measuring gene expression December 5, 2017

Size: px
Start display at page:

Download "measuring gene expression December 5, 2017"

Transcription

1 measuring gene expression December 5, 2017

2

3 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA do not encode proteins

4 RNA encodes proteins

5

6 Early studies indicated that gene lengths could sometimes be much greater than mrna lengths

7 Early studies indicated that gene lengths could sometimes be much greater than mrna lengths processed transcript (mrna) unprocessed transcript (pre-mrna)

8 eukaryotic gene structure was quite a surprise!

9 Enhancer Promoter exon intron exon intron exon polya signal 5 UTR 3 UTR CAAT TATA 5 3 Start point for transcription Start point for Translation (AUG) Terminator for translation (UGA, UAA, UAG)

10 Enhancer Promoter exon intron exon intron exon polya signal 5 UTR 3 UTR CAAT TATA 5 transcription 3 Pre-mRNA

11 Enhancer Promoter exon intron exon intron exon polya signal 5 UTR 3 UTR CAAT TATA 5 transcription 3 Pre-mRNA mrna splicing

12 Enhancer Promoter exon intron exon intron exon polya signal 5 UTR 3 UTR CAAT TATA 5 transcription 3 Pre-mRNA mrna splicing translation

13 Intervening Sequences (introns): how does the cell get rid of them? Splicing!!! Highly conserved ribonucleoprotein complex recognizes intron/exon junctions and guides intron excision. This process is responsible for much of the diversity of proteins, and is closely regulated.

14 Intervening Sequences (introns): what are they good for? When introducing a sequence into a cell system for overexpression, things work better if the sequence has an intron. nonsense mediated decay requires introns may be a buffer for mutation or a way to shuffle protein domains creating variation by alternative splicing

15 Alternative Splicing

16 Alternative Splicing

17 gene expression analysis what genomic regions are being transcribed? which transcripts are being made, from those regions? what is the rate/level of transcription from a region? does expression from those regions change under certain conditions? remember, though, that gene expression!= cell function

18 challenges in studying gene expression transcript abundance mapping annotation quantitation comparing across experiments technical variability biological variability

19 annotation how can we find genes? observe RNA product observe protein product orthology (reciprocal best hit or similar method) de novo prediction

20 laboratory methods abundance measurement variety of transcripts throughput protein methods quantitative low low Northern blot qualitative predetermined low cdna subtraction poorly quantitative comparative low differential display poorly quantitative comparative low ESTs/cDNA sequencing qualitative moderate moderate SAGE quantitative moderate moderate RT-PCR quantitative predetermined moderate microarray quantitative predetermined high RNAseq quantitative high high

21 SAGE (serial analysis of gene expression) generate a 9-10bp sequence tag for each transcript, concatenate tags and sequence them. Tags will be near 3 end of genes, increasing the specificity of the method.

22

23 SAGE (serial analysis of gene expression) key points: ditags should be unique, so multiple observations of the same ditag are assumed to be PCR duplicates. Identification of tagged genes relies on having good annotation.

24 gene expression analysis by microarray

25 gene expression analysis by microarray ~100M oligonucleotides fixed to a microscope slide. Labeled cdna is hybridized to the array and scanned. Because the background isn t consistent, signal intensity is typically defined by the foreground:background ratio for each spot B F

26 gene expression analysis by microarray advantages: relatively inexpensive (lots of replicates possible), statistical properties are well-described disadvantages: requires high input quantity, limited dynamic range, limited range of genomic targets, typically not useful for spliceoform detection

27 gene expression analysis by sequencing (RNAseq) advantages: allows very, very low input quantity, excellent dynamic range, genomic targets are not preselected, theoretically extraordinarily sensitive for splice site detection disadvantages: expensive, statistical properties not at all clear

28 RNAseq total RNA (rrna, mrna, trna, microrna etc) library preparation and sequencing rrna depletion strand specificity paired end vs single end read length coverage mapping splice-aware with or without annotation transcript count assignment, normalization compare transcript abundance between samples

29

30 alignment approaches map to transcriptome (RSEM and others) splice-aware alignment (TopHat, STAR and others) transcriptome assembly kmer/word counting without alignment (Sailfish and others) segment genome by differentially expressed regions (derfinder)

31 RNAseq alignment challenge reads are not contiguous with the reference genome transcript genome this read does not map contiguously to the reference genome paired ends spanning junctions may map very far apart on reference genome

32 RNAseq and alternative splicing some reads can be unambiguously assigned to a transcript, but others cannot.

33 Used by TCGA. RNAseq by expectation maximization Can use a reference genome with or without annotation. In either mode, multimapping reads are explicitly considered and the transcript abundance is derived at every position using a maximum likelihood model. Finally, Bayesian estimates of transcript abundance are provided. (and often paired with EBSeq)

34 EBSeq

35 EBSeq

36 uncertainty is proportional to the number of spliceoforms

37 TopHat: splice-aware aligner

38

39 TopHat

40 splice-aware alignment: STAR

41 splice-aware alignment: STAR

42 used in TCGA as second processing step

43

44

45

46 Scripture: hybrid alignment/transcriptome assembly

47

48

49

50 HMM-based method: segment genomic regions according to sequencing coverage, then estimate abundance from observations (a mixture of background signal, measurement error, and true signal) Analyses are done across multiple samples, without considering annotation.

51

52 steps in RNAseq analysis alignment and transcript assignment quantitation comparison among experiments (differential expression)

53 normalization when comparing two RNAseq experiments, read depth is a critical factor (nonbiological effect). Options for normalizing for read depth: 1) Reads per kilobase per million reads (RPKM) normalizes for read depth and gene size 2) trimmed mean of M-values (TMM) 3) DESeq size factor 4) quantile-based normalizations such as upper quartile normalization

54 upper quartile normalization Table 1 How do you know whether the increased counts in condition 2 for the first gene reflect higher transcription? it s possible that there were just more reads for this experiment. gene condition 1 condition 2 ENST ENST ENST ENST ENST ENST ENST ENST idea: gene expression measurements are more robust for highly expressed genes. Find the normalization factor for these genes and apply it to all genes measured. ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST

55 upper quartile normalization remove genes that have no counts in all experiments rank genes by expression, for each experiment separately identify the gene at the 75th percentile in each experiment. This will be the size factor for that experiment. divide expression levels for all genes by the expression of the gene at the 75th percentile, for each experiment can multiply by mean expression level of top quartile to restore counts to larger numbers if needed

56 sorted normalized gene condition 1 condition2 ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST gene condition 1 condition 2 ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST ENST

57 normalization other nonbiological factors include gene length and GC content. These are gene-specific and are often assumed to cancel out if comparisons are done gene by gene.

58

59 normalization: GC content doesn t cancel out

60 normalization: BASP1 isoform levels vary by center!?

61 methods for comparing expression levels Let s assume that RNAseq reads can be modeled with a Poisson distribution (drawing randomly from all possible RNA fragments) Then, for each gene, the mean expression is measured across replicates, and the variance is set to be equal to the mean (the lambda parameter). Comparing the expression of the gene between two conditions is then fairly straightforward.

62 methods for comparing expression levels Problem: the variance in gene expression is usually much greater than the mean (overdispersion) Solution: Use a negative binomial model. This can be derived as a gamma Poisson mixture model, assuming that technical replicates follow a Poisson distribution, and biological replicates follow a gamma distribution (accounts for overdispersion) DESeq and DESeq2 are excellent implementations of this method.

63 methods for comparing expression levels Many other methods exist, including Bayesian approaches, beta binomial estimation, and nonparametric. Different methods are often optimized for particular types of data.

measuring gene expression December 11, 2018

measuring gene expression December 11, 2018 measuring gene expression December 11, 2018 Intervening Sequences (introns): how does the cell get rid of them? Splicing!!! Highly conserved ribonucleoprotein complex recognizes intron/exon junctions and

More information

ChIP-seq and RNA-seq

ChIP-seq and RNA-seq ChIP-seq and RNA-seq Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions (ChIPchromatin immunoprecipitation)

More information

ChIP-seq and RNA-seq. Farhat Habib

ChIP-seq and RNA-seq. Farhat Habib ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions

More information

Transcriptome analysis

Transcriptome analysis Statistical Bioinformatics: Transcriptome analysis Stefan Seemann seemann@rth.dk University of Copenhagen April 11th 2018 Outline: a) How to assess the quality of sequencing reads? b) How to normalize

More information

Introduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013

Introduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance

More information

RNA-Seq Analysis. Simon Andrews, Laura v

RNA-Seq Analysis. Simon Andrews, Laura v RNA-Seq Analysis Simon Andrews, Laura Biggins simon.andrews@babraham.ac.uk @simon_andrews v2018-10 RNA-Seq Libraries rrna depleted mrna Fragment u u u u NNNN Random prime + RT 2 nd strand synthesis (+

More information

Analysis of data from high-throughput molecular biology experiments Lecture 6 (F6, RNA-seq ),

Analysis of data from high-throughput molecular biology experiments Lecture 6 (F6, RNA-seq ), Analysis of data from high-throughput molecular biology experiments Lecture 6 (F6, RNA-seq ), 2012-01-26 What is a gene What is a transcriptome History of gene expression assessment RNA-seq RNA-seq analysis

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

RNA-sequencing. Next Generation sequencing analysis Anne-Mette Bjerregaard. Center for biological sequence analysis (CBS)

RNA-sequencing. Next Generation sequencing analysis Anne-Mette Bjerregaard. Center for biological sequence analysis (CBS) RNA-sequencing Next Generation sequencing analysis 2016 Anne-Mette Bjerregaard Center for biological sequence analysis (CBS) Terms and definitions TRANSCRIPTOME The full set of RNA transcripts and their

More information

1. Introduction Gene regulation Genomics and genome analyses

1. Introduction Gene regulation Genomics and genome analyses 1. Introduction Gene regulation Genomics and genome analyses 2. Gene regulation tools and methods Regulatory sequences and motif discovery TF binding sites Databases 3. Technologies Microarrays Deep sequencing

More information

RNA-Sequencing analysis

RNA-Sequencing analysis RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges

More information

Genome annotation & EST

Genome annotation & EST Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary

More information

MODULE 5: TRANSLATION

MODULE 5: TRANSLATION MODULE 5: TRANSLATION Lesson Plan: CARINA ENDRES HOWELL, LEOCADIA PALIULIS Title Translation Objectives Determine the codons for specific amino acids and identify reading frames by looking at the Base

More information

Fig Ch 17: From Gene to Protein

Fig Ch 17: From Gene to Protein Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA

More information

Deep sequencing of transcriptomes

Deep sequencing of transcriptomes 1 / 40 Deep sequencing of transcriptomes An introduction to RNA-seq Michael Dondrup UNI BCCS 2. november 2010 2 / 40 Transcriptomics by Ultra-Fast Sequencing Microarrays have been the primary transcriptomics

More information

Sequence Analysis 2RNA-Seq

Sequence Analysis 2RNA-Seq Sequence Analysis 2RNA-Seq Lecture 10 2/21/2018 Instructor : Kritika Karri kkarri@bu.edu Transcriptome Entire set of RNA transcripts in a given cell for a specific developmental stage or physiological

More information

Transcription is the first stage of gene expression

Transcription is the first stage of gene expression Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the

More information

Analysis of RNA-seq Data. Bernard Pereira

Analysis of RNA-seq Data. Bernard Pereira Analysis of RNA-seq Data Bernard Pereira The many faces of RNA-seq Applications Discovery Find new transcripts Find transcript boundaries Find splice junctions Comparison Given samples from different experimental

More information

Analysis of RNA-seq Data

Analysis of RNA-seq Data Analysis of RNA-seq Data A physicist and an engineer are in a hot-air balloon. Soon, they find themselves lost in a canyon somewhere. They yell out for help: "Helllloooooo! Where are we?" 15 minutes later,

More information

Chapter 1. from genomics to proteomics Ⅱ

Chapter 1. from genomics to proteomics Ⅱ Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more

More information

An introduction to RNA-seq. Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy

An introduction to RNA-seq. Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy An introduction to RNA-seq Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy The central dogma Genome = all DNA in an organism (genotype) Transcriptome = all RNA (molecular

More information

Introduction of RNA-Seq Analysis

Introduction of RNA-Seq Analysis Introduction of RNA-Seq Analysis Jiang Li, MS Bioinformatics System Engineer I Center for Quantitative Sciences(CQS) Vanderbilt University September 21, 2012 Goal of this talk 1. Act as a practical resource

More information

RNA-SEQUENCING ANALYSIS

RNA-SEQUENCING ANALYSIS RNA-SEQUENCING ANALYSIS Joseph Powell SISG- 2018 CONTENTS Introduction to RNA sequencing Data structure Analyses Transcript counting Alternative splicing Allele specific expression Discovery APPLICATIONS

More information

Analysis of Biological Sequences SPH

Analysis of Biological Sequences SPH Analysis of Biological Sequences SPH 140.638 swheelan@jhmi.edu nuts and bolts meet Tuesdays & Thursdays, 3:30-4:50 no exam; grade derived from 3-4 homework assignments plus a final project (open book,

More information

Chapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc.

Chapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc. Chapter 8 Microbial Genetics Lectures prepared by Christine L. Case Structure and Function of Genetic Material Learning Objectives 8-1 Define genetics, genome, chromosome, gene, genetic code, genotype,

More information

Analysis of Biological Sequences SPH

Analysis of Biological Sequences SPH Analysis of Biological Sequences SPH 140.638 swheelan@jhmi.edu nuts and bolts meet Tuesdays & Thursdays, 3:30-4:50 no exam; grade derived from 3-4 homework assignments plus a final project (open book,

More information

Wheat CAP Gene Expression with RNA-Seq

Wheat CAP Gene Expression with RNA-Seq Wheat CAP Gene Expression with RNA-Seq July 9 th -13 th, 2018 Overview of the workshop, Alina Akhunova http://www.ksre.k-state.edu/igenomics/workshops/ RNA-Seq Workshop Activities Lectures Laboratory Molecular

More information

I. Gene Expression Figure 1: Central Dogma of Molecular Biology

I. Gene Expression Figure 1: Central Dogma of Molecular Biology I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases

More information

Finding Genes with Genomics Technologies

Finding Genes with Genomics Technologies PLNT2530 Plant Biotechnology (2018) Unit 7 Finding Genes with Genomics Technologies Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License

More information

RNA-Seq de novo assembly training

RNA-Seq de novo assembly training RNA-Seq de novo assembly training Training session aims Give you some keys elements to look at during read quality check. Transcriptome assembly is not completely a strait forward process : Multiple strategies

More information

RNA

RNA RNA sequencing Michael Inouye Baker Heart and Diabetes Institute Univ of Melbourne / Monash Univ Summer Institute in Statistical Genetics 2017 Integrative Genomics Module Seattle @minouye271 www.inouyelab.org

More information

Fermentation. Lesson Overview. Lesson Overview 13.1 RNA

Fermentation. Lesson Overview. Lesson Overview 13.1 RNA 13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to

More information

Statistical Genomics and Bioinformatics Workshop. Genetic Association and RNA-Seq Studies

Statistical Genomics and Bioinformatics Workshop. Genetic Association and RNA-Seq Studies Statistical Genomics and Bioinformatics Workshop: Genetic Association and RNA-Seq Studies RNA Seq and Differential Expression Analysis Brooke L. Fridley, PhD University of Kansas Medical Center 1 Next-generation

More information

Experimental Design. Dr. Matthew L. Settles. Genome Center University of California, Davis

Experimental Design. Dr. Matthew L. Settles. Genome Center University of California, Davis Experimental Design Dr. Matthew L. Settles Genome Center University of California, Davis settles@ucdavis.edu What is Differential Expression Differential expression analysis means taking normalized sequencing

More information

CH 17 :From Gene to Protein

CH 17 :From Gene to Protein CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there

More information

High performance sequencing and gene expression quantification

High performance sequencing and gene expression quantification High performance sequencing and gene expression quantification Ana Conesa Genomics of Gene Expression Lab Centro de Investigaciones Príncipe Felipe Valencia aconesa@cipf.es Next Generation Sequencing NGS

More information

7.2 Protein Synthesis. From DNA to Protein Animation

7.2 Protein Synthesis. From DNA to Protein Animation 7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They

More information

SO YOU WANT TO DO A: RNA-SEQ EXPERIMENT MATT SETTLES, PHD UNIVERSITY OF CALIFORNIA, DAVIS

SO YOU WANT TO DO A: RNA-SEQ EXPERIMENT MATT SETTLES, PHD UNIVERSITY OF CALIFORNIA, DAVIS SO YOU WANT TO DO A: RNA-SEQ EXPERIMENT MATT SETTLES, PHD UNIVERSITY OF CALIFORNIA, DAVIS SETTLES@UCDAVIS.EDU Bioinformatics Core Genome Center UC Davis BIOINFORMATICS.UCDAVIS.EDU DISCLAIMER This talk/workshop

More information

less sensitive than RNA-seq but more robust analysis pipelines expensive but quantitiatve standard but typically not high throughput

less sensitive than RNA-seq but more robust analysis pipelines expensive but quantitiatve standard but typically not high throughput Chapter 11: Gene Expression The availability of an annotated genome sequence enables massively parallel analysis of gene expression. The expression of all genes in an organism can be measured in one experiment.

More information

BIO 311C Spring Lecture 36 Wednesday 28 Apr.

BIO 311C Spring Lecture 36 Wednesday 28 Apr. BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name minichromosome maintenance complex component 8 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID MCM8 Human The protein encoded by

More information

Bi 8 Lecture 5. Ellen Rothenberg 19 January 2016

Bi 8 Lecture 5. Ellen Rothenberg 19 January 2016 Bi 8 Lecture 5 MORE ON HOW WE KNOW WHAT WE KNOW and intro to the protein code Ellen Rothenberg 19 January 2016 SIZE AND PURIFICATION BY SYNTHESIS: BASIS OF EARLY SEQUENCING complex mixture of aborted DNA

More information

Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.

Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6. Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)

More information

Transcription in Eukaryotes

Transcription in Eukaryotes Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the

More information

Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes

Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Genes can be regulated at many levels Usually, gene regulation, are referring to transcriptional

More information

RNA-Seq. Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University

RNA-Seq. Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University RNA-Seq Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University joshua.ainsley@tufts.edu Day five Alternative splicing Assembly RNA edits Alternative splicing

More information

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important! Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic

More information

9/19/13. cdna libraries, EST clusters, gene prediction and functional annotation. Biosciences 741: Genomics Fall, 2013 Week 3

9/19/13. cdna libraries, EST clusters, gene prediction and functional annotation. Biosciences 741: Genomics Fall, 2013 Week 3 cdna libraries, EST clusters, gene prediction and functional annotation Biosciences 741: Genomics Fall, 2013 Week 3 1 2 3 4 5 6 Figure 2.14 Relationship between gene structure, cdna, and EST sequences

More information

Videos. Lesson Overview. Fermentation

Videos. Lesson Overview. Fermentation Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast

More information

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16 Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes

More information

DNA Replication and Repair

DNA Replication and Repair DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands

More information

Experimental Design. Sequencing. Data Quality Control. Read mapping. Differential Expression analysis

Experimental Design. Sequencing. Data Quality Control. Read mapping. Differential Expression analysis -Seq Analysis Quality Control checks Reproducibility Reliability -seq vs Microarray Higher sensitivity and dynamic range Lower technical variation Available for all species Novel transcript identification

More information

Assessing De-Novo Transcriptome Assemblies

Assessing De-Novo Transcriptome Assemblies Assessing De-Novo Transcriptome Assemblies Shawn T. O Neil Center for Genome Research and Biocomputing Oregon State University Scott J. Emrich University of Notre Dame 100K Contigs, Perfect 1M Contigs,

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 February 15, 2013 Multiple choice questions (numbers in brackets indicate the number of correct answers) 1. Which of the following statements are not true Transcriptomes consist of mrnas Proteomes consist

More information

Measuring and Understanding Gene Expression

Measuring and Understanding Gene Expression Measuring and Understanding Gene Expression Dr. Lars Eijssen Dept. Of Bioinformatics BiGCaT Sciences programme 2014 Why are genes interesting? TRANSCRIPTION Genome Genomics Transcriptome Transcriptomics

More information

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain

More information

Gene Expression Transcription/Translation Protein Synthesis

Gene Expression Transcription/Translation Protein Synthesis Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name sortilin 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SORT1 Human This gene encodes a protein that is a multi-ligand type-1

More information

RNA-Seq data analysis course September 7-9, 2015

RNA-Seq data analysis course September 7-9, 2015 RNA-Seq data analysis course September 7-9, 2015 Peter-Bram t Hoen (LUMC) Jan Oosting (LUMC) Celia van Gelder, Jacintha Valk (BioSB) Anita Remmelzwaal (LUMC) Expression profiling DNA mrna protein Comprehensive

More information

Intro to RNA-seq. July 13, 2015

Intro to RNA-seq. July 13, 2015 Intro to RNA-seq July 13, 2015 Goal of the course To be able to effectively design, and interpret genomic studies of gene expression. We will focus on RNA-seq, but the class will provide a foothold into

More information

GRU5 LECTURE POST-TRANSCRIPTIONAL MODIFICATION AND TRANSCRIPTION

GRU5 LECTURE POST-TRANSCRIPTIONAL MODIFICATION AND TRANSCRIPTION GRU5 LECTURE POST-TRANSCRIPTIONAL MODIFICATION AND TRANSCRIPTION Do Now 1. What was the DNA template for this mrna: 5 -A-A-C-G-U-3? (Write it 5 to 3 ) 2. State the Central Dogma of biology. 3. Name 3 differences

More information

Single-Cell Whole Transcriptome Profiling With the SOLiD. System

Single-Cell Whole Transcriptome Profiling With the SOLiD. System APPLICATION NOTE Single-Cell Whole Transcriptome Profiling Single-Cell Whole Transcriptome Profiling With the SOLiD System Introduction The ability to study the expression patterns of an individual cell

More information

MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE?

MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE? MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE? Lesson Plan: Title Introduction to the Genome Browser: what is a gene? JOYCE STAMM Objectives Demonstrate basic skills in using the UCSC Genome

More information

Computational & Quantitative Biology Lecture 6 RNA Sequencing

Computational & Quantitative Biology Lecture 6 RNA Sequencing Peter A. Sims Dept. of Systems Biology Dept. of Biochemistry & Molecular Biophysics Sulzberger Columbia Genome Center October 27, 2014 Computational & Quantitative Biology Lecture 6 RNA Sequencing We Have

More information

SCBC203 Gene Expression. Assoc. Prof. Rutaiwan Tohtong Department of Biochemistry Faculty of Science PR318

SCBC203 Gene Expression. Assoc. Prof. Rutaiwan Tohtong Department of Biochemistry Faculty of Science PR318 SCBC203 Gene Expression Assoc. Prof. Rutaiwan Tohtong Department of Biochemistry Faculty of Science PR318 Rutaiwan.toh@mahidol.ac.th 1 Gene Expression Gene expression is a process where by the genetic

More information

GenBank Growth. In 2003 ~ 31 million sequences ~ 37 billion base pairs

GenBank Growth. In 2003 ~ 31 million sequences ~ 37 billion base pairs Gene Finding GenBank Growth GenBank Growth In 2003 ~ 31 million sequences ~ 37 billion base pairs GenBank: Exponential Growth Growth of GenBank in billions of base pairs from release 3 in April of 1994

More information

The Central Dogma. DNA makes RNA makes Proteins

The Central Dogma. DNA makes RNA makes Proteins The Central Dogma DNA makes RNA makes Proteins TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION OF

More information

Microarray Gene Expression Analysis at CNIO

Microarray Gene Expression Analysis at CNIO Microarray Gene Expression Analysis at CNIO Orlando Domínguez Genomics Unit Biotechnology Program, CNIO 8 May 2013 Workflow, from samples to Gene Expression data Experimental design user/gu/ubio Samples

More information

6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA

6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA 6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA DNA mrna Protein DNA is found in the nucleus, but making a protein occurs at the ribosome

More information

Applications of short-read

Applications of short-read Applications of short-read sequencing: RNA-Seq and ChIP-Seq BaRC Hot Topics March 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ Sequencing applications RNA-Seq includes experiments

More information

Background Wikipedia Lee and Mahadavan, JCB, 2009 History (Platform Comparison) P Park, Nature Review Genetics, 2009 P Park, Nature Reviews Genetics, 2009 Rozowsky et al., Nature Biotechnology, 2009

More information

Protein Synthesis ~Biology AP~

Protein Synthesis ~Biology AP~ Protein Synthesis ~Biology AP~ A Meridian Study Guide by David Guan, Jennifer Zheng [Edited by Lei Gong] Introduction: - DNA and RNA are essential for life because they code for enzymes, which regulate

More information

DNA Function: Information Transmission

DNA Function: Information Transmission DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living

More information

Hershey and Chase. The accumulation of evidence: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928)

Hershey and Chase. The accumulation of evidence: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928) Today: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928) Reviewing Mitosis/ Exploring the Function of Taxol Structure and Function of DNA! What do we learn about the

More information

RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013

RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein

More information

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information

Analyzed Fungi Neurospora crassa mutants. Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated:

Analyzed Fungi Neurospora crassa mutants. Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated: From Gene to Protein Beadle and Tatum Analyzed Fungi Neurospora crassa mutants Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated: Precursor Ornithine

More information

Motivation From Protein to Gene

Motivation From Protein to Gene MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein

More information

Analysis of RNA-seq Data. Feb 8, 2017 Peikai CHEN (PHD)

Analysis of RNA-seq Data. Feb 8, 2017 Peikai CHEN (PHD) Analysis of RNA-seq Data Feb 8, 2017 Peikai CHEN (PHD) Outline What is RNA-seq? What can RNA-seq do? How is RNA-seq measured? How to process RNA-seq data: the basics How to visualize and diagnose your

More information

DNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks.

DNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks. DNA REPLICATION 5 4 Phosphate 3 DNA structure Nitrogenous base 1 Deoxyribose 2 Nucleotide DNA strand = DNA polynucleotide 2004 Biology Olympiad Preparation Program 2 2004 Biology Olympiad Preparation Program

More information

Lesson Overview. Fermentation 13.1 RNA

Lesson Overview. Fermentation 13.1 RNA 13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA

More information

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made

More information

David M. Rocke Division of Biostatistics and Department of Biomedical Engineering University of California, Davis

David M. Rocke Division of Biostatistics and Department of Biomedical Engineering University of California, Davis David M. Rocke Division of Biostatistics and Department of Biomedical Engineering University of California, Davis Outline RNA-Seq for differential expression analysis Statistical methods for RNA-Seq: Structure

More information

RNA-Seq Workshop AChemS Sunil K Sukumaran Monell Chemical Senses Center Philadelphia

RNA-Seq Workshop AChemS Sunil K Sukumaran Monell Chemical Senses Center Philadelphia RNA-Seq Workshop AChemS 2017 Sunil K Sukumaran Monell Chemical Senses Center Philadelphia Benefits & downsides of RNA-Seq Benefits: High resolution, sensitivity and large dynamic range Independent of prior

More information

Sequencing applications. Today's outline. Hands-on exercises. Applications of short-read sequencing: RNA-Seq and ChIP-Seq

Sequencing applications. Today's outline. Hands-on exercises. Applications of short-read sequencing: RNA-Seq and ChIP-Seq Sequencing applications Applications of short-read sequencing: RNA-Seq and ChIP-Seq BaRC Hot Topics March 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ RNA-Seq includes experiments

More information

Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein)

Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein) Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein) I. Review A. Cells copy their DNA (in S phase of Interphase)-Why? Prepare for Cell Division (Mitosis & Cytokinesis) Genes

More information

Computational Biology I LSM5191 (2003/4)

Computational Biology I LSM5191 (2003/4) Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression I Flow of information: DNA to polypeptide DNA Start Exon1 Intron Exon2 Termination

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name laminin, beta 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID LAMB3 Human The product encoded by this gene is a laminin that

More information

Genes and How They Work. Chapter 15

Genes and How They Work. Chapter 15 Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central

More information

DNA Arrays Affymetrix GeneChip System

DNA Arrays Affymetrix GeneChip System DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC

More information

Videos. Bozeman Transcription and Translation: Drawing transcription and translation:

Videos. Bozeman Transcription and Translation:   Drawing transcription and translation: Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain

More information

There are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal.

There are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal. 1 2 Continuous genes - Intron: Many eukaryotic genes contain coding regions called exons and noncoding regions called intervening sequences or introns. The average human gene contains from eight to nine

More information

RNA-Seq analysis workshop

RNA-Seq analysis workshop RNA-Seq analysis workshop Zhangjun Fei Boyce Thompson Institute for Plant Research USDA Robert W. Holley Center for Agriculture and Health Cornell University Outline Background of RNA-Seq Application of

More information

Introduction to RNAseq Analysis. Milena Kraus Apr 18, 2016

Introduction to RNAseq Analysis. Milena Kraus Apr 18, 2016 Introduction to RNAseq Analysis Milena Kraus Apr 18, 2016 Agenda What is RNA sequencing used for? 1. Biological background 2. From wet lab sample to transcriptome a. Experimental procedure b. Raw data

More information

Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology

Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated to synthesize

More information

3'A C G A C C A G T A A A 5'

3'A C G A C C A G T A A A 5' AP Biology Chapter 14 Reading Guide Gene Expression: From Gene to Protein Overview 1. What is gene expression? Concept 14.1 Genes specify proteins via transcription and translation Basic Principles of

More information

You are genetically unique

You are genetically unique BNF 5106 - Lecture 1 Genetics, Genes, Genetic codes, and Mutations You are genetically unique Since each parent has 23 pairs of chromosomes, the probability that each parent gives twice the same chromosomes

More information

Exam 2 BIO200, Winter 2012

Exam 2 BIO200, Winter 2012 Exam 2 BIO200, Winter 2012 Name: Multiple Choice Questions: Circle the one best answer for each question. (2 points each) 1. The 5 cap structure is often described as a backwards G. What makes this nucleotide

More information

DNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA

DNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA 21 DNA and Biotechnology DNA and Biotechnology OUTLINE: Replication of DNA Gene Expression Mutations Regulating Gene Activity Genetic Engineering Genomics DNA (deoxyribonucleic acid) Double-stranded molecule

More information