Variant detection analysis in the BRCA1/2 genes from Ion torrent PGM data
|
|
- Berenice Brown
- 6 years ago
- Views:
Transcription
1 Variant detection analysis in the BRCA1/2 genes from Ion torrent PGM data Bruno Zeitouni Bionformatics department of the Institut Curie Inserm U900 Mines ParisTech Ion Torrent User Meeting 2012, October 10th
2 The Institut Curie, Paris (France) - Private organization which contributes to the public health system - Cancer, the first cause of mortality (13% of overall deaths) - Two major entities : 1) the hospital group *diagnostics (imaging, pathology, laboratory testing) *therapeutics (surgery, radiotherapy, medical treatments, support treatment) 2) the research center *cancer research groups *core facilities: microarray, NGS, Bioinformatics
3 Question - NGS core facility : 2 SOLiD 5500, 1 HiSeq 2000, 2 Ion torrent PGM - IT & Bionformatics depts: CPU and storage ressources Can we use the ion torrent technology for accurate routine diagnosis? > Application to the BRCA1/2 genes
4 A pilot study for BRCA1/2 analysis by Ion PGM 3 ion PGM test runs : - Run 1 (12/2011): 16 samples with known BRCA1/2 mutations SNPs, Indels (ins50, del29, del11), Gain/loss of exon(s) (delbrca1ex1-7, delbrca2, dupbrca2ex19-20) chip Run 2 (06/2012): 16 samples not genotyped for BRCA1/2 = routine case EMMA/Capillary sequencing done in parallel chip Run 3 (09/2012): 30 samples, known indels in homopolymers (80%) chip 318
5 Experimental design Patient s biological sample : constitutional DNA Genomic DNA extraction Amplification of coding regions in BRCA1/2 genes : Multiplicom BRCA MASTR v2.1 assay Fragment size selection (200bp) & library construction Sequencing on the ion PGM (316/318 chip) Variant detection bioinformatics pipeline Variant validation and final report to geneticist
6 Variant detection bioinformatics pipeline Ion torrent chip READ MAPPING Base calling Sequencing reads SFF format QC Mapping with TMAP hg19 genome VARIANT CALLING ION VARIANT CALLER V2.2.3 package DiBayes GATK Stringency-- VARIANT FILTERING SNVs Indels QC VARIANT ANNOTATION ANNOVAR Unknown CDS or splicing site variants List of targets BED format QC Focus on targeted regions COV 30 VarFreq SNV 0.3 VarFreq Indel 0.2 StrandRatio 0.2 Homozygotes: No DESEQ VARIANT VIEW IGV UCSC Browser Alamut QC Read alignments BAM Format QC: Quality control Groups of PCR multiplexes VCF format RGTs Candidate variants SANGER Validation
7 Mapping and enrichment statistics Run 1 puce 316 fastqc Mean quality Q27 and coverage of 350X Very good mapping data: >99% of mapped reads Excellent enrichment results (99% of targets) No bias in forward/reverse strand coverage
8 Results: SNVs and Indels Run 1 Run 2 Sn FP rate Sn FP rate SNVs 92.6% (25) 30.5% (11) 100% (32) 5,9% (2) n=27 n=32 Indels 91.7% (11) 0% (0) 100% (3) 25% (1) n=12 n=3 hp- Indels Run 3 Sn FP rate? 44% (11) 47.6% (10) n=25 Sn: Sensitivity FP: False-Positive n = number of expected variants
9 Minimum of coverage required to variant detection % of true-positives at different values of depth-of-coverage Estimated minimum of coverage required - SNVs ~ 30X - Indels ~ 100X
10 Results: Gain/Loss of exons * Log2 Fold-Change * Run 1 Run 2 * BRCA1 Exons FDR 10%
11 The Target-PGM pipeline available to end-users in Galaxy Graphical interface of Galaxy
12 Conclusion - The ion torrent technology allows to detect the SNV/Indel variants and seems to be suitable for routine usage - The PCR technique enrichment showed excellent performance (99% of reads on targets) - Accuracy of the specific mapping method developed in the TMAP software - Excellent sensitivity for SNV detection, correct specificity - Very good specificity for Indel detection, average sensitivity > Issues in the detection of indels in homopolymers The transfer of NGS to the BRCA genetic analysis using the ion PGM is workable
13 Acknowledgements Cancer Genetics dept of the IC hospital Claude Houdayer Julien Tarabeux Lisa Golmard Virgine Moncoutier Dominique Stoppa-Lyonnet Marc-Henri Stern NGS core facility of the IC Thomas Rio Frio Quentin Leroy Bioinformatics dept of the IC Séverine Lair Alban Lermine Nicolas Servant Philippe Hupé Emmanuel Barillot Thank you for your attention!
Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4
WHITE PAPER Oncomine Comprehensive Assay Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4 Contents Scope and purpose of document...2 Content...2 How Torrent
More informationProcessing Ion AmpliSeq Data using NextGENe Software v2.3.0
Processing Ion AmpliSeq Data using NextGENe Software v2.3.0 July 2012 John McGuigan, Megan Manion, Kevin LeVan, CS Jonathan Liu Introduction The Ion AmpliSeq Panels use highly multiplexed PCR in order
More informationEcole de Bioinforma(que AVIESAN Roscoff 2014 GALAXY INITIATION. A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech
GALAXY INITIATION A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech How does Next- Gen sequencing work? DNA fragmentation Size selection and clonal amplification Massive parallel sequencing ACCGTTTGCCG
More informationPractical Considerations for Implementation of Clinical Sequencing. Emily Winn-Deen, Ph.D. April 2017
Practical Considerations for Implementation of Clinical Sequencing Emily Winn-Deen, Ph.D. April 2017 1. DEFINE THE CLINICAL PROBLEM TO BE ADDRESSED Focused panels Targeted Gene Panels Gene or disease-based
More informationWelcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
More informationSNP calling. Jose Blanca COMAV institute bioinf.comav.upv.es
SNP calling Jose Blanca COMAV institute bioinf.comav.upv.es SNP calling Genotype matrix Genotype matrix: Samples x SNPs SNPs and errors A change in a read may due to: Sample contamination Cloning or PCR
More informationAnalytics Behind Genomic Testing
A Quick Guide to the Analytics Behind Genomic Testing Elaine Gee, PhD Director, Bioinformatics ARUP Laboratories 1 Learning Objectives Catalogue various types of bioinformatics analyses that support clinical
More informationDNA concentration and purity were initially measured by NanoDrop 2000 and verified on Qubit 2.0 Fluorometer.
DNA Preparation and QC Extraction DNA was extracted from whole blood or flash frozen post-mortem tissue using a DNA mini kit (QIAmp #51104 and QIAmp#51404, respectively) following the manufacturer s recommendations.
More informationSetting Standards and Raising Quality for Clinical Bioinformatics. Joo Wook Ahn, Guy s & St Thomas 04/07/ ACGS summer scientific meeting
Setting Standards and Raising Quality for Clinical Bioinformatics Joo Wook Ahn, Guy s & St Thomas 04/07/2016 - ACGS summer scientific meeting 1. Best Practice Guidelines Draft guidelines circulated to
More informationAssay Validation Services
Overview PierianDx s assay validation services bring clinical genomic tests to market more rapidly through experimental design, sample requirements, analytical pipeline optimization, and criteria tuning.
More informationStatistical method for Next Generation Sequencing pipeline comparison
Statistical method for Next Generation Sequencing pipeline comparison Pascal Roy, MD PhD EPICLIN 2016 Strasbourg 25-27 mai 2016 MH Elsensohn 1-4*, N Leblay 1-4, S Dimassi 5,6, A Campan-Fournier 5,6, A
More informationImplementation of Ion AmpliSeq in molecular diagnostics
Implementation of Ion AmpliSeq in molecular diagnostics The Rotterdam Experience Ronald van Marion Deelnemersbijeenkomst SKML sectie Pathologie Amersfoort, 26 mei 2016 Molecular Diagnostics in Rotterdam
More informationNGS in Pathology Webinar
NGS in Pathology Webinar NGS Data Analysis March 10 2016 1 Topics for today s presentation 2 Introduction Next Generation Sequencing (NGS) is becoming a common and versatile tool for biological and medical
More informationwith drmid Dx for Illumina NGS systems
Performance Characteristics BRCA MASTR Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Revision date: July 27, 2017 Page 1 of 8 Table of Contents
More informationSingle Nucleotide Variant Analysis. H3ABioNet May 14, 2014
Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide
More informationReads to Discovery. Visualize Annotate Discover. Small DNA-Seq ChIP-Seq Methyl-Seq. MeDIP-Seq. RNA-Seq. RNA-Seq.
Reads to Discovery RNA-Seq Small DNA-Seq ChIP-Seq Methyl-Seq RNA-Seq MeDIP-Seq www.strand-ngs.com Analyze Visualize Annotate Discover Data Import Alignment Vendor Platforms: Illumina Ion Torrent Roche
More informationHigh Cross-Platform Genotyping Concordance of Axiom High-Density Microarrays and Eureka Low-Density Targeted NGS Assays
High Cross-Platform Genotyping Concordance of Axiom High-Density Microarrays and Eureka Low-Density Targeted NGS Assays Ali Pirani and Mohini A Patil ISAG July 2017 The world leader in serving science
More informationBICF Variant Analysis Tools. Using the BioHPC Workflow Launching Tool Astrocyte
BICF Variant Analysis Tools Using the BioHPC Workflow Launching Tool Astrocyte Prioritization of Variants SNP INDEL SV Astrocyte BioHPC Workflow Platform Allows groups to give easy-access to their analysis
More information14 March, 2016: Introduction to Genomics
14 March, 2016: Introduction to Genomics Genome Genome within Ensembl browser http://www.ensembl.org/homo_sapiens/location/view?db=core;g=ensg00000139618;r=13:3231547432400266 Genome within Ensembl browser
More informationFunctional DNA Quality Analysis Improves the Accuracy of Next Generation Sequencing from Clinical Specimens
Functional DNA Quality Analysis Improves the Accuracy of Next Generation Sequencing from Clinical Specimens Overview We have developed a novel QC, the SuraSeq DNA Quantitative Functional Index (QFI ).
More informationSequencing and PCR. Training: Ion S5 and S5 XL Systems workflow training
Training: Ion S5 and S5 XL Systems workflow training This interactive course focuses on the Ion S5 and Ion S5 XL Systems operation and the Ion AmpliSeq workflow on the Ion Chef System for sequencing. The
More informationNext-Generation Sequencing. Technologies
Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062
More informationCourse Presentation. Ignacio Medina Presentation
Course Index Introduction Agenda Analysis pipeline Some considerations Introduction Who we are Teachers: Marta Bleda: Computational Biologist and Data Analyst at Department of Medicine, Addenbrooke's Hospital
More informationSNP calling and VCF format
SNP calling and VCF format Laurent Falquet, Oct 12 SNP? What is this? A type of genetic variation, among others: Family of Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide
More informationG E N OM I C S S E RV I C ES
GENOMICS SERVICES ABOUT T H E N E W YOR K G E NOM E C E N T E R NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. Through
More informationEnterprise Interest I am an employee of ThermoFisher Scientific.
Enterprise Interest I am an employee of ThermoFisher Scientific. Developing a multiplex next-generation sequencing assay to study highly clonal tumor samples Dumitru Brinza, Ph.D Clinical Next-Generation
More informationQIAseq Targeted Panel Analysis Plugin USER MANUAL
QIAseq Targeted Panel Analysis Plugin USER MANUAL User manual for QIAseq Targeted Panel Analysis 1.1 Windows, macos and Linux June 18, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej
More informationTargeted Sequencing in the NBS Laboratory
Targeted Sequencing in the NBS Laboratory Christopher Greene, PhD Newborn Screening and Molecular Biology Branch Division of Laboratory Sciences Gene Sequencing in Public Health Newborn Screening February
More informationC3BI. VARIANTS CALLING November Pierre Lechat Stéphane Descorps-Declère
C3BI VARIANTS CALLING November 2016 Pierre Lechat Stéphane Descorps-Declère General Workflow (GATK) software websites software bwa picard samtools GATK IGV tablet vcftools website http://bio-bwa.sourceforge.net/
More informationAlissa Interpret The next evolution of Cartagenia Bench
Alissa Interpret The next evolution of Cartagenia Bench Case Study: An Efficient Clinical Pipeline for Microcephaly, RASopathy and Leukodystrophy Gene Panels Using Alissa Interpret s Flexible Classification
More informationDeep Sequencing technologies
Deep Sequencing technologies Gabriela Salinas 30 October 2017 Transcriptome and Genome Analysis Laboratory http://www.uni-bc.gwdg.de/index.php?id=709 Microarray and Deep-Sequencing Core Facility University
More informationDesign a super panel for comprehensive genetic testing
Design a super panel for comprehensive genetic testing Rong Chen, Ph.D. Assistant Professor Director of Clinical Genome Sequencing Dept. of Genetics and Genomic Sciences Institute for Genomics and Multiscale
More informationYour Best Data: Teaming QIAGEN Chemistry & Bioinformatics to Drive Samples to Insight
Your Best Data: Teaming QIAGEN Chemistry & Bioinformatics to Drive Samples to Insight Aysel Heckel Director Clinical Solutions Sales Dr. Anne Arens Field Application Scientist Course on Variant Detection
More informationSEQUENCING. M Ataei, PhD. Feb 2016
CLINICAL NEXT GENERATION SEQUENCING M Ataei, PhD Tehran Medical Genetics Laboratory Feb 2016 Overview 2 Background NGS in non-invasive prenatal diagnosis (NIPD) 3 Background Background 4 In the 1970s,
More informationA Crash Course in NGS for GI Pathologists. Sandra O Toole
A Crash Course in NGS for GI Pathologists Sandra O Toole The Sanger Technique First generation sequencing Uses dideoxynucleotides (dideoxyadenine, dideoxyguanine, etc) These are molecules that resemble
More informationSanger vs Next-Gen Sequencing
Tools and Algorithms in Bioinformatics GCBA815/MCGB815/BMI815, Fall 2017 Week-8: Next-Gen Sequencing RNA-seq Data Analysis Babu Guda, Ph.D. Professor, Genetics, Cell Biology & Anatomy Director, Bioinformatics
More informationNext generation sequencing in diagnostic laboratories: opportunities and challenges
Next generation sequencing in diagnostic laboratories: opportunities and challenges Vitali Sintchenko Marie Bashir Institute for Emerging Infectious Diseases & Biosecurity Declaration No conflict of interest
More informationIntroducing combined CGH and SNP arrays for cancer characterisation and a unique next-generation sequencing service. Dr. Ruth Burton Product Manager
Introducing combined CGH and SNP arrays for cancer characterisation and a unique next-generation sequencing service Dr. Ruth Burton Product Manager Today s agenda Introduction CytoSure arrays and analysis
More informationFrom Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow
From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with
More informationVariant calling in NGS experiments
Variant calling in NGS experiments Jorge Jiménez jjimeneza@cipf.es BIER CIBERER Genomics Department Centro de Investigacion Principe Felipe (CIPF) (Valencia, Spain) 1 Index 1. NGS workflow 2. Variant calling
More informationIDENTIFYING A DISEASE CAUSING MUTATION
IDENTIFYING A DISEASE CAUSING MUTATION Targeted resequencing MARCELA DAVILA 3/MZO/2016 Core Facilities at Sahlgrenska Academy Statistics Software bioinformatics@gu.se www.cf.gu.se/english// Increasing
More informationBioinformatics Advice on Experimental Design
Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics
More informationNGS, Cancer and Bioinformatics. 5/3/2015 Yannick Boursin
NGS, Cancer and Bioinformatics 5/3/2015 Yannick Boursin 1 NGS and Clinical Oncology NGS in hereditary cancer genome testing BRCA1/2 (breast/ovary cancer) XPC (melanoma) ERCC1 (colorectal cancer) NGS for
More informationTranscriptome analysis
Statistical Bioinformatics: Transcriptome analysis Stefan Seemann seemann@rth.dk University of Copenhagen April 11th 2018 Outline: a) How to assess the quality of sequencing reads? b) How to normalize
More informationStatistical method to compare massive parallel sequencing pipelines
Statistical method to compare massive parallel sequencing pipelines Delphine Maucort-Boulch MD PhD Mad-Hélénie Elsensohn Msc, Florence Roucher-Boulez PharmD PhD, Claire Bardel PhD, Pascal Roy MD PhD Service
More informationDevelopment and characterization of a high throughput targeted genotypingby-sequencing solution for agricultural genetic applications
Development and characterization of a high throughput targeted genotypingby-sequencing solution for agricultural genetic applications Michelle Swimley 1, Angela Burrell 1, Prasad Siddavatam 1, Chris Willis
More informationIon S5 and Ion S5 XL Systems
Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Explore the Ion S5 and Ion S5 XL Systems Adopting next-generation sequencing (NGS) in your lab is now simpler than ever The Ion S5
More informationOncomine cfdna Assays Part III: Variant Analysis
Oncomine cfdna Assays Part III: Variant Analysis USER GUIDE for use with: Oncomine Lung cfdna Assay Oncomine Colon cfdna Assay Oncomine Breast cfdna Assay Catalog Numbers A31149, A31182, A31183 Publication
More informationAccess Array BRCA1 / BRCA2 / TP53 Target-Specific Panel Build the highest quality amplicon libraries with qualified assays
DATA SHEET PN 100-3489 B1 Access Array BRCA1 / BRCA2 / TP53 Target-Specific Panel Build the highest quality amplicon libraries with qualified assays Covers 100% of the exons within the genes Supported
More informationIntroduction to RNA-Seq in GeneSpring NGS Software
Introduction to RNA-Seq in GeneSpring NGS Software Dipa Roy Choudhury, Ph.D. Strand Scientific Intelligence and Agilent Technologies Learn more at www.genespring.com Introduction to RNA-Seq In a few years,
More informationIon S5 and Ion S5 XL Systems
Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Explore the Ion S5 and Ion S5 XL Systems Adopting next-generation sequencing (NGS) in your lab is now simpler than ever The Ion S5
More informationMatthew Tinning Australian Genome Research Facility. July 2012
Next-Generation Sequencing: an overview of technologies and applications Matthew Tinning Australian Genome Research Facility July 2012 History of Sequencing Where have we been? 1869 Discovery of DNA 1909
More informationMaximizing your NGS sequencing with IDT. Adam Chernick, PhD Field Applications Manager, Functional Genomics
Maximizing your NGS sequencing with IDT Adam Chernick, PhD Field Applications Manager, Functional Genomics 1 Contents Expanding our NGS portfolio what s next? xgen technology and Lockdown probe advantages
More informationIntroduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017
Introduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017 Topics to cover today What is Next Generation Sequencing (NGS)? Why do we need NGS? Common approaches to NGS NGS
More informationValidation of Identity and Ancestry SNP Panels for the Ion PGM
Validation of Identity and Ancestry SNP Panels for the Ion PGM Christopher Phillips, Carla Santos, Maria de la Puente, Manuel Fondevila, Ángel Carracedo, Maviky Lareu Forensic Genetics Unit, University
More informationQuality assurance in NGS (diagnostics)
Quality assurance in NGS (diagnostics) Chris Mattocks National Genetics Reference Laboratory (Wessex) Research Diagnostics Quality assurance Any systematic process of checking to see whether a product
More informationThe Final Frontier. Data Analysis. Jean Jasinski, Ph.D. Field Application Scientist Sept. 27, 2017
The Final Frontier Data Analysis Jean Jasinski, Ph.D. Field Application Scientist Sept. 27, 2017 1 For Research Use Only. Not for use in diagnostic procedures. Final Frontier: Data Analysis Agenda Introduction
More informationIntroduction to Next Generation Sequencing (NGS) Data Analysis and Pathway Analysis. Jenny Wu
Introduction to Next Generation Sequencing (NGS) Data Analysis and Pathway Analysis Jenny Wu Outline Introduction to NGS data analysis in Cancer Genomics NGS applications in cancer research Typical NGS
More informationNext Generation Sequencing and Bioinformatics Analysis Pipelines. Adam Ameur National Genomics Infrastructure SciLifeLab Uppsala
GA N AT ION ALCTAC ATCA G ENOMI C SGT INF R A S T RU CTURE Next Generation Sequencing and Bioinformatics Analysis Pipelines Adam Ameur National Genomics Infrastructure SciLifeLab Uppsala adam.ameur@igp.uu.se
More informationNext Generation Sequencing: Data analysis for genetic profiling
Next Generation Sequencing: Data analysis for genetic profiling Raed Samara, Ph.D. Global Product Manager Raed.Samara@QIAGEN.com Welcome to the NGS webinar series - 2015 NGS Technology Webinar 1 NGS: Introduction
More informationGalaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory http://collaboratory.lifesci.ucla.edu Workshop Outline ü Day 1 UCLA galaxy
More informationTitelstijl van model bewerken
Generate Titelstijl van and verify model your bewerken data Solutions for all your genetic analysis needs Sanger Sequencing Microarray technology QuantStudio real-time and digital PCR Ion Torrent NGS systems
More informationRead Mapping and Variant Calling. Johannes Starlinger
Read Mapping and Variant Calling Johannes Starlinger Application Scenario: Personalized Cancer Therapy Different mutations require different therapy Collins, Meredith A., and Marina Pasca di Magliano.
More informationDNBseq TM SERVICE OVERVIEW Plant and Animal Whole Genome Re-Sequencing
TM SERVICE OVERVIEW Plant and Animal Whole Genome Re-Sequencing Plant and animal whole genome re-sequencing (WGRS) involves sequencing the entire genome of a plant or animal and comparing the sequence
More informationWhole Human Genome Sequencing Report This is a technical summary report for PG DNA
Whole Human Genome Sequencing Report This is a technical summary report for PG0002601-DNA Physician and Patient Information Physician name: Vinodh Naraynan Address: Suite 406 222 West Thomas Road Phoenix
More informationresequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics
RNA Sequencing T TM variation genetics validation SNP ncrna metagenomics private trio de novo exome mendelian ChIP-seq RNA DNA bioinformatics custom target high-throughput resequencing storage ncrna comparative
More informationComparing a few SNP calling algorithms using low-coverage sequencing data
Yu and Sun BMC Bioinformatics 2013, 14:274 RESEARCH ARTICLE Open Access Comparing a few SNP calling algorithms using low-coverage sequencing data Xiaoqing Yu 1 and Shuying Sun 1,2* Abstract Background:
More informationSurely Better Target Enrichment from Sample to Sequencer
sureselect TARGET ENRICHMENT solutions Surely Better Target Enrichment from Sample to Sequencer Agilent s market leading SureSelect platform provides a complete portfolio of catalog to custom products,
More informationGet to Know Your DNA. Every Single Fragment.
HaloPlex HS NGS Target Enrichment System Get to Know Your DNA. Every Single Fragment. High sensitivity detection of rare variants using molecular barcodes How Does Molecular Barcoding Work? HaloPlex HS
More informationPioneering Clinical Omics
Pioneering Clinical Omics Clinical Genomics Strand NGS An analysis tool for data generated by cutting-edge Next Generation Sequencing(NGS) instruments. Strand NGS enables read alignment and analysis of
More informationQIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd
QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s
More informationWhole Genome Sequencing in Cancer Diagnostics (research) Nederlandse Pathologiedagen 19 & 20 November 2015
Whole Genome Sequencing in Cancer Diagnostics (research) Nederlandse Pathologiedagen 19 & 20 November 2015 Dr. I.J. Nijman Disclosure slide (Potential) conflict of interest None For this meeting relevant
More informationLong and short/small RNA-seq data analysis
Long and short/small RNA-seq data analysis GEF5, 4.9.2015 Sami Heikkinen, PhD, Dos. Topics 1. RNA-seq in a nutshell 2. Long vs short/small RNA-seq 3. Bioinformatic analysis work flows GEF5 / Heikkinen
More informationForm for publishing your article on BiotechArticles.com this document to
Your Article: Article Title (3 to 12 words) Article Summary (In short - What is your article about Just 2 or 3 lines) Category Transcriptomics sequencing and lncrna Sequencing Analysis: Quality Evaluation
More informationSCIENCE CHINA Life Sciences. High-performance single-chip exon capture allows accurate whole exome sequencing using the Illumina Genome Analyzer
SCIENCE CHINA Life Sciences RESEARCH PAPERS October 2011 Vol.54 No.10: 945 952 doi: 10.1007/s11427-011-4232-4 High-performance single-chip exon capture allows accurate whole exome sequencing using the
More informationSummary of key processes for tumor BRCA testing. Q&A Session Hadassah Medical Center, Jerusalem Sabine Merkelbach-Bruse
Summary of key processes for tumor BRCA testing Q&A Session 29.01.2018 Hadassah Medical Center, Jerusalem Sabine Merkelbach-Bruse Review of key processes Overview Summary of key processes Quality assurance
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationApplications of short-read
Applications of short-read sequencing: RNA-Seq and ChIP-Seq BaRC Hot Topics March 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ Sequencing applications RNA-Seq includes experiments
More informationSEQUENCING FROM SAMPLE TO SEQUENCE READY
SEQUENCING FROM SAMPLE TO SEQUENCE READY ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES NOT ONCE, BUT EVERY TIME n The highest quality amplicons more sensitive, accurate, and specific n Full support for all
More informationChIP-seq and RNA-seq. Farhat Habib
ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions
More informationBioinformatics small variants Data Analysis. Guidelines. genomescan.nl
Next Generation Sequencing Bioinformatics small variants Data Analysis Guidelines genomescan.nl GenomeScan s Guidelines for Small Variant Analysis on NGS Data Using our own proprietary data analysis pipelines
More informationValidation and optimization of the Ion Torrent S5 XL sequencer and Oncomine workflow for BRCA1 and BRCA2 genetic testing
/, 207, Vol. 8, (No. 2), pp: 4858-4866 Validation and optimization of the Ion Torrent S5 XL sequencer and Oncomine workflow for BRCA and BRCA2 genetic testing Saeam Shin,2,*, Yoonjung Kim,*, Seoung Chul
More informationVariant Detection in Next Generation Sequencing Data. John Osborne Sept 14, 2012
+ Variant Detection in Next Generation Sequencing Data John Osborne Sept 14, 2012 + Overview My Bias Talk slanted towards analyzing whole genomes using Illumina paired end reads with open source tools
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationPhilippe Hupé 1,2. The R User Conference 2009 Rennes
A suite of R packages for the analysis of DNA copy number microarray experiments Application in cancerology Philippe Hupé 1,2 1 UMR144 Institut Curie, CNRS 2 U900 Institut Curie, INSERM, Mines Paris Tech
More informationQuantifying gene expression
Quantifying gene expression Genome GTF (annotation)? Sequence reads FASTQ FASTQ (+reference transcriptome index) Quality control FASTQ Alignment to Genome: HISAT2, STAR (+reference genome index) (known
More informationNGS, a suitable approach for TP53 screening in CLL?
NGS, a suitable approach for TP53 screening in CLL? Ferran Nadeu 2nd ERIC WORKSHOP ON TP53 ANALYSIS IN CHRONIC LYMPHOCYTIC LEUKEMIA 7-8 November 2017, Stresa (Italy) The Sanger sequencing bottleneck 1
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationIntroduction to human genomics and genome informatics
Introduction to human genomics and genome informatics Session 1 Prince of Wales Clinical School Dr Jason Wong ARC Future Fellow Head, Bioinformatics & Integrative Genomics Adult Cancer Program, Lowy Cancer
More informationHaloPlex HS. Get to Know Your DNA. Every Single Fragment. Kevin Poon, Ph.D.
HaloPlex HS Get to Know Your DNA. Every Single Fragment. Kevin Poon, Ph.D. Sr. Global Product Manager Diagnostics & Genomics Group Agilent Technologies For Research Use Only. Not for Use in Diagnostic
More informationQIAseq SPE technology for Illumina : Redefining amplicon sequencing
Application Note QIAseq SPE technology for Illumina : Redefining amplicon sequencing Amplicon-based enrichment and sequencing takes advantage of PCR workflows to turn amplicons that represent regions of
More informationNext Generation Sequencing of CFTR from dried blood spots using the Ion Torrent PGM
Next Generation Sequencing of CFTR from dried blood spots using the Ion Torrent PGM Miyono Hendrix Newborn Screening & Genetic Testing Symposium October 27, 2014 National Center for Environmental Health
More informationSequencing applications. Today's outline. Hands-on exercises. Applications of short-read sequencing: RNA-Seq and ChIP-Seq
Sequencing applications Applications of short-read sequencing: RNA-Seq and ChIP-Seq BaRC Hot Topics March 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ RNA-Seq includes experiments
More informationUnderstanding the science and technology of whole genome sequencing
Understanding the science and technology of whole genome sequencing Dag Undlien Department of Medical Genetics Oslo University Hospital University of Oslo and The Norwegian Sequencing Centre d.e.undlien@medisin.uio.no
More informationChIP-seq analysis 2/28/2018
ChIP-seq analysis 2/28/2018 Acknowledgements Much of the content of this lecture is from: Furey (2012) ChIP-seq and beyond Park (2009) ChIP-seq advantages + challenges Landt et al. (2012) ChIP-seq guidelines
More informationAlignment & Variant Discovery. J Fass UCD Genome Center Bioinformatics Core Tuesday June 17, 2014
Alignment & Variant Discovery J Fass UCD Genome Center Bioinformatics Core Tuesday June 17, 2014 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
More informationAssignment 9: Genetic Variation
Assignment 9: Genetic Variation Due Date: Friday, March 30 th, 2018, 10 am In this assignment, you will profile genome variation information and attempt to answer biologically relevant questions. The variant
More informationGenetic Testing in the Clinic. Anne Goodeve Sheffield Diagnostic Genetics Service Sheffield Children s NHS Foundation Trust
Genetic Testing in the Clinic Anne Goodeve Sheffield Diagnostic Genetics Service Sheffield Children s NHS Foundation Trust Disclosures for Anne Goodeve In compliance with COI policy, ISTH requires the
More informationVariant prioritization in NGS studies: Annotation and Filtering "
Variant prioritization in NGS studies: Annotation and Filtering Colleen J. Saunders (PhD) DST/NRF Innovation Postdoctoral Research Fellow, South African National Bioinformatics Institute/MRC Unit for Bioinformatics
More informationAnalysis of RNA-seq Data. Feb 8, 2017 Peikai CHEN (PHD)
Analysis of RNA-seq Data Feb 8, 2017 Peikai CHEN (PHD) Outline What is RNA-seq? What can RNA-seq do? How is RNA-seq measured? How to process RNA-seq data: the basics How to visualize and diagnose your
More information