Variant detection analysis in the BRCA1/2 genes from Ion torrent PGM data

Size: px
Start display at page:

Download "Variant detection analysis in the BRCA1/2 genes from Ion torrent PGM data"

Transcription

1 Variant detection analysis in the BRCA1/2 genes from Ion torrent PGM data Bruno Zeitouni Bionformatics department of the Institut Curie Inserm U900 Mines ParisTech Ion Torrent User Meeting 2012, October 10th

2 The Institut Curie, Paris (France) - Private organization which contributes to the public health system - Cancer, the first cause of mortality (13% of overall deaths) - Two major entities : 1) the hospital group *diagnostics (imaging, pathology, laboratory testing) *therapeutics (surgery, radiotherapy, medical treatments, support treatment) 2) the research center *cancer research groups *core facilities: microarray, NGS, Bioinformatics

3 Question - NGS core facility : 2 SOLiD 5500, 1 HiSeq 2000, 2 Ion torrent PGM - IT & Bionformatics depts: CPU and storage ressources Can we use the ion torrent technology for accurate routine diagnosis? > Application to the BRCA1/2 genes

4 A pilot study for BRCA1/2 analysis by Ion PGM 3 ion PGM test runs : - Run 1 (12/2011): 16 samples with known BRCA1/2 mutations SNPs, Indels (ins50, del29, del11), Gain/loss of exon(s) (delbrca1ex1-7, delbrca2, dupbrca2ex19-20) chip Run 2 (06/2012): 16 samples not genotyped for BRCA1/2 = routine case EMMA/Capillary sequencing done in parallel chip Run 3 (09/2012): 30 samples, known indels in homopolymers (80%) chip 318

5 Experimental design Patient s biological sample : constitutional DNA Genomic DNA extraction Amplification of coding regions in BRCA1/2 genes : Multiplicom BRCA MASTR v2.1 assay Fragment size selection (200bp) & library construction Sequencing on the ion PGM (316/318 chip) Variant detection bioinformatics pipeline Variant validation and final report to geneticist

6 Variant detection bioinformatics pipeline Ion torrent chip READ MAPPING Base calling Sequencing reads SFF format QC Mapping with TMAP hg19 genome VARIANT CALLING ION VARIANT CALLER V2.2.3 package DiBayes GATK Stringency-- VARIANT FILTERING SNVs Indels QC VARIANT ANNOTATION ANNOVAR Unknown CDS or splicing site variants List of targets BED format QC Focus on targeted regions COV 30 VarFreq SNV 0.3 VarFreq Indel 0.2 StrandRatio 0.2 Homozygotes: No DESEQ VARIANT VIEW IGV UCSC Browser Alamut QC Read alignments BAM Format QC: Quality control Groups of PCR multiplexes VCF format RGTs Candidate variants SANGER Validation

7 Mapping and enrichment statistics Run 1 puce 316 fastqc Mean quality Q27 and coverage of 350X Very good mapping data: >99% of mapped reads Excellent enrichment results (99% of targets) No bias in forward/reverse strand coverage

8 Results: SNVs and Indels Run 1 Run 2 Sn FP rate Sn FP rate SNVs 92.6% (25) 30.5% (11) 100% (32) 5,9% (2) n=27 n=32 Indels 91.7% (11) 0% (0) 100% (3) 25% (1) n=12 n=3 hp- Indels Run 3 Sn FP rate? 44% (11) 47.6% (10) n=25 Sn: Sensitivity FP: False-Positive n = number of expected variants

9 Minimum of coverage required to variant detection % of true-positives at different values of depth-of-coverage Estimated minimum of coverage required - SNVs ~ 30X - Indels ~ 100X

10 Results: Gain/Loss of exons * Log2 Fold-Change * Run 1 Run 2 * BRCA1 Exons FDR 10%

11 The Target-PGM pipeline available to end-users in Galaxy Graphical interface of Galaxy

12 Conclusion - The ion torrent technology allows to detect the SNV/Indel variants and seems to be suitable for routine usage - The PCR technique enrichment showed excellent performance (99% of reads on targets) - Accuracy of the specific mapping method developed in the TMAP software - Excellent sensitivity for SNV detection, correct specificity - Very good specificity for Indel detection, average sensitivity > Issues in the detection of indels in homopolymers The transfer of NGS to the BRCA genetic analysis using the ion PGM is workable

13 Acknowledgements Cancer Genetics dept of the IC hospital Claude Houdayer Julien Tarabeux Lisa Golmard Virgine Moncoutier Dominique Stoppa-Lyonnet Marc-Henri Stern NGS core facility of the IC Thomas Rio Frio Quentin Leroy Bioinformatics dept of the IC Séverine Lair Alban Lermine Nicolas Servant Philippe Hupé Emmanuel Barillot Thank you for your attention!

Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4

Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4 WHITE PAPER Oncomine Comprehensive Assay Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4 Contents Scope and purpose of document...2 Content...2 How Torrent

More information

Processing Ion AmpliSeq Data using NextGENe Software v2.3.0

Processing Ion AmpliSeq Data using NextGENe Software v2.3.0 Processing Ion AmpliSeq Data using NextGENe Software v2.3.0 July 2012 John McGuigan, Megan Manion, Kevin LeVan, CS Jonathan Liu Introduction The Ion AmpliSeq Panels use highly multiplexed PCR in order

More information

Ecole de Bioinforma(que AVIESAN Roscoff 2014 GALAXY INITIATION. A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech

Ecole de Bioinforma(que AVIESAN Roscoff 2014 GALAXY INITIATION. A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech GALAXY INITIATION A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech How does Next- Gen sequencing work? DNA fragmentation Size selection and clonal amplification Massive parallel sequencing ACCGTTTGCCG

More information

Practical Considerations for Implementation of Clinical Sequencing. Emily Winn-Deen, Ph.D. April 2017

Practical Considerations for Implementation of Clinical Sequencing. Emily Winn-Deen, Ph.D. April 2017 Practical Considerations for Implementation of Clinical Sequencing Emily Winn-Deen, Ph.D. April 2017 1. DEFINE THE CLINICAL PROBLEM TO BE ADDRESSED Focused panels Targeted Gene Panels Gene or disease-based

More information

Welcome to the NGS webinar series

Welcome to the NGS webinar series Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic

More information

SNP calling. Jose Blanca COMAV institute bioinf.comav.upv.es

SNP calling. Jose Blanca COMAV institute bioinf.comav.upv.es SNP calling Jose Blanca COMAV institute bioinf.comav.upv.es SNP calling Genotype matrix Genotype matrix: Samples x SNPs SNPs and errors A change in a read may due to: Sample contamination Cloning or PCR

More information

Analytics Behind Genomic Testing

Analytics Behind Genomic Testing A Quick Guide to the Analytics Behind Genomic Testing Elaine Gee, PhD Director, Bioinformatics ARUP Laboratories 1 Learning Objectives Catalogue various types of bioinformatics analyses that support clinical

More information

DNA concentration and purity were initially measured by NanoDrop 2000 and verified on Qubit 2.0 Fluorometer.

DNA concentration and purity were initially measured by NanoDrop 2000 and verified on Qubit 2.0 Fluorometer. DNA Preparation and QC Extraction DNA was extracted from whole blood or flash frozen post-mortem tissue using a DNA mini kit (QIAmp #51104 and QIAmp#51404, respectively) following the manufacturer s recommendations.

More information

Setting Standards and Raising Quality for Clinical Bioinformatics. Joo Wook Ahn, Guy s & St Thomas 04/07/ ACGS summer scientific meeting

Setting Standards and Raising Quality for Clinical Bioinformatics. Joo Wook Ahn, Guy s & St Thomas 04/07/ ACGS summer scientific meeting Setting Standards and Raising Quality for Clinical Bioinformatics Joo Wook Ahn, Guy s & St Thomas 04/07/2016 - ACGS summer scientific meeting 1. Best Practice Guidelines Draft guidelines circulated to

More information

Assay Validation Services

Assay Validation Services Overview PierianDx s assay validation services bring clinical genomic tests to market more rapidly through experimental design, sample requirements, analytical pipeline optimization, and criteria tuning.

More information

Statistical method for Next Generation Sequencing pipeline comparison

Statistical method for Next Generation Sequencing pipeline comparison Statistical method for Next Generation Sequencing pipeline comparison Pascal Roy, MD PhD EPICLIN 2016 Strasbourg 25-27 mai 2016 MH Elsensohn 1-4*, N Leblay 1-4, S Dimassi 5,6, A Campan-Fournier 5,6, A

More information

Implementation of Ion AmpliSeq in molecular diagnostics

Implementation of Ion AmpliSeq in molecular diagnostics Implementation of Ion AmpliSeq in molecular diagnostics The Rotterdam Experience Ronald van Marion Deelnemersbijeenkomst SKML sectie Pathologie Amersfoort, 26 mei 2016 Molecular Diagnostics in Rotterdam

More information

NGS in Pathology Webinar

NGS in Pathology Webinar NGS in Pathology Webinar NGS Data Analysis March 10 2016 1 Topics for today s presentation 2 Introduction Next Generation Sequencing (NGS) is becoming a common and versatile tool for biological and medical

More information

with drmid Dx for Illumina NGS systems

with drmid Dx for Illumina NGS systems Performance Characteristics BRCA MASTR Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Revision date: July 27, 2017 Page 1 of 8 Table of Contents

More information

Single Nucleotide Variant Analysis. H3ABioNet May 14, 2014

Single Nucleotide Variant Analysis. H3ABioNet May 14, 2014 Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide

More information

Reads to Discovery. Visualize Annotate Discover. Small DNA-Seq ChIP-Seq Methyl-Seq. MeDIP-Seq. RNA-Seq. RNA-Seq.

Reads to Discovery. Visualize Annotate Discover. Small DNA-Seq ChIP-Seq Methyl-Seq. MeDIP-Seq. RNA-Seq. RNA-Seq. Reads to Discovery RNA-Seq Small DNA-Seq ChIP-Seq Methyl-Seq RNA-Seq MeDIP-Seq www.strand-ngs.com Analyze Visualize Annotate Discover Data Import Alignment Vendor Platforms: Illumina Ion Torrent Roche

More information

High Cross-Platform Genotyping Concordance of Axiom High-Density Microarrays and Eureka Low-Density Targeted NGS Assays

High Cross-Platform Genotyping Concordance of Axiom High-Density Microarrays and Eureka Low-Density Targeted NGS Assays High Cross-Platform Genotyping Concordance of Axiom High-Density Microarrays and Eureka Low-Density Targeted NGS Assays Ali Pirani and Mohini A Patil ISAG July 2017 The world leader in serving science

More information

BICF Variant Analysis Tools. Using the BioHPC Workflow Launching Tool Astrocyte

BICF Variant Analysis Tools. Using the BioHPC Workflow Launching Tool Astrocyte BICF Variant Analysis Tools Using the BioHPC Workflow Launching Tool Astrocyte Prioritization of Variants SNP INDEL SV Astrocyte BioHPC Workflow Platform Allows groups to give easy-access to their analysis

More information

14 March, 2016: Introduction to Genomics

14 March, 2016: Introduction to Genomics 14 March, 2016: Introduction to Genomics Genome Genome within Ensembl browser http://www.ensembl.org/homo_sapiens/location/view?db=core;g=ensg00000139618;r=13:3231547432400266 Genome within Ensembl browser

More information

Functional DNA Quality Analysis Improves the Accuracy of Next Generation Sequencing from Clinical Specimens

Functional DNA Quality Analysis Improves the Accuracy of Next Generation Sequencing from Clinical Specimens Functional DNA Quality Analysis Improves the Accuracy of Next Generation Sequencing from Clinical Specimens Overview We have developed a novel QC, the SuraSeq DNA Quantitative Functional Index (QFI ).

More information

Sequencing and PCR. Training: Ion S5 and S5 XL Systems workflow training

Sequencing and PCR. Training: Ion S5 and S5 XL Systems workflow training Training: Ion S5 and S5 XL Systems workflow training This interactive course focuses on the Ion S5 and Ion S5 XL Systems operation and the Ion AmpliSeq workflow on the Ion Chef System for sequencing. The

More information

Next-Generation Sequencing. Technologies

Next-Generation Sequencing. Technologies Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062

More information

Course Presentation. Ignacio Medina Presentation

Course Presentation. Ignacio Medina Presentation Course Index Introduction Agenda Analysis pipeline Some considerations Introduction Who we are Teachers: Marta Bleda: Computational Biologist and Data Analyst at Department of Medicine, Addenbrooke's Hospital

More information

SNP calling and VCF format

SNP calling and VCF format SNP calling and VCF format Laurent Falquet, Oct 12 SNP? What is this? A type of genetic variation, among others: Family of Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide

More information

G E N OM I C S S E RV I C ES

G E N OM I C S S E RV I C ES GENOMICS SERVICES ABOUT T H E N E W YOR K G E NOM E C E N T E R NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. Through

More information

Enterprise Interest I am an employee of ThermoFisher Scientific.

Enterprise Interest I am an employee of ThermoFisher Scientific. Enterprise Interest I am an employee of ThermoFisher Scientific. Developing a multiplex next-generation sequencing assay to study highly clonal tumor samples Dumitru Brinza, Ph.D Clinical Next-Generation

More information

QIAseq Targeted Panel Analysis Plugin USER MANUAL

QIAseq Targeted Panel Analysis Plugin USER MANUAL QIAseq Targeted Panel Analysis Plugin USER MANUAL User manual for QIAseq Targeted Panel Analysis 1.1 Windows, macos and Linux June 18, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej

More information

Targeted Sequencing in the NBS Laboratory

Targeted Sequencing in the NBS Laboratory Targeted Sequencing in the NBS Laboratory Christopher Greene, PhD Newborn Screening and Molecular Biology Branch Division of Laboratory Sciences Gene Sequencing in Public Health Newborn Screening February

More information

C3BI. VARIANTS CALLING November Pierre Lechat Stéphane Descorps-Declère

C3BI. VARIANTS CALLING November Pierre Lechat Stéphane Descorps-Declère C3BI VARIANTS CALLING November 2016 Pierre Lechat Stéphane Descorps-Declère General Workflow (GATK) software websites software bwa picard samtools GATK IGV tablet vcftools website http://bio-bwa.sourceforge.net/

More information

Alissa Interpret The next evolution of Cartagenia Bench

Alissa Interpret The next evolution of Cartagenia Bench Alissa Interpret The next evolution of Cartagenia Bench Case Study: An Efficient Clinical Pipeline for Microcephaly, RASopathy and Leukodystrophy Gene Panels Using Alissa Interpret s Flexible Classification

More information

Deep Sequencing technologies

Deep Sequencing technologies Deep Sequencing technologies Gabriela Salinas 30 October 2017 Transcriptome and Genome Analysis Laboratory http://www.uni-bc.gwdg.de/index.php?id=709 Microarray and Deep-Sequencing Core Facility University

More information

Design a super panel for comprehensive genetic testing

Design a super panel for comprehensive genetic testing Design a super panel for comprehensive genetic testing Rong Chen, Ph.D. Assistant Professor Director of Clinical Genome Sequencing Dept. of Genetics and Genomic Sciences Institute for Genomics and Multiscale

More information

Your Best Data: Teaming QIAGEN Chemistry & Bioinformatics to Drive Samples to Insight

Your Best Data: Teaming QIAGEN Chemistry & Bioinformatics to Drive Samples to Insight Your Best Data: Teaming QIAGEN Chemistry & Bioinformatics to Drive Samples to Insight Aysel Heckel Director Clinical Solutions Sales Dr. Anne Arens Field Application Scientist Course on Variant Detection

More information

SEQUENCING. M Ataei, PhD. Feb 2016

SEQUENCING. M Ataei, PhD. Feb 2016 CLINICAL NEXT GENERATION SEQUENCING M Ataei, PhD Tehran Medical Genetics Laboratory Feb 2016 Overview 2 Background NGS in non-invasive prenatal diagnosis (NIPD) 3 Background Background 4 In the 1970s,

More information

A Crash Course in NGS for GI Pathologists. Sandra O Toole

A Crash Course in NGS for GI Pathologists. Sandra O Toole A Crash Course in NGS for GI Pathologists Sandra O Toole The Sanger Technique First generation sequencing Uses dideoxynucleotides (dideoxyadenine, dideoxyguanine, etc) These are molecules that resemble

More information

Sanger vs Next-Gen Sequencing

Sanger vs Next-Gen Sequencing Tools and Algorithms in Bioinformatics GCBA815/MCGB815/BMI815, Fall 2017 Week-8: Next-Gen Sequencing RNA-seq Data Analysis Babu Guda, Ph.D. Professor, Genetics, Cell Biology & Anatomy Director, Bioinformatics

More information

Next generation sequencing in diagnostic laboratories: opportunities and challenges

Next generation sequencing in diagnostic laboratories: opportunities and challenges Next generation sequencing in diagnostic laboratories: opportunities and challenges Vitali Sintchenko Marie Bashir Institute for Emerging Infectious Diseases & Biosecurity Declaration No conflict of interest

More information

Introducing combined CGH and SNP arrays for cancer characterisation and a unique next-generation sequencing service. Dr. Ruth Burton Product Manager

Introducing combined CGH and SNP arrays for cancer characterisation and a unique next-generation sequencing service. Dr. Ruth Burton Product Manager Introducing combined CGH and SNP arrays for cancer characterisation and a unique next-generation sequencing service Dr. Ruth Burton Product Manager Today s agenda Introduction CytoSure arrays and analysis

More information

From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow

From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with

More information

Variant calling in NGS experiments

Variant calling in NGS experiments Variant calling in NGS experiments Jorge Jiménez jjimeneza@cipf.es BIER CIBERER Genomics Department Centro de Investigacion Principe Felipe (CIPF) (Valencia, Spain) 1 Index 1. NGS workflow 2. Variant calling

More information

IDENTIFYING A DISEASE CAUSING MUTATION

IDENTIFYING A DISEASE CAUSING MUTATION IDENTIFYING A DISEASE CAUSING MUTATION Targeted resequencing MARCELA DAVILA 3/MZO/2016 Core Facilities at Sahlgrenska Academy Statistics Software bioinformatics@gu.se www.cf.gu.se/english// Increasing

More information

Bioinformatics Advice on Experimental Design

Bioinformatics Advice on Experimental Design Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics

More information

NGS, Cancer and Bioinformatics. 5/3/2015 Yannick Boursin

NGS, Cancer and Bioinformatics. 5/3/2015 Yannick Boursin NGS, Cancer and Bioinformatics 5/3/2015 Yannick Boursin 1 NGS and Clinical Oncology NGS in hereditary cancer genome testing BRCA1/2 (breast/ovary cancer) XPC (melanoma) ERCC1 (colorectal cancer) NGS for

More information

Transcriptome analysis

Transcriptome analysis Statistical Bioinformatics: Transcriptome analysis Stefan Seemann seemann@rth.dk University of Copenhagen April 11th 2018 Outline: a) How to assess the quality of sequencing reads? b) How to normalize

More information

Statistical method to compare massive parallel sequencing pipelines

Statistical method to compare massive parallel sequencing pipelines Statistical method to compare massive parallel sequencing pipelines Delphine Maucort-Boulch MD PhD Mad-Hélénie Elsensohn Msc, Florence Roucher-Boulez PharmD PhD, Claire Bardel PhD, Pascal Roy MD PhD Service

More information

Development and characterization of a high throughput targeted genotypingby-sequencing solution for agricultural genetic applications

Development and characterization of a high throughput targeted genotypingby-sequencing solution for agricultural genetic applications Development and characterization of a high throughput targeted genotypingby-sequencing solution for agricultural genetic applications Michelle Swimley 1, Angela Burrell 1, Prasad Siddavatam 1, Chris Willis

More information

Ion S5 and Ion S5 XL Systems

Ion S5 and Ion S5 XL Systems Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Explore the Ion S5 and Ion S5 XL Systems Adopting next-generation sequencing (NGS) in your lab is now simpler than ever The Ion S5

More information

Oncomine cfdna Assays Part III: Variant Analysis

Oncomine cfdna Assays Part III: Variant Analysis Oncomine cfdna Assays Part III: Variant Analysis USER GUIDE for use with: Oncomine Lung cfdna Assay Oncomine Colon cfdna Assay Oncomine Breast cfdna Assay Catalog Numbers A31149, A31182, A31183 Publication

More information

Access Array BRCA1 / BRCA2 / TP53 Target-Specific Panel Build the highest quality amplicon libraries with qualified assays

Access Array BRCA1 / BRCA2 / TP53 Target-Specific Panel Build the highest quality amplicon libraries with qualified assays DATA SHEET PN 100-3489 B1 Access Array BRCA1 / BRCA2 / TP53 Target-Specific Panel Build the highest quality amplicon libraries with qualified assays Covers 100% of the exons within the genes Supported

More information

Introduction to RNA-Seq in GeneSpring NGS Software

Introduction to RNA-Seq in GeneSpring NGS Software Introduction to RNA-Seq in GeneSpring NGS Software Dipa Roy Choudhury, Ph.D. Strand Scientific Intelligence and Agilent Technologies Learn more at www.genespring.com Introduction to RNA-Seq In a few years,

More information

Ion S5 and Ion S5 XL Systems

Ion S5 and Ion S5 XL Systems Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Explore the Ion S5 and Ion S5 XL Systems Adopting next-generation sequencing (NGS) in your lab is now simpler than ever The Ion S5

More information

Matthew Tinning Australian Genome Research Facility. July 2012

Matthew Tinning Australian Genome Research Facility. July 2012 Next-Generation Sequencing: an overview of technologies and applications Matthew Tinning Australian Genome Research Facility July 2012 History of Sequencing Where have we been? 1869 Discovery of DNA 1909

More information

Maximizing your NGS sequencing with IDT. Adam Chernick, PhD Field Applications Manager, Functional Genomics

Maximizing your NGS sequencing with IDT. Adam Chernick, PhD Field Applications Manager, Functional Genomics Maximizing your NGS sequencing with IDT Adam Chernick, PhD Field Applications Manager, Functional Genomics 1 Contents Expanding our NGS portfolio what s next? xgen technology and Lockdown probe advantages

More information

Introduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017

Introduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017 Introduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017 Topics to cover today What is Next Generation Sequencing (NGS)? Why do we need NGS? Common approaches to NGS NGS

More information

Validation of Identity and Ancestry SNP Panels for the Ion PGM

Validation of Identity and Ancestry SNP Panels for the Ion PGM Validation of Identity and Ancestry SNP Panels for the Ion PGM Christopher Phillips, Carla Santos, Maria de la Puente, Manuel Fondevila, Ángel Carracedo, Maviky Lareu Forensic Genetics Unit, University

More information

Quality assurance in NGS (diagnostics)

Quality assurance in NGS (diagnostics) Quality assurance in NGS (diagnostics) Chris Mattocks National Genetics Reference Laboratory (Wessex) Research Diagnostics Quality assurance Any systematic process of checking to see whether a product

More information

The Final Frontier. Data Analysis. Jean Jasinski, Ph.D. Field Application Scientist Sept. 27, 2017

The Final Frontier. Data Analysis. Jean Jasinski, Ph.D. Field Application Scientist Sept. 27, 2017 The Final Frontier Data Analysis Jean Jasinski, Ph.D. Field Application Scientist Sept. 27, 2017 1 For Research Use Only. Not for use in diagnostic procedures. Final Frontier: Data Analysis Agenda Introduction

More information

Introduction to Next Generation Sequencing (NGS) Data Analysis and Pathway Analysis. Jenny Wu

Introduction to Next Generation Sequencing (NGS) Data Analysis and Pathway Analysis. Jenny Wu Introduction to Next Generation Sequencing (NGS) Data Analysis and Pathway Analysis Jenny Wu Outline Introduction to NGS data analysis in Cancer Genomics NGS applications in cancer research Typical NGS

More information

Next Generation Sequencing and Bioinformatics Analysis Pipelines. Adam Ameur National Genomics Infrastructure SciLifeLab Uppsala

Next Generation Sequencing and Bioinformatics Analysis Pipelines. Adam Ameur National Genomics Infrastructure SciLifeLab Uppsala GA N AT ION ALCTAC ATCA G ENOMI C SGT INF R A S T RU CTURE Next Generation Sequencing and Bioinformatics Analysis Pipelines Adam Ameur National Genomics Infrastructure SciLifeLab Uppsala adam.ameur@igp.uu.se

More information

Next Generation Sequencing: Data analysis for genetic profiling

Next Generation Sequencing: Data analysis for genetic profiling Next Generation Sequencing: Data analysis for genetic profiling Raed Samara, Ph.D. Global Product Manager Raed.Samara@QIAGEN.com Welcome to the NGS webinar series - 2015 NGS Technology Webinar 1 NGS: Introduction

More information

Galaxy Platform For NGS Data Analyses

Galaxy Platform For NGS Data Analyses Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory http://collaboratory.lifesci.ucla.edu Workshop Outline ü Day 1 UCLA galaxy

More information

Titelstijl van model bewerken

Titelstijl van model bewerken Generate Titelstijl van and verify model your bewerken data Solutions for all your genetic analysis needs Sanger Sequencing Microarray technology QuantStudio real-time and digital PCR Ion Torrent NGS systems

More information

Read Mapping and Variant Calling. Johannes Starlinger

Read Mapping and Variant Calling. Johannes Starlinger Read Mapping and Variant Calling Johannes Starlinger Application Scenario: Personalized Cancer Therapy Different mutations require different therapy Collins, Meredith A., and Marina Pasca di Magliano.

More information

DNBseq TM SERVICE OVERVIEW Plant and Animal Whole Genome Re-Sequencing

DNBseq TM SERVICE OVERVIEW Plant and Animal Whole Genome Re-Sequencing TM SERVICE OVERVIEW Plant and Animal Whole Genome Re-Sequencing Plant and animal whole genome re-sequencing (WGRS) involves sequencing the entire genome of a plant or animal and comparing the sequence

More information

Whole Human Genome Sequencing Report This is a technical summary report for PG DNA

Whole Human Genome Sequencing Report This is a technical summary report for PG DNA Whole Human Genome Sequencing Report This is a technical summary report for PG0002601-DNA Physician and Patient Information Physician name: Vinodh Naraynan Address: Suite 406 222 West Thomas Road Phoenix

More information

resequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics

resequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics RNA Sequencing T TM variation genetics validation SNP ncrna metagenomics private trio de novo exome mendelian ChIP-seq RNA DNA bioinformatics custom target high-throughput resequencing storage ncrna comparative

More information

Comparing a few SNP calling algorithms using low-coverage sequencing data

Comparing a few SNP calling algorithms using low-coverage sequencing data Yu and Sun BMC Bioinformatics 2013, 14:274 RESEARCH ARTICLE Open Access Comparing a few SNP calling algorithms using low-coverage sequencing data Xiaoqing Yu 1 and Shuying Sun 1,2* Abstract Background:

More information

Surely Better Target Enrichment from Sample to Sequencer

Surely Better Target Enrichment from Sample to Sequencer sureselect TARGET ENRICHMENT solutions Surely Better Target Enrichment from Sample to Sequencer Agilent s market leading SureSelect platform provides a complete portfolio of catalog to custom products,

More information

Get to Know Your DNA. Every Single Fragment.

Get to Know Your DNA. Every Single Fragment. HaloPlex HS NGS Target Enrichment System Get to Know Your DNA. Every Single Fragment. High sensitivity detection of rare variants using molecular barcodes How Does Molecular Barcoding Work? HaloPlex HS

More information

Pioneering Clinical Omics

Pioneering Clinical Omics Pioneering Clinical Omics Clinical Genomics Strand NGS An analysis tool for data generated by cutting-edge Next Generation Sequencing(NGS) instruments. Strand NGS enables read alignment and analysis of

More information

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s

More information

Whole Genome Sequencing in Cancer Diagnostics (research) Nederlandse Pathologiedagen 19 & 20 November 2015

Whole Genome Sequencing in Cancer Diagnostics (research) Nederlandse Pathologiedagen 19 & 20 November 2015 Whole Genome Sequencing in Cancer Diagnostics (research) Nederlandse Pathologiedagen 19 & 20 November 2015 Dr. I.J. Nijman Disclosure slide (Potential) conflict of interest None For this meeting relevant

More information

Long and short/small RNA-seq data analysis

Long and short/small RNA-seq data analysis Long and short/small RNA-seq data analysis GEF5, 4.9.2015 Sami Heikkinen, PhD, Dos. Topics 1. RNA-seq in a nutshell 2. Long vs short/small RNA-seq 3. Bioinformatic analysis work flows GEF5 / Heikkinen

More information

Form for publishing your article on BiotechArticles.com this document to

Form for publishing your article on BiotechArticles.com  this document to Your Article: Article Title (3 to 12 words) Article Summary (In short - What is your article about Just 2 or 3 lines) Category Transcriptomics sequencing and lncrna Sequencing Analysis: Quality Evaluation

More information

SCIENCE CHINA Life Sciences. High-performance single-chip exon capture allows accurate whole exome sequencing using the Illumina Genome Analyzer

SCIENCE CHINA Life Sciences. High-performance single-chip exon capture allows accurate whole exome sequencing using the Illumina Genome Analyzer SCIENCE CHINA Life Sciences RESEARCH PAPERS October 2011 Vol.54 No.10: 945 952 doi: 10.1007/s11427-011-4232-4 High-performance single-chip exon capture allows accurate whole exome sequencing using the

More information

Summary of key processes for tumor BRCA testing. Q&A Session Hadassah Medical Center, Jerusalem Sabine Merkelbach-Bruse

Summary of key processes for tumor BRCA testing. Q&A Session Hadassah Medical Center, Jerusalem Sabine Merkelbach-Bruse Summary of key processes for tumor BRCA testing Q&A Session 29.01.2018 Hadassah Medical Center, Jerusalem Sabine Merkelbach-Bruse Review of key processes Overview Summary of key processes Quality assurance

More information

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio

More information

Applications of short-read

Applications of short-read Applications of short-read sequencing: RNA-Seq and ChIP-Seq BaRC Hot Topics March 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ Sequencing applications RNA-Seq includes experiments

More information

SEQUENCING FROM SAMPLE TO SEQUENCE READY

SEQUENCING FROM SAMPLE TO SEQUENCE READY SEQUENCING FROM SAMPLE TO SEQUENCE READY ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES NOT ONCE, BUT EVERY TIME n The highest quality amplicons more sensitive, accurate, and specific n Full support for all

More information

ChIP-seq and RNA-seq. Farhat Habib

ChIP-seq and RNA-seq. Farhat Habib ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions

More information

Bioinformatics small variants Data Analysis. Guidelines. genomescan.nl

Bioinformatics small variants Data Analysis. Guidelines. genomescan.nl Next Generation Sequencing Bioinformatics small variants Data Analysis Guidelines genomescan.nl GenomeScan s Guidelines for Small Variant Analysis on NGS Data Using our own proprietary data analysis pipelines

More information

Validation and optimization of the Ion Torrent S5 XL sequencer and Oncomine workflow for BRCA1 and BRCA2 genetic testing

Validation and optimization of the Ion Torrent S5 XL sequencer and Oncomine workflow for BRCA1 and BRCA2 genetic testing /, 207, Vol. 8, (No. 2), pp: 4858-4866 Validation and optimization of the Ion Torrent S5 XL sequencer and Oncomine workflow for BRCA and BRCA2 genetic testing Saeam Shin,2,*, Yoonjung Kim,*, Seoung Chul

More information

Variant Detection in Next Generation Sequencing Data. John Osborne Sept 14, 2012

Variant Detection in Next Generation Sequencing Data. John Osborne Sept 14, 2012 + Variant Detection in Next Generation Sequencing Data John Osborne Sept 14, 2012 + Overview My Bias Talk slanted towards analyzing whole genomes using Illumina paired end reads with open source tools

More information

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio

More information

Philippe Hupé 1,2. The R User Conference 2009 Rennes

Philippe Hupé 1,2. The R User Conference 2009 Rennes A suite of R packages for the analysis of DNA copy number microarray experiments Application in cancerology Philippe Hupé 1,2 1 UMR144 Institut Curie, CNRS 2 U900 Institut Curie, INSERM, Mines Paris Tech

More information

Quantifying gene expression

Quantifying gene expression Quantifying gene expression Genome GTF (annotation)? Sequence reads FASTQ FASTQ (+reference transcriptome index) Quality control FASTQ Alignment to Genome: HISAT2, STAR (+reference genome index) (known

More information

NGS, a suitable approach for TP53 screening in CLL?

NGS, a suitable approach for TP53 screening in CLL? NGS, a suitable approach for TP53 screening in CLL? Ferran Nadeu 2nd ERIC WORKSHOP ON TP53 ANALYSIS IN CHRONIC LYMPHOCYTIC LEUKEMIA 7-8 November 2017, Stresa (Italy) The Sanger sequencing bottleneck 1

More information

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio

More information

Introduction to human genomics and genome informatics

Introduction to human genomics and genome informatics Introduction to human genomics and genome informatics Session 1 Prince of Wales Clinical School Dr Jason Wong ARC Future Fellow Head, Bioinformatics & Integrative Genomics Adult Cancer Program, Lowy Cancer

More information

HaloPlex HS. Get to Know Your DNA. Every Single Fragment. Kevin Poon, Ph.D.

HaloPlex HS. Get to Know Your DNA. Every Single Fragment. Kevin Poon, Ph.D. HaloPlex HS Get to Know Your DNA. Every Single Fragment. Kevin Poon, Ph.D. Sr. Global Product Manager Diagnostics & Genomics Group Agilent Technologies For Research Use Only. Not for Use in Diagnostic

More information

QIAseq SPE technology for Illumina : Redefining amplicon sequencing

QIAseq SPE technology for Illumina : Redefining amplicon sequencing Application Note QIAseq SPE technology for Illumina : Redefining amplicon sequencing Amplicon-based enrichment and sequencing takes advantage of PCR workflows to turn amplicons that represent regions of

More information

Next Generation Sequencing of CFTR from dried blood spots using the Ion Torrent PGM

Next Generation Sequencing of CFTR from dried blood spots using the Ion Torrent PGM Next Generation Sequencing of CFTR from dried blood spots using the Ion Torrent PGM Miyono Hendrix Newborn Screening & Genetic Testing Symposium October 27, 2014 National Center for Environmental Health

More information

Sequencing applications. Today's outline. Hands-on exercises. Applications of short-read sequencing: RNA-Seq and ChIP-Seq

Sequencing applications. Today's outline. Hands-on exercises. Applications of short-read sequencing: RNA-Seq and ChIP-Seq Sequencing applications Applications of short-read sequencing: RNA-Seq and ChIP-Seq BaRC Hot Topics March 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ RNA-Seq includes experiments

More information

Understanding the science and technology of whole genome sequencing

Understanding the science and technology of whole genome sequencing Understanding the science and technology of whole genome sequencing Dag Undlien Department of Medical Genetics Oslo University Hospital University of Oslo and The Norwegian Sequencing Centre d.e.undlien@medisin.uio.no

More information

ChIP-seq analysis 2/28/2018

ChIP-seq analysis 2/28/2018 ChIP-seq analysis 2/28/2018 Acknowledgements Much of the content of this lecture is from: Furey (2012) ChIP-seq and beyond Park (2009) ChIP-seq advantages + challenges Landt et al. (2012) ChIP-seq guidelines

More information

Alignment & Variant Discovery. J Fass UCD Genome Center Bioinformatics Core Tuesday June 17, 2014

Alignment & Variant Discovery. J Fass UCD Genome Center Bioinformatics Core Tuesday June 17, 2014 Alignment & Variant Discovery J Fass UCD Genome Center Bioinformatics Core Tuesday June 17, 2014 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG

More information

Assignment 9: Genetic Variation

Assignment 9: Genetic Variation Assignment 9: Genetic Variation Due Date: Friday, March 30 th, 2018, 10 am In this assignment, you will profile genome variation information and attempt to answer biologically relevant questions. The variant

More information

Genetic Testing in the Clinic. Anne Goodeve Sheffield Diagnostic Genetics Service Sheffield Children s NHS Foundation Trust

Genetic Testing in the Clinic. Anne Goodeve Sheffield Diagnostic Genetics Service Sheffield Children s NHS Foundation Trust Genetic Testing in the Clinic Anne Goodeve Sheffield Diagnostic Genetics Service Sheffield Children s NHS Foundation Trust Disclosures for Anne Goodeve In compliance with COI policy, ISTH requires the

More information

Variant prioritization in NGS studies: Annotation and Filtering "

Variant prioritization in NGS studies: Annotation and Filtering Variant prioritization in NGS studies: Annotation and Filtering Colleen J. Saunders (PhD) DST/NRF Innovation Postdoctoral Research Fellow, South African National Bioinformatics Institute/MRC Unit for Bioinformatics

More information

Analysis of RNA-seq Data. Feb 8, 2017 Peikai CHEN (PHD)

Analysis of RNA-seq Data. Feb 8, 2017 Peikai CHEN (PHD) Analysis of RNA-seq Data Feb 8, 2017 Peikai CHEN (PHD) Outline What is RNA-seq? What can RNA-seq do? How is RNA-seq measured? How to process RNA-seq data: the basics How to visualize and diagnose your

More information