CELLTECHGEN For Research Only. Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector)

Transcription

1 Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector) Catalog number: CTG-CAS9-18 Introduction The vector Lenti-EF1 -Cas9-EGFP-U6 sgrna is designed for expression of Cas9 and grna for mammalian gene modification studies using CRISPR/Cas9 technology in vivo or in vitro. Cas9 is expressed from a bidirectional EF1 promoter and sgrna is cloned to downstream of a human U6 promote. To construct the vector, you must construct pgl3-u6 sgrna-puro with your guide sequence. The U6-gRMA sequence is obtained by PCR, and the PCR production is cloned into the pre-linearized vector using the included high-efficiency ligation mix and competent cells. After injected with the vector, sgrna can recognize the targeted DNA sequence and guide Cas9 nuclease during genome editing for gene knockout, knockin, mutagenesis, and more. Reagents Plasmids: pgl3-u6 sgrna-puro and lenti-ef1 -Cas9-EGFP-U6 sgrna Bsa I (NEB, R0535S) Solution I (TaKaRa, 6022Q) Kpn1 (NEB #R3142) Nhe1 (NEB #R3131) PrimeSTAR HS DNA Polymerase (Takara, DR010A) T4 DNA Ligase (NEB #M0202) PCR Cleanup Kit (Axygen, AP-PCR-50) Equipment Centrifuge (RT and 4 C) Vortex One Drop OD Spectrophotometer Thermocycler Thermomixer Water bath (37 C, 42 C and 58 C) Procedure I. Construction of pgl3-u6 sgrna-puro expression vector 1. Design of paired sgrna oligos. Select paired sgrnas in a tail-to-tail orientation and separated by bp, which have the sequence 5 -CCN (52-72) GG. All possible paired sites for mouse and human exons are available on the website ( For each sgrna, the 5 - GGN (19) GG motif is preferred, however, 5 -GN (20) GG or 5 -N (21) GG are also satisfactory. BLAT or BLAST the sgrna target sites in UCSC or ENSEMBL genome browsers to find those with few or no highly related sites in the genome.

2 Figure 1. Example of cloning a target sequence using the CRISPR/Cas9 System 2. Annealing oligos prior to cloning. 4.5 µl Top oligo (100 µm) 4.5 µl Bottom oligo (100 µm) 1 µl NEB buffer 2 Annealing oligos using a thermocycler with the following program: 95 C, 5 min; C at 2 C /s; C at 0.1 C /s; hold at 4 C. 3. Preparation of pgl3-u6 sgrna-puro plasmid. 2 µg pgl3-u6 sgrna-puro 1 µl BsaI Purify the digestion product using MinElute PCR Purification Kit. 4. Ligation of annealed oligos with BsaI-digested pgl3-u6 sgrna-puro 2 µl annealed oligos

3 1 µl (25 ng/µl) digested pgl3-u6 sgrna-puro 3 µl 2 x Solution I Incubate at 16 C for 60 min 5. Transformation and plate on Amp+ plate (100 μg/ml). CELLTECHGEN For Research Only 6. Confirm correct insertion of sgrna oligos by sequencing using the following primer. Assembly-For: cgattagtgaacggatctcgacg 7. Mini-prep pgl3-u6 sgrna-puro plasmid using Axygen Miniprep Kit. II. Cloning U6-sgRNA into the lenti-ef1 -Cas9-EGFP-U6 sgrna vector 1. Amplification of U6-sgRNA fragment using the following primers, reaction and program from pgl3-u6 sgrna-puro: Primer For: GAA GGTACCCTCGAGCGGCCGCCCCCTTCA Primer Rev: GAA GCTAGCCCATTTGTCTCGAGGTCGAGAATT PCR Reaction Mixture (50 μl) Component Amount (μl) 5X PrimeSTAR Buffer (Mg 2+ plus) 10 dntp Mixture (2.5 mm each) 4 Primer For (10 μm each) 0.5 Primer Rev (10 μm each) 0.5 pgl3-u6 sgrna-puro 1 ng PrimeSTAR HS DNA Polymerase 0.3 Sterilized Distilled Water Up to 50 μl Program: 95 C, 5 min; 95 C, 30 s, 60 C, 30 s, 72 C, 30 s, 30 cycles; 72 C, 5 min; hold at 16 C. 2. Purification of the PCR production and digestion using Kpn1 and Nhe1 restriction Enzyme. Purify the PCR product using Axygen PCR Purification Kit. Digest PCR production as following reaction: PCR product 2 µl Kpn1 2 µl Nhe1 Purify the digestion product using Axygen PCR Purification Kit.

4 3. Digestion of lenti-ef1 -Cas9-EGFP-U6 sgrna using Kpn1 and Nhe1 restriction Enzyme 2 µg lenti-ef1 -Cas9-EGFP-U6 sgrna 1 µl Kpn1 1 µl Nhe1 Purify the digestion product using Axygen PCR Purification Kit. 4. Ligation of Kpn1 and Nhe1-digested PCR production with Kpn1 and Nhe1-digested lenti-ef1 -Cas9-EGFP-U6 sgrna Component Amount (μl) Kpn1 and Nhe1-digested PCR production 50 ng Kpn1 and Nhe1-digested lenti-ef1 -Cas9-EGFP-U6 sgrna 150 ng T4 ligation buffer, 10 1 T4 ligase 1 H 2 O Up to 10 Incubate at 16 C for 3 h 5. Transformation and plate on Amp+ plate (100 μg/ml). 6. Confirm correct insertion of U6-sgRNA by sequencing using the following primer. Lenti-Cas9-U6 sgrna seq: cgggtttattacagggacagc 7. Mini-prep lenti-ef1 -Cas9-EGFP-U6 sgrna vector using Axygen Miniprep Kit. Related Products EGFP expression control vector AAV-CMV-EGFP (Catalog number: CTG-CAS9-010) EGFP grna expression vector AAV-U6-EGFP sgrna(catalog number: CTG-CAS9-13) Lenti-U6-EGFP sgrna-ef1a-puro(catalog number: CTG-CAS9-14) pgl3-u6-egfp-sgrna-puro(catalog number: CTG-CAS9-15) Cas9 nuclease expression vector Lenti-CMV-Cas9-P2A-Puro (Catalog number: CTG-CAS9-02) Lenti-EF1a-Cas9-P2A-Puro (Catalog number: CTG-CAS9-05) Lenti-EFS-Cas9-P2A-Puro (Catalog number: CTG-CAS9-06) Lenti-sFFV-Cas9-P2A-Puro (Catalog number: CTG-CAS9-07) pst1374-n-nls-flag-cas9-egfp (Catalog number: CTG-CAS9-08)

5 AAV-mMecp2-Cas9 (Catalog number: CTG-CAS9-09) AAV-TRE-Cas9(Catalog number: CTG-CAS9-16) grna transcription vector in vitro pst1374-n-nls-flag-cas9 (Catalog Number: CTG-CAS9-01) puc57-t7 sgrna-kan (Catalog number: CTG-CAS9-04) grna expression vector pgl3-u6 sgrna-puro( Catalog number: CTG-CAS9-03) Lenti-U6 sgrna-ef1a-puro(catalog number: CTG-CAS9-11) AAV-U6 sgrna-egfp(catalog number: CTG-CAS9-12) AAV-CMV-EGFP-P2A-tTA3g-U6 sgrna(catalog number: CTG-CAS9-17) All-in-one Cas9 and grna expression vector Lenti-EF1a-Cas9-EGFP-U6 sgrna(catalog number: CTG-CAS9-18) PB-TRE-NLS-linker-Cas9-IRES-hrGFP-Zeo(Catalog number: CTG-CAS9-19)