Alternative Cleavage and Polyadenylation of RNA
|
|
- Vincent Lambert
- 6 years ago
- Views:
Transcription
1 Developmental Cell 18 Supplemental Information The Spen Family Protein FPA Controls Alternative Cleavage and Polyadenylation of RNA Csaba Hornyik, Lionel C. Terzi, and Gordon G. Simpson Figure S1, related to Figure 4. FPA controls alternative polyadenylation of FPA premrna directly (A) Alternative polyadenylation of FPA mrna is unaffected by FLC. RNA gel blot analysis of alternative polyadenylation of FPA mrna in WT and autonomous pathway 1
2 mutants with elevated FLC levels: fve-3, ld-1, fca-9, fpa-7. FPA was detected with the same probe as used in Figure 1 and -TUBULIN was used as a loading control. (B) RNA gel blot analysis of alternative polyadenylation of FPA mrna in WT and fpa-7 compared with FLC null mutant flc-3 plants and fpa-7 flc-3 backgrounds. FPA was detected with the same probe as used in Figure 1 and -TUBULIN was used as a loading control. (C) Western blot analysis of different wild-type and fpa mutant backgrounds using anti- FPA antibodies. Coomassie staining of the corresponding proteins is shown as a loading control. (D) Association of Pol II with distal poly(a) sites in FPA chromatin is unaffected by genotypes with contrasting patterns of FPA poly(a) site selection. ChIP of Pol II at the FPA locus. Schematic depiction of FPA locus with exons shown as black rectangles and introns as gray lines. Poly(A) sites (PAS) are indicated. The chromatin regions analysed by qpcr are boxed. WT plants and lines expressing 35S::FPA:YFP and fpa-8 mutants were subjected to ChIP using anti-pol II antibodies (8WG16) followed by qpcr. Histograms show mean values SE obtained for four PCR amplifications. Figure S2, related to Figure 5. Changes in FPA activity correlate with differences in processing of antisense RNAs at the FLC locus 2
3 (A) Read-through defects in the gene upstream of FLC does not explain elevated FLC expression in fpa mutants. Schematic representation of FLC and adjacent loci. Rectangles represent exons and lines depict introns. Arrow heads and numbers identify position of primers used, and regions amplified in RT-qPCR. (B) RT-qPCR analysis of FLC, At5g10150 and intergenic transcription. Histograms show mean values SE for three independent PCR amplifications on three biological replicate samples. (C) Chromatograms of RT-PCR analysis of class I and class II antisense RNAs at the FLC locus from fpa-8 plants. The same primers used for RT-qPCR were used except that the forward primer was labeled with 6-FAM. The x axis shows size (bp) and the y axis the relative fluorescence signal. The position of the spliced variants identified by cloning (Figure 5a) are indicated. No RT controls are shown below. 3
4 Figure S3, related to Figure 6. Read-through from upstream Pol II gene explains AtSN1 up-regulation in fpa mutants (A) FPA does not play a generic role in silencing A. thaliana SINEs. RT-qPCR analysis of expression of the SINE, SB2-17 (At5TE38215), in WT, fpa-7 and a Pol V mutant background (drd3-7). Histograms show mean values SE for three independent PCR amplifications on three biological replicate samples. 4
5 (B) RT-qPCR signal detected at AtSN1 in fpa mutants arises from the same strand as At3g Strand-specific RT-PCR analysis of transcription at AtSN1. RT-PCR products were separated on agarose gels and stained with ethidium bromide. ACTIN2 and no RT and no RNA controls are included. (C) Estimation of percentage read-through at At3g qpcr analysis of read-through and mrna in WT and fpa-8 mutant background. Absolute amounts of RNA were derived from a standard curve prepared from amplification of cloned At3g44010 and downstream sequences. (D) Total amount of read-through RNA depicted in C, showing that there is an increase in the amount of read-through RNA in fpa-8 plants comparing to WT plants. Table S1, related to Figure 5. Antisense FLC RNA isoform sequences Isoform Sequence 5-3 Class I i Class I ii Class II i CTCGATGCAATTCTCACACGAATAAGGTGGCTAATTAAGTAGTGGGAGAGTCACCGGA AGATTGTCGGAGATTTGTCCAGCAGGTGACATCTCCATCTCAGCTTCTGCTCCCACATG ATGATTATTCTCCATCTGTACGATAATCATAGGTCAAAATCACTATTCACTTTCTCTTTTT GTCTTCTATCCAAGGA CTCGATGCAATTCTCACACGAATAAGGTACAAAGTTCATCAACCTTTTGTCTTAAAACAG ATAGTATTGACTTAGTTCCGTCTACTTAAGTATCACACACAAAGTCTCTTGGCCAAAGAG AGAGTATTAAGATATACAAACGCTCGCCCTTATCAGCGGAATAATTACATATCTTATTTT TTTTTTCTTCATAATTATATATGTTTTGGATTTTGATTTCAACCGCCGATTTAAGGTGGCT AATTAAGTAGTGGGAGAGTCACCGGAAGATTGTCGGAGATTTGTCCAGCAGGTGACAT CTCCATCTCAGCTTCTGCTCCCACATGATGATTATTCTCCATCTGTACGATAATCATAGG TCAAAATCACTATTCACTTTCTCTTTTTGTCTTCTATCCAAGGA CTCGATGCAATTCTCACACGAATAAGAAAAGTAAAAGAGCACAAAACAGAAGATAAAAG GGGGAACAAATGAAAACCCAGGTAAGGAAAAGGCGTACTTATCGCCGGAGGAGAA Class II ii CTCGATGCAATTCTCACACGAATAAGGTGGCTAATTAAGTAGTGGGAGAGTCACCGGA AGATTGTCGGAGATTTGTCCAGCAGGTGACATCTCCATCTCAGCTTCTGCTCCCACATG ATGATTATTCTCCATCTGTACGATAATCATAGAAAAGTAAAAGAGCACAAAACAGAAGAT AAAAGGGGGAACAAATGAAAACCCAGGTAAGGAAAAGGCGTACTTATCGCCGGAGGA GAA Class II iii CTCGATGCAATTCTCACACGAATAAGGTGGCTAATTAAGTAGTGGGAGAGTCACCGGA AGATTGTCGGAGATTTGTCCAGCAGAAAAGTAAAAGAGCACAAAACAGAAGATAAAAG GGGGAACAAATGAAAACCCAGGTAAGGAAAGGGCGTACTTATCGCCGGAGGAGAA Class II iv CTCGATGCAATTCTCACACGAATAAGAAAAAAACACAAACAAACACAGAACCGAGAAAC AACAAGAGATCCGCCGGAAAAAAACCAAACGGTAAGGAAAAGACGTACTTATCGCCGG AGGAGAA 5
6 SUPPLEMENTAL EXPERIMENTAL PROCEDURES Plant strains fpa-3, fpa-7 (SALK_021959), flc-3, 35S::FPA fca-1 were provided by R. Amasino (Madison). fca-9, fpa-8, 35S::FPA:YFP fpa-8, were provided by C. Dean (John Innes Centre), fve-3 was provided by J. Martinez-Zapater (Madrid). The Pol V mutant, drd3-7, was provided by M. Matzke (Vienna). The wild-type strains Col-0 and Ler and ld-1, fpa- 1, fpa-2, fca-1, fy-1 were obtained from NASC (UK). 35S::FPA was made by crossing 35S::FPA fca-1 to Ler. fpa-3 has been described (Meier et al., 2001), but our analysis revealed a different mutation to that reported; fpa-3 contains a single deletion corresponding to G 3553 in exon 6. A. thaliana seeds were sown aseptically in MS10 or MS10+Kanamycin (35S::FPA) plates. Seeds were stratified for 2 days at 4 o C. Plants were grown at constant 24 o C under 16 h light/ 8 h dark conditions. Seedlings were harvested 14 days after transfer to 24 o C. Detection of FLC antisense RNA isoforms using RT-PCR with 6-FAM labelled primer For detection of FLC antisense RNA isoforms we used an RT-PCR based method (Simpson et al., 2008). Total RNA was extracted from 100mg seedlings using TRIzol reagent (Invitrogen) and treated with DNaseI (Roche). 2.5 g of total RNA was used for first strand synthesis (MMLV reverse transcriptase, Promega) according to the manufacturer. We used 6-carboxyfluoresceine (6-FAM) labelled forward primer (antisense FLC Class I and Class II) and reverse primer (antisense FLC Class I and Class II) to amplify FLC antisense RNAs with Taq polymerase (Roche). 1 l of 25 l reaction was mixed with 9 l of HiDi formamide containing 0.05 l of GeneScan-500 LIZ (Applied Biosystems) internal size standard. Amplified fragments were separated on a 3730 DNA Analyser (Applied Biosystems); results were analysed using GeneMapper software (Applied Biosystems). 6
7 Table of Primers AMPLICON NAME USED IN FORWARD (F) and REVERSE (R) PRIMER (5' to 3') UBIQUITIN Figures 5 and 6 F: gttggaggatggcagaactc R: tcccagtcaacgtcttaacg FLC Figure S2 - qpcr1 F: gagccaagaagaccgaactc R: ttctgctcccacatgatga FLC_UpIR Figure S2 - qpcr2 F: ataagcattaggttgttcc R: gatagcgagtaagaaacg At5g10150 Figure S2 - qpcr3 F: tatcgacggagacaatggaa R: gagtcaaatcggacgagtca Anti-sense FLC Class I Figures 5b and 5e F: ctcgatgcaattctcacacg R: tccttggatagaagacaaaaagaga Anti-sense FLC Class II Figures 5b and 5e F: ctcgatgcaattctcacacg R: ttctcctccggcgataagta SB2-17 Figure S3a F: ttacatgatgtggtttcgg R: aacatttatccatttccaatg At3TE63855 Figure 6b - qpcr 1 F: cgaccaatgctggagttgta R: aacatcagaacagaacgacca AtSN1_DownIR Figure 6b - qpcr 2 F: tggtacagtgaacgccaaat R: ttggtcctctgtccaattca AtSN1 (At3TE63860) Figure 6b - qpcr 3 F: aaagaagatgaatttctggtatgg R: agcctagttttaattctacggatca AtSN1_UpIR Figure 6b - qpcr 4 F: cactccagctccatgtcatt R: agaaaaagtgacggcaaaaa At3g44005 Figure 6b - qpcr 5 F: ccgaccaccttaaagattttcc R: ccacagccatgcctaacc At3g44006 Figure 6b - qpcr 6 F: aaatgctggcacttcacc R: caccgtttcaggactaacc At3g44010_DownIR Figure 6b - qpcr 7 F: ttttgctttgttaccgttcg R: ggctgcgactgaagtaaaca At3g44010 Figure 6b - qpcr 8, S3 F: aagttggtgcttgattaacg R: ggaagtatggtttgaactgc At3g44010_UpIR Figure 6b - qpcr 9 F: gtcacgatgatgaagaagc R: catgtggatggagaagaaag At3g44010_PCR1 Figure 6d, S3c,d F: cttggattggagacgcatta R: tgatgttttggctattctcgt At3g44010_PCR2 Figure 6d F: cttggattggagacgcatta R: ggaagtatggtttgaactgc ACT2 Figure S3b F: tcatactagtctcgagagatgactcagatcatgtttgag R: tcattctagaggcgcgccacaatttcccgttctgcggtag AtSN1_PCR 1 Figures 6f, S3b F: aaaataagtggtggttgtacaagc R: accaacgtgctgttggcccagtggtaaatc AtSN1_PCR 2 Figure 6f F: aaaataagtggtggttgtacaagc R: agaaaaagtgacggcaaaaa AtSN1_PCR 3 Figure 6f F: cggctttgatttgatgtgaa R: accaacgtgctgttggcccagtggtaaatc ACTIN Figure 4b, 5d, S1c F: gagagattcagatgcccagaagtc R: tggattccagcagcttcca FPA 1 Figure 4b, S1c F: acgtatcatcgcacaattcg R: ccaaaattccaatcccagaa FPA 2 Figure 4b F: ttcgtttgttctctaactttgattg R: tttttggactaaacaagcatca FPA 3 Figure 4b F: ttgacttcttcacaaccattctg R: ccaaataaaccaatccctgaa FPA 4 Figure 4b F: tggggaggtcgataagaatc R: ttgctgctgtttctgctgta FPA 5 Figure 4b, S1c F: ttctaccctctgcctgatga 7
8 FLC-H3 FLC-Mid Figure 5d Figure 5d R: aaatgctccagtttcaacga F: ggttgttatttggtggtgtga R: cttctgctcccacatgatga F: caactggaggaacaccttga R: cacggttgttctcagcaaa SUPPLEMENTAL REFERENCES Meier, C., Bouquin, T., Nielsen, M.E., Raventos, D., Mattsson, O., Rocher, A., Schomburg, F., Amasino, R.M., and Mundy, J. (2001). Gibberellin response mutants identified by luciferase imaging. Plant J 25, Simpson, C.G., Fuller, J., Maronova, M., Kalyna, M., Davidson, D., McNicol, J., Barta, A., and Brown, J.W. (2008). Monitoring changes in alternative precursor messenger RNA splicing in multiple gene transcripts. Plant J 53,
S156AT168AY175A (AAA) were purified as GST-fusion proteins and incubated with GSTfused
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Supplemental Materials Supplemental Figure S1 (a) Phenotype of the wild type and grik1-2 grik2-1 plants after 8 days in darkness.
More informationFigure S1. Figure S2 RT-PCR. qpcr RT-PCR. Northern. IVSwt ΔIVS IVS IVS IVS. NTC mock IVSwt ΔIVS IVS IVS. mock IVSwt ΔIVS
Figure S1 40 cycles IVS IVS IVS NTC wt Δ Δ mut pri-mirna163 * Fig. S1 Transcripts generated from the MIR163 gene variants in which splice sites have been mutated are not spliced. products were separated
More informationSupplemental Figure 1.
Supplemental Data. Charron et al. Dynamic landscapes of four histone modifications during de-etiolation in Arabidopsis. Plant Cell (2009). 10.1105/tpc.109.066845 Supplemental Figure 1. Immunodetection
More informationTranscription Termination and Chimeric RNA Formation Controlled by Arabidopsis thaliana FPA
Transcription Termination and Chimeric RNA Formation Controlled by Arabidopsis thaliana FPA Céline Duc 1, Alexander Sherstnev 1, Christian Cole 1, Geoffrey J. Barton 1 *, Gordon G. Simpson 1,2 * 1 College
More informationSupplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified by primers used for mrna expression analysis. Gray
More informationNature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Validation of CDK9-inhibitor treatment.
Supplementary Figure 1 Validation of CDK9-inhibitor treatment. (a) Schematic of GAPDH with the middle of the amplicons indicated in base pairs. The transcription start site (TSS) and the terminal polyadenylation
More informationJung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh
Developmental Cell, Volume 22 Supplemental Information Control of Seed Germination by Light-Induced Histone Arginine Demethylation Activity Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon
More informationConstruction of plant complementation vector and generation of transgenic plants
MATERIAL S AND METHODS Plant materials and growth conditions Arabidopsis ecotype Columbia (Col0) was used for this study. SALK_072009, SALK_076309, and SALK_027645 were obtained from the Arabidopsis Biological
More informationSUPPLEMENTARY INFORMATION
AS-NMD modulates FLM-dependent thermosensory flowering response in Arabidopsis NATURE PLANTS www.nature.com/natureplants 1 Supplementary Figure 1. Genomic sequence of FLM along with the splice sites. Sequencing
More informationSupplemental Data. Na Xu et al. (2016). Plant Cell /tpc
Supplemental Figure 1. The weak fluorescence phenotype is not caused by the mutation in At3g60240. (A) A mutation mapped to the gene At3g60240. Map-based cloning strategy was used to map the mutated site
More informationSupplemental Figure legends Figure S1. (A) (B) (C) (D) Figure S2. Figure S3. (A-E) Figure S4. Figure S5. (A, C, E, G, I) (B, D, F, H, Figure S6.
Supplemental Figure legends Figure S1. Map-based cloning and complementation testing for ZOP1. (A) ZOP1 was mapped to a ~273-kb interval on Chromosome 1. In the interval, a single-nucleotide G to A substitution
More informationCandidate region (0.74 Mb) ATC TCT GGG ACT CAT GAG CAG GAG GCT AGC ATC TCT GGG ACT CAT TAG CAG GAG GCT AGC
A idm-3 idm-3 B Physical distance (Mb) 4.6 4.86.6 8.4 C Chr.3 Recom. Rate (%) ATG 3.9.9.9 9.74 Candidate region (.74 Mb) n=4 TAA D idm-3 G3T(E4) G4A(W988) WT idm-3 ATC TCT GGG ACT CAT GAG CAG GAG GCT AGC
More informationStudent Learning Outcomes (SLOS)
Student Learning Outcomes (SLOS) KNOWLEDGE AND LEARNING SKILLS USE OF KNOWLEDGE AND LEARNING SKILLS - how to use Annhyb to save and manage sequences - how to use BLAST to compare sequences - how to get
More informationSupplemental Data. Benstein et al. (2013). Plant Cell /tpc
Supplemental Figure 1. Purification of the heterologously expressed PGDH1, PGDH2 and PGDH3 enzymes by Ni-NTA affinity chromatography. Protein extracts (2 µl) of different fractions (lane 1 = total extract,
More informationSupplementary Fig.1. Over-expression of RNase L in stable polyclonal cell line
Supplemental Data mrna Protein A kda 75 40 NEO/vector NEO/RNase L RNASE L β-actin RNASE L β-actin B % of control (neo vector), normalized 240 ** 200 160 120 80 40 0 Neo Neo/RNase L RNase L Protein Supplementary
More informationFile name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary Figure 1. dcas9-mq1 fusion protein induces de novo
More information6/256 1/256 0/256 1/256 2/256 7/256 10/256. At3g06290 (SAC3B)
Chr.III M 5M 1M 15M 2M 23M BAC clones F22F7 F1A16 F24F17 F24P17 T8E24 F17A9 F21O3 F17A17 F18C1 F2O1 F28L1 F5E6 F3E22 T1B9 MLP3 Number of recombinants 6/256 1/256 /256 1/256 2/256 7/256 1/256 At3g629 (SAC3B)
More informationSupplemental Figure 1 A
Supplemental Figure 1 A Supplemental Data. Han et al. (2016). Plant Cell 10.1105/tpc.15.00997 BamHI -1616 bp SINE repeats SalI ATG SacI +1653 bp HindIII LB HYG p35s pfwa LUC Tnos RB pfwa-bamhi-f: CGGGATCCCGCCTTTCTCTTCCTCATCTGC
More informationSupplemental Data. Sethi et al. (2014). Plant Cell /tpc
Supplemental Data Supplemental Figure 1. MYC2 Binds to the E-box but not the E1-box of the MPK6 Promoter. (A) E1-box and E-box (wild type) containing MPK6 promoter fragment. The region shown in red denotes
More informationSupplemental Data. Cui et al. (2012). Plant Cell /tpc a b c d. Stem UBC32 ACTIN
A Root Stem Leaf Flower Silique Senescence leaf B a b c d UBC32 ACTIN C * Supplemental Figure 1. Expression Pattern and Protein Sequence of UBC32 Homologues in Yeast, Human, and Arabidopsis. (A) Expression
More informationA Repressor Complex Governs the Integration of
Developmental Cell 15 Supplemental Data A Repressor Complex Governs the Integration of Flowering Signals in Arabidopsis Dan Li, Chang Liu, Lisha Shen, Yang Wu, Hongyan Chen, Masumi Robertson, Chris A.
More informationSupplemental Material Igreja and Izaurralde 1. CUP promotes deadenylation and inhibits decapping of mrna targets. Catia Igreja and Elisa Izaurralde
Supplemental Material Igreja and Izaurralde 1 CUP promotes deadenylation and inhibits decapping of mrna targets Catia Igreja and Elisa Izaurralde Supplemental Materials and methods Functional assays and
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature10928 Materials and Methods 1. Plant material and growth conditions. All plant lines used were in Col-0 background unless otherwise specified. pif4-101 mutant
More informationIDN1 and IDN2: two proteins required for de novo DNA methylation in Arabidopsis thaliana.
IDN1 and IDN2: two proteins required for de novo DNA methylation in Arabidopsis thaliana. Israel Ausin, Todd C. Mockler, Joanne Chory, and Steven E. Jacobsen Col Ler nrpd1a rdr2 dcl3-1 ago4-1 idn1-1 idn2-1
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationSupplemental materials
Supplemental materials Materials and methods for supplemental figures Yeast two-hybrid assays TAP46-PP2Ac interactions I. The TAP46 was used as the bait and the full-length cdnas of the five C subunits
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationSomatic Primary pirna Biogenesis Driven by cis-acting RNA Elements and Trans-Acting Yb
Cell Reports Supplemental Information Somatic Primary pirna Biogenesis Driven by cis-acting RNA Elements and Trans-Acting Yb Hirotsugu Ishizu, Yuka W. Iwasaki, Shigeki Hirakata, Haruka Ozaki, Wataru Iwasaki,
More informationSupplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
More informationSupplemental Figure 1
Supplemental Figure 1 A gta2-1 gta2-2 1kb AT4G08350 B Col-0 gta2-1 LP+RP+LBb1.3 C Col-0 gta2-2 LP+RP+LB1 D Col-0 gta2-2 gta2-1 GTA2 TUBLIN E Col0 gta2-1 gta2-2 Supplemental Figure 1. Phenotypic analysis
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationNature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Distribution of mirnas between lncrna and protein-coding genes. Pie chart showing distribution of human mirna between protein coding and lncrna genes. To the right, lncrna mirna
More informationSupplemental Data. Wu and Xue (2010). Plant Cell /tpc
Supplemental Data. Wu and Xue (21). Plant Cell 1.115/tpc.11.75564 A P1-S P1-A P2-S P2-A P3-S P3-A P4-S P4-A B Relative expression Relative expression C 5. 4.5 4. 3.5 3. 2.5 2. 1.5 1..5 5. 4.5 4. 3.5 3.
More informationpreviously. co and fca-9 alleles were isolated from the Col background. Plants were
Supporting Online Material Materials and Methods Plant Growth Conditions The flc-3, FRI Sf2 -Col (S1), fve-4 (S2), ld-1 (S3) and fpa (S4) lines were described previously. co and fca-9 alleles were isolated
More informationSchematic representation of the endogenous PALB2 locus and gene-disruption constructs
Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying
More informationSupplemental Data. Seo et al. (2014). Plant Cell /tpc
Supplemental Figure 1. Protein alignment of ABD1 from other model organisms. The alignment was performed with H. sapiens DCAF8, M. musculus DCAF8 and O. sativa Os10g0544500. The WD40 domains are underlined.
More informationSupplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) (b)
Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) A schematic overview of the production and amplification of a single pirna from a transposon transcript. The
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12119 SUPPLEMENTARY FIGURES AND LEGENDS pre-let-7a- 1 +14U pre-let-7a- 1 Ddx3x Dhx30 Dis3l2 Elavl1 Ggt5 Hnrnph 2 Osbpl5 Puf60 Rnpc3 Rpl7 Sf3b3 Sf3b4 Tia1 Triobp U2af1 U2af2 1 6 2 4 3
More informationReal Time PCR (qpcr) Dott. Finetti Luca
Real Time PCR (qpcr) Dott. Finetti Luca fntlcu1@unife.it PCR (Polymerase Chain Reaction) PCR (Polymerase Chain Reaction) Theoretically: 2 n PCR (Polymerase Chain Reaction) It often used as a qualitative
More informationBS 50 Genetics and Genomics Week of Oct 24
BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.
More informationReading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Fig. 1 shrna mediated knockdown of ZRSR2 in K562 and 293T cells. (a) ZRSR2 transcript levels in stably transduced K562 cells were determined using qrt-pcr. GAPDH was
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationGene Forward Primer Reverse Primer GAPDH ATCATCCCTGCCTCTACTGG GTCAGGTCCACCACTGACAC SSB1 AACTTCAGTGAGCCAAACCC GTTCTCAGAGGCTGGAGAGG
Supplemental Data EXPERIMENTAL PROCEDURES Plasmids and Antibodies- Full length cdna of INT11 or INT12 were cloned into ps- Flag-SBP vector respectively. Anti-RNA pol II (RPB1) was purchased from Santa
More informationPattern Formation via Small RNA Mobility SUPPLEMENTAL FIGURE 1 SUPPLEMENTAL INFORMATION. Daniel H. Chitwood et al.
SUPPLEMENTAL INFORMATION Pattern Formation via Small RNA Mobility Daniel H. Chitwood et al. SUPPLEMENTAL FIGURE 1 Supplemental Figure 1. The ARF3 promoter drives expression throughout leaves. (A, B) Expression
More informationIntron distance to transcription start (nt)*
Schwab et al. SOM: Enhanced microrna accumulation through stemloop-adjacent introns 1 Supplemental Table 1. Characteristics of introns used in this study Intron name Length intron (nt) Length cloned fragment
More informationEric J. Wagner, Brandon D. Burch, Ashley C. Godfrey, Harmony R. Salzler, Robert J. Duronio, and William F. Marzluff
Molecular Cell, Volume 28 Supplemental Data A Genome-Wide RNA Interference Screen Reveals that Variant Histones Are Necessary for Replication-Dependent Histone Pre-mRNA Processing Eric J. Wagner, Brandon
More informationSupplemental Data. Zhou et al. (2016). Plant Cell /tpc
Supplemental Figure 1. Confirmation of mutant mapping results. (A) Complementation assay with stably transformed genomic fragments (ComN-N) (2 kb upstream of TSS and 1.5 kb downstream of TES) and CaMV
More informationSupplemental Figure 1. Immunoblot analysis of wild-type and mutant forms of JAZ3
Supplemental Data. Chung and Howe (2009). A Critical Role for the TIFY Motif in Repression of Jasmonate Signaling by a Stabilized Splice Variant of the JASMONATE ZIM-domain protein JAZ10 in Arabidopsis.
More informationSupplemental Data. Wang et al. Plant Cell. (2013) /tpc
SNL1 SNL Supplemental Figure 1. The Expression Patterns of SNL1 and SNL in Different Tissues of Arabidopsis from Genevestigator Web Site (https://www.genevestigator.com/gv/index.jsp). 1 A 1. 1..8.6.4..
More informationNature Genetics: doi: /ng.3556 INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE. Supplementary Figure 1
INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE Supplementary Figure 1 REF6 expression in transgenic lines. (a,b) Expression of REF6 in REF6-HA ref6 and REF6ΔZnF-HA ref6 plants detected by RT qpcr (a) and immunoblot
More informationSupplemental Data. Noncoding Transcription by RNA Polymerase Pol IVb/Pol V Mediates Transcriptional Silencing of Overlapping and Adjacent Genes
Cell, Volume 135 Supplemental Data Noncoding Transcription by RNA Polymerase Pol IVb/Pol V Mediates Transcriptional Silencing of Overlapping and Adjacent Genes Andrzej T. Wierzbicki, Jeremy R. Haag, and
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID protein kinase N1 PKN1 Human The protein encoded by this gene belongs to the protein
More informationSupplemental Table S1. Experimental details of the qpcr analyses according to the checklist of the MIQE* guidelines.
Supplemental Table S1, page 1 Supplemental Table S1. Experimental details of the qpcr analyses according to the checklist of the MIQE* guidelines. ITEM TO ERXPERIMENTAL DESIGN Definition of experimental
More informationMethods for Working with DNA and RNA
Methods for Working with DNA and RNA 1. Gel electrophoresis A. Materials: agarose (large DNAs) vs. acrylamide (high resolution, DNA sequencing) B. Separated by its sieving property and charge: both are
More informationErhard et al. (2013). Plant Cell /tpc
Supplemental Figure 1. c1-hbr allele structure. Diagram of the c1-hbr allele found in stocks segregating 1:1 for rpd1-1 and rpd1-2 homozygous mutants showing the presence of a 363 base pair (bp) Heartbreaker
More informationSuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes
WHITE PAPER SuperScript IV Reverse Transcriptase SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes Abstract Reverse transcriptases (RTs) from avian myeloblastosis virus
More informationSUPPLEMENTARY MATERIAL AND METHODS
SUPPLEMENTARY MATERIAL AND METHODS Amplification of HEV ORF1, ORF2 and ORF3 genome regions Total RNA was extracted from 200 µl EDTA plasma using Cobas AmpliPrep total nucleic acid isolation kit (Roche,
More informationPercent survival. Supplementary fig. S3 A.
Supplementary fig. S3 A. B. 100 Percent survival 80 60 40 20 Ml 0 0 100 C. Fig. S3 Comparison of leukaemia incidence rate in the triple targeted chimaeric mice and germline-transmission translocator mice
More informationMeCP2. MeCP2/α-tubulin. GFP mir1-1 mir132
Conservation Figure S1. Schematic showing 3 UTR (top; thick black line), mir132 MRE (arrow) and nucleotide sequence conservation (vertical black lines; http://genome.ucsc.edu). a GFP mir1-1 mir132 b GFP
More informationPrimePCR Assay Validation Report
Gene Information Gene Name minichromosome maintenance complex component 8 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID MCM8 Human The protein encoded by
More informationFigure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA.
Summary of Supplemental Information Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA. Figure S2: rrna removal procedure is effective for clearing out
More informationSUPPLEMENTARY INFORMATION
Ca 2+ /calmodulin Regulates Salicylic Acid-mediated Plant Immunity Liqun Du, Gul S. Ali, Kayla A. Simons, Jingguo Hou, Tianbao Yang, A.S.N. Reddy and B. W. Poovaiah * *To whom correspondence should be
More informationSUPPLEMENTARY INFORMATION
Gene replacements and insertions in rice by intron targeting using CRISPR Cas9 Table of Contents Supplementary Figure 1. sgrna-induced targeted mutations in the OsEPSPS gene in rice protoplasts. Supplementary
More informationSupplementary Information
Supplementary Information MicroRNA-212/132 family is required for epithelial stromal interactions necessary for mouse mammary gland development Ahmet Ucar, Vida Vafaizadeh, Hubertus Jarry, Jan Fiedler,
More information(phosphatase tensin) domain is shown in dark gray, the FH1 domain in black, and the
Supplemental Figure 1. Predicted Domain Organization of the AFH14 Protein. (A) Schematic representation of the predicted domain organization of AFH14. The PTEN (phosphatase tensin) domain is shown in dark
More informationSUPPLEMENTAL DATA. Supplementary data
1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 SUPPLEMENTAL DATA Supplementary data Figure S1: Verification of pla-iα1 knockdown lines a: Semiquantitative
More informationSupplementary Methods
Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed
More informationExecutive Summary. clinical supply services
clinical supply services case study Development and NDA-level validation of quantitative polymerase chain reaction (qpcr) procedure for detection and quantification of residual E.coli genomic DNA Executive
More informationSupplementary Information
Supplementary Information MED18 interaction with distinct transcription factors regulates plant immunity, flowering time and responses to hormones Supplementary Figure 1. Diagram showing T-DNA insertion
More informationXXII DNA cloning and sequencing. Outline
XXII DNA cloning and sequencing 1) Deriving DNA for cloning Outline 2) Vectors; forming recombinant DNA; cloning DNA; and screening for clones containing recombinant DNA [replica plating and autoradiography;
More informationSupplementary Figure S1. The tetracycline-inducible CRISPR system. A) Hela cells stably
Supplementary Information Supplementary Figure S1. The tetracycline-inducible CRISPR system. A) Hela cells stably expressing shrna sequences against TRF2 were examined by western blotting. shcon, shrna
More informationSupplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity.
Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity. (A) Amino acid alignment of HDA5, HDA15 and HDA18. The blue line
More informationAD BD TOC1. Supplementary Figure 1: Yeast two-hybrid assays showing the interaction between
AD X BD TOC1 AD BD X PIFΔAD PIF TOC1 TOC1 PIFΔAD PIF N TOC1 TOC1 C1 PIFΔAD PIF C1 TOC1 TOC1 C PIFΔAD PIF C TOC1 Supplementary Figure 1: Yeast two-hybrid assays showing the interaction between PIF and TOC1
More informationCombining Techniques to Answer Molecular Questions
Combining Techniques to Answer Molecular Questions UNIT FM02 How to cite this article: Curr. Protoc. Essential Lab. Tech. 9:FM02.1-FM02.5. doi: 10.1002/9780470089941.etfm02s9 INTRODUCTION This manual is
More informationSupplemental Data. Jing et al. (2013). Plant Cell /tpc
Supplemental Figure 1. Characterization of epp1 Mutants. (A) Cotyledon angles of 5-d-old Col wild-type (gray bars) and epp1-1 (black bars) seedlings under red (R), far-red (FR) and blue (BL) light conditions,
More informationContents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
More informationSupplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell
Supplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell Supplementary Figures S1-S3 Supplementary Methods Supplementary Figure S1. Identification
More informationSupplemental Data. Li et al. (2015). Plant Cell /tpc
Supplemental Data Supplemental Figure 1: Characterization of asr3 T-DNA knockout lines and complementation transgenic lines. (A) The scheme of At2G33550 (ASR3) with gray boxes indicating exons and dash
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID protein phosphatase, Mg2+/Mn2+ dependent, 1A PPM1A Human The protein encoded by
More informationFig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination
More informationMIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.
MIT Department of Biology 7.01: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel iv) Would Xba I be useful for cloning? Why or why not?
More informationFig. S1. Clustering analysis of expression array and ChIP-PCR assay in the ARF3 locus. (A) Typical examples of the transgenic plants used for
Fig. S1. Clustering analysis of expression array and ChIP-PCR assay in the ARF3 locus. (A) Typical examples of the transgenic plants used for ChIP-chip and ChIP-PCR assays. The presence of pas1:t7:as1
More informationTRANSGENIC ANIMALS. -transient transfection of cells -stable transfection of cells. - Two methods to produce transgenic animals:
TRANSGENIC ANIMALS -transient transfection of cells -stable transfection of cells - Two methods to produce transgenic animals: 1- DNA microinjection - random insertion 2- embryonic stem cell-mediated gene
More informationDesign. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
More informationSupplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted
More informationBefore starting, write your name on the top of each page Make sure you have all pages
Biology 105: Introduction to Genetics Name Student ID Before starting, write your name on the top of each page Make sure you have all pages You can use the back-side of the pages for scratch, but we will
More informationBiol 321 Spring 2013 Quiz 4 25 pts NAME
Biol 321 Spring 2013 Quiz 4 25 pts NAME 1. (3 pts.) a. What is the name of this compound? BE EXPLICIT deoxyribose 5 b. Number the carbons on this structure: 4 1 3 2 2. (4 pts.) Circle True or False. If
More informationBootcamp: Molecular Biology Techniques and Interpretation
Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing
More informationSupplementary Information
Supplementary Information Super-resolution imaging of fluorescently labeled, endogenous RNA Polymerase II in living cells with CRISPR/Cas9-mediated gene editing Won-Ki Cho 1, Namrata Jayanth 1, Susan Mullen
More informationBIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationPIE1 ARP6 SWC6 KU70 ARP6 PIE1. HSA SNF2_N HELICc SANT. pie1-3 A1,A2 K1,K2 K1,K3 K3,LB2 A3, A4 A3,LB1 A1,A2 K1,K2 K1,K3. swc6-1 A3,A4.
A B N-terminal SWC2 H2A.Z SWC6 ARP6 PIE1 HSA SNF2_N HELICc SANT C pie1-3 D PIE1 ARP6 5 Kb A1 200 bp A3 A2 LB1 arp6-3 A4 E A1,A2 A3, A4 A3,LB1 K1,K2 K1,K3 K3,LB2 SWC6 swc6-1 A1,A2 A3,A4 K1,K2 K1,K3 100
More informationHypomorphic Alleles Reveal FCA-Independent Roles for FY in the Regulation of FLOWERING LOCUS C 1[C][W][OA]
Hypomorphic Alleles Reveal FCA-Independent Roles for FY in the Regulation of FLOWERING LOCUS C 1[C][W][OA] Wei Feng, Yannick Jacob 2, Kira M. Veley 3, Lei Ding, Xuhong Yu, Goh Choe 4, and Scott D. Michaels*
More informationGenomic DNA fragments identified by ChIP-chip assay for MR [28] corresponding to two
Supplemental Materials and Methods Genomic DNA fragments identified by ChIP-chip assay for MR [28] corresponding to two upstream regions of the human Klf9 gene (-5139 to -5771 bp and -3875 to -4211 bp)
More informationAs a control to demonstrate that we could isolate PCR products that result from ligating
SUPPLEMENTAL INFORMATION (Mullen and Marzluff) RESULTS Oligo(dA) Clones and Oligo(dT) RT-PCR controls. As a control to demonstrate that we could isolate PCR products that result from ligating the authentic
More informationGENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.
!! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,
More informationApplied Bioinformatics - Lecture 16: Transcriptomics
Applied Bioinformatics - Lecture 16: Transcriptomics David Hendrix Oregon State University Feb 15th 2016 Transcriptomics High-throughput Sequencing (deep sequencing) High-throughput sequencing (also
More informationSupplemental Data. Meng et al. (2011). Plant Cell /tpc B73 CML311 CML436. Gaspé Flint
Gaspé Flint B73 CML311 CML436 A B C D 10 th leaf 10 th leaf 10 th leaf Supplemental Figure 1. Whole plant images of the four varieties used in this study (A) Extreme early flowering temperate line Gaspé
More informationprimer sense. - 3 primer antisense 5 - TAC AAG TAC TCA GAT CTC GAG CTC AAG CTT CGA ATT CNN NNN NNN NNN ATG NNN
Activity that you must complete by Sunday November 11 th at 12 EGFP TAC AAG TAC TCA GAT CTC GAG CTC AAG CTT CGA ATT CTG CAG TCG 5-5 - restriction enzyme S restriction enzyme A restriction enzyme S restriction
More information