A.C.P., F.A.S.N. Assistant Professor of Medicine Division of Nephrology and Hypertension University
More informationIntroduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013
Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance
More informationTooling up for Functional Genomics
Tooling up for Functional Genomics Michael Abberton, Iain Donnison, Phil Morris, Helen Ougham, Mark Robbins, Howard Thomas From model to crop species 6 Genomes and genome mapping 7 The transcriptome 7
More informationMicroarrays in Diagnostics and Biomarker Development
Microarrays in Diagnostics and Biomarker Development . Editor Microarrays in Diagnostics and Biomarker Development Current and Future Applications Editor CoReBio PACA Luminy Science Park 13288 Marseille
More informationBioinformatics for Biologists
Bioinformatics for Biologists Microarray Data Analysis. Lecture 1. Fran Lewitter, Ph.D. Director Bioinformatics and Research Computing Whitehead Institute Outline Introduction Working with microarray data
More informationBABELOMICS: Microarray Data Analysis
BABELOMICS: Microarray Data Analysis Madrid, 21 June 2010 Martina Marbà mmarba@cipf.es Bioinformatics and Genomics Department Centro de Investigación Príncipe Felipe (CIPF) (Valencia, Spain) DNA Microarrays
More informationLearning theory: SLT what is it? Parametric statistics small number of parameters appropriate to small amounts of data
Predictive Genomics, Biology, Medicine Learning theory: SLT what is it? Parametric statistics small number of parameters appropriate to small amounts of data Ex. Find mean m and standard deviation s for
More informationMulti-omics in biology: integration of omics techniques
31/07/17 Летняя школа по биоинформатике 2017 Multi-omics in biology: integration of omics techniques Konstantin Okonechnikov Division of Pediatric Neurooncology German Cancer Research Center (DKFZ) 2 Short
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Introduction
More informationA PROTEIN INTERACTION NETWORK OF THE MALARIA PARASITE PLASMODIUM FALCIPARUM
A PROTEIN INTERACTION NETWORK OF THE MALARIA PARASITE PLASMODIUM FALCIPARUM DOUGLAS J. LACOUNT, MARISSA VIGNALI, RAKESH CHETTIER, AMIT PHANSALKAR, RUSSELL BELL, JAY R. HESSELBERTH, LORI W. SCHOENFELD,
More informationAssociation Mapping. Mendelian versus Complex Phenotypes. How to Perform an Association Study. Why Association Studies (Can) Work
Genome 371, 1 March 2010, Lecture 13 Association Mapping Mendelian versus Complex Phenotypes How to Perform an Association Study Why Association Studies (Can) Work Introduction to LOD score analysis Common
More informationSAS Microarray Solution for the Analysis of Microarray Data. Susanne Schwenke, Schering AG Dr. Richardus Vonk, Schering AG
for the Analysis of Microarray Data Susanne Schwenke, Schering AG Dr. Richardus Vonk, Schering AG Overview Challenges in Microarray Data Analysis Software for Microarray Data Analysis SAS Scientific Discovery
More informationWhole Genome Sequencing in Cancer Diagnostics (research) Nederlandse Pathologiedagen 19 & 20 November 2015
Whole Genome Sequencing in Cancer Diagnostics (research) Nederlandse Pathologiedagen 19 & 20 November 2015 Dr. I.J. Nijman Disclosure slide (Potential) conflict of interest None For this meeting relevant
More informationPredicting Transcription Factors Binding Sites With Deep Learning
Predicting Transcription Factors Binding Sites With Deep Learning Yurii Toma (yurii.toma@ut.ee) Kaur Alasoo (kaur.alasoo@gmail.com) Dmytro Fishman (dmytrofishman@gmail.com) What is the central dogma of
More informationNetwork System Inference
Network System Inference Francis J. Doyle III University of California, Santa Barbara Douglas Lauffenburger Massachusetts Institute of Technology WTEC Systems Biology Final Workshop March 11, 2005 What
More informationPharmacogenetics: A SNPshot of the Future. Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001
Pharmacogenetics: A SNPshot of the Future Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001 1 I. What is pharmacogenetics? It is the study of how genetic variation affects drug response
More informationMassARRAY Genetic Analysis System. Genotyping Methylation Analysis Molecular Typing Somatic Mutation Profiling Quantitative Gene Expression (QGE)
MassARRAY Genetic Analysis System Genotyping Methylation Analysis Molecular Typing Somatic Mutation Profiling Quantitative Gene Expression (QGE) MassARRAY Genetic Analysis System * Overview Next-generation
More informationNGS Approaches to Epigenomics
I519 Introduction to Bioinformatics, 2013 NGS Approaches to Epigenomics Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Contents Background: chromatin structure & DNA methylation Epigenomic
More informationMayo Clinic Arizona/Rochester and U. Minnesota
Mayo Clinic Arizona/Rochester and U. Minnesota Overcoming Drug Resistance in Multiple Myeloma Project 1: Develop high throughput drug screening platform for myeloma cell lines and >500 primary patient
More informationEffects of Different Normalization Methods on Gene Set Enrichment Analysis (GSEA)
Effects of Different Normalization Methods on Gene Set Enrichment Analysis (GSEA) Ming Zhao Tutor: Dr. Mengjin Zhu 12th, Nov, 2011 Key Laboratory of Agricultural Animal Genetics, Breeding and Reproduction
More informationBioinformatics Analysis of Nano-based Omics Data
Bioinformatics Analysis of Nano-based Omics Data Penny Nymark, Pekka Kohonen, Vesa Hongisto and Roland Grafström Hands-on Workshop on Nano Safety Assessment, 29 th September, 2016, National Technical University
More informationHow Targets Are Chosen. Chris Wayman 12 th April 2012
How Targets Are Chosen Chris Wayman 12 th April 2012 A few questions How many ideas does it take to make a medicine? 10 20 20-50 50-100 A few questions How long does it take to bring a product from bench
More informationIs the grass greener on the other side.? Academia to Industry Stephen B. Helliwell
Is the grass greener on the other side.? Academia to Industry Stephen B. Helliwell Senior Investigator, Novartis Institutes for BioMedical Research Is the grass greener? http://eatrio.net/2013/04/portuguese-idioms-joao-sem-braco.html
More informationDNA Microarrays Introduction Part 2. Todd Lowe BME/BIO 210 April 11, 2007
DNA Microarrays Introduction Part 2 Todd Lowe BME/BIO 210 April 11, 2007 Reading Assigned For Friday, please read two papers and be prepared to discuss in detail: Comprehensive Identification of Cell Cycle-related
More information