Classes of eukaryotic cellular RNAs
|
|
|
- Allan Johns
- 6 years ago
- Views:
Transcription
1
2
3 Classes of eukaryotic cellular RNAs ribosomal RNA (rrna) 18S (small subunit) 28S (large subunit) 5.8S (large subunit) 5S (large subunit) transfer RNA (trna) messenger RNA (mrna) heterogeneous nuclear RNA (hnrna) (precursors of mrna) small nuclear RNA (snrna) U1, U2, U3, U4, U5, U6, U7, U8, U9, U10... small cytoplasmic RNA (scrna) 7SL RNA What are the enzymes responsible for the synthesis of these RNAs?
4 The human RNA polymerases Polymerase Location Product RNA polymerase I nucleolus 18S, 28S, 5.8S rrna RNA polymerase II nucleoplasm RNA polymerase III nucleoplasm mitochondrial RNA polymerase mitochondrion hnrna/mrna, U1, U2, U4, U5 snrna trna, 5S RNA, U6 snrna, 7SL RNA all mitochondrial RNA
5 Unione di ribonucleotidi monofosfato per formare una catena polinucleotidica I precursori della sintesi sono i nucleotidi trifosfato. L energia che occorre per la formazione del legame fosfodiesterico è data dall eliminazione del pirofosfato per idrolisi del legame.
6 Legame al promotore della RNA polimerasi Apertura della doppia elica Inizio della sintesi Allungamento Terminazione
7 Direzione della sintesi Filamento senso Filamento antisenso
8 closed promoter complex Transcription RNA polymerase open promoter complex initiation elongation termination RNA product
9
10 Proteins regulating eukaryotic mrna synthesis General transcription factors TFIID (a multisubunit protein) binds to the TATA box to begin the assembly of the transcription apparatus the TATA binding protein (TBP) directly binds the TATA box TBP associated factors (TAFs) bind to TBP TFIIA, TFIIB, TFIIE, TFIIF, TFIIH 1, TFIIJ assemble with TFIID RNA polymerase II binds the promoter region via the TFII s Transcription factors binding to other promoter elements and transcription elements interact with proteins at the promoter and further stabilize (or inhibit) formation of a functional preinitiation complex 1 TFIIH is also involved in phosphorylation of RNA polymerase II, DNA repair (Cockayne syndrome mutations), and cell cycle regulation
11 Binding of the general transcription factors E F TAFs B TFIID H A TBP J TFIID (a multisubunit protein) binds to the TATA box to begin the assembly of the transcription apparatus the TATA binding protein (TBP) directly binds the TATA box TBP associated factors (TAFs) bind to TBP TFIIA, TFIIB, TFIIE, TFIIF, TFIIH, TFIIJ assemble with TFIID
12 Binding of RNA polymerase II E F B TFIID H A TBP J RNA pol II RNA polymerase II (a multisubunit protein) binds to the promoter region by interacting with the TFII s TFs recruit histone acetylase to the promoter
13 Steps in mrna processing (hnrna is the precursor of mrna) capping (occurs co-transcriptionally) cleavage and polyadenylation (forms the 3 end) splicing (occurs in the nucleus prior to transport) exon 1 intron 1 exon 2 cap Transcription of pre-mrna and capping at the 5 end Cleavage of the 3 end and polyadenylation cap cap poly(a) Splicing to remove intron sequences cap poly(a) Transport of mature mrna to the cytoplasm
14 Splicing Rimozione di un introne attraverso due reazioni sequenziali di trasferimento di fosfato, note come transesterificazioni. Queste uniscono due esoni rimuovendo l introne come un cappio
15
16
17 b). Gene structure promoter region exons (filled and unfilled boxed regions) +1 introns (between exons) transcribed region mrna structure 5 3 translated region
18
19 Structure of eukaryotic mrna 5 Cap 7mGppp 5 untranslated region initiation AUG translated region 3 untranslated region UGA termination polyadenylation signal AAUAAA (A) ~200 poly(a) tail all mrnas have a 5 cap and all mrnas (with the exception of the histone mrnas) contain a poly(a) tail the 5 cap and 3 poly(a) tail prevent mrna degradation loss of the cap and poly(a) tail results in mrna degradation 3
20
21 Polyadenylation cleavage of the primary transcript occurs approximately nucleotides 3 -ward of the AAUAAA consensus site polyadenylation catalyzed by poly(a) polymerase approximately 200 adenylate residues are added cleavage AAUAAA mgpppnmpnm mgpppnmpnm AAUAAA A A A polyadenylation A A A 3 poly(a) is associated with poly(a) binding protein (PBP) function of poly(a) tail is to stabilize mrna
22
23
24
25
26 Enhancers Nei geni degli eucarioti gli enhancers possono distare dalla regione codificante anche più di 50 Kb.
27
28
RNA. Ribonucleotidi monofosfato uniti a. formare una catena polinucleotidica
RNA Ribonucleotidi monofosfato uniti a formare una catena polinucleotidica Formazione del legame fosfodiesterico I precursori della sintesi sono i ribonucleotidi trifosfato. L energia che occorre per la
Il differenziamento cellulare dipende da meccanismi di regolazione dell espressione genica
Il differenziamento cellulare dipende da meccanismi di regolazione dell espressione genica RNA Ribonucleotidi monofosfato uniti a formare una catena polinucleotidica I precursori della sintesi sono
Il differenziamento cellulare dipende da meccanismi di regolazione
Il differenziamento cellulare dipende da meccanismi di regolazione dell espressione genica Trascrizione sintesi di tutti gli RNA cellulari RNA Ribonucleotidi monofosfato uniti a formare una catena polinucleotidica
Trascrizione sintesi di tutti gli RNA cellulari
Trascrizione sintesi di tutti gli RNA cellulari RNA Ribonucleotidi monofosfato uniti a formare una catena polinucleotidica Formazione del legame fosfodiesterico I precursori della sintesi sono i ribonucleotidi
Transcription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
TRANSCRIPTION AND PROCESSING OF RNA
TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural
30 Gene expression: Transcription
30 Gene expression: Transcription Gene structure. o Exons coding region of DNA. o Introns non-coding region of DNA. o Introns are interspersed between exons of a single gene. o Promoter region helps enzymes
Transcription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
TRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long
Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double
SIBC504: TRANSCRIPTION & RNA PROCESSING Assistant Professor Dr. Chatchawan Srisawat
SIBC504: TRANSCRIPTION & RNA PROCESSING Assistant Professor Dr. Chatchawan Srisawat TRANSCRIPTION: AN OVERVIEW Transcription: the synthesis of a single-stranded RNA from a doublestranded DNA template.
Lecture 11. Initiation of RNA Pol II transcription. Transcription Initiation Complex
Lecture 11 *Eukaryotic Transcription Gene Organization RNA Processing 5 cap 3 polyadenylation splicing Translation Initiation of RNA Pol II transcription Consensus sequence of promoter TATA Transcription
Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code
Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)
Computational Biology I LSM5191 (2003/4)
Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression I Flow of information: DNA to polypeptide DNA Start Exon1 Intron Exon2 Termination
Chapter 3. DNA, RNA, and Protein Synthesis
Chapter 3. DNA, RNA, and Protein Synthesis 4. Transcription Gene Expression Regulatory region (promoter) 5 flanking region Upstream region Coding region 3 flanking region Downstream region Transcription
GENETICS - CLUTCH CH.10 TRANSCRIPTION.
!! www.clutchprep.com CONCEPT: OVERVIEW OF TRANSCRIPTION Transcription is the process of using DNA as a template to RNA RNA polymerase is the enzyme that transcribes DNA - There are many different types
Eukaryotic & Prokaryotic Transcription. RNA polymerases
Eukaryotic & Prokaryotic Transcription RNA polymerases RNA Polymerases A. E. coli RNA polymerase 1. core enzyme = ββ'(α)2 has catalytic activity but cannot recognize start site of transcription ~500,000
Gene Expression: Transcription, Translation, RNAs and the Genetic Code
Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a
Biochemistry Eukaryotic Transcription
1 Description of Module Subject Name Paper Name Module Name/Title Dr. Vijaya Khader Dr. MC Varadaraj 2 1. Objectives 1. Understand and have an overview of eucaryotic transcriptional regulation. 2. Explain
CLASS 3.5: 03/29/07 EUKARYOTIC TRANSCRIPTION I: PROMOTERS AND ENHANCERS
CLASS 3.5: 03/29/07 EUKARYOTIC TRANSCRIPTION I: PROMOTERS AND ENHANCERS A. Promoters and Polymerases (RNA pols): 1. General characteristics - Initiation of transcription requires a. Transcription factors
DNA Transcription. Dr Aliwaini
DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger
Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points?
BCH 401G Lecture 37 Andres Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? RNA processing: Capping, polyadenylation, splicing. Why process mammalian
Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded
Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by
Chapter 17. From Gene to Protein
Chapter 17 From Gene to Protein One Gene One Enzyme Hypothesis Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria Beadle
FROM GENE TO PROTEIN. One Gene One Enzyme Hypothesis 3/12/2013. Basic Principles of Transcription & Translation
One Gene One Enzyme Hypothesis FROM GENE TO PROTEIN C H A P T E R 1 7 Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria
BS 50 Genetics and Genomics Week of Oct 24
BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.
Analyzed Fungi Neurospora crassa mutants. Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated:
From Gene to Protein Beadle and Tatum Analyzed Fungi Neurospora crassa mutants Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated: Precursor Ornithine
Fermentation. Lesson Overview. Lesson Overview 13.1 RNA
13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to
Fig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
CH 17 :From Gene to Protein
CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there
Transcription is the first stage of gene expression
Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the
BIO 311C Spring Lecture 36 Wednesday 28 Apr.
BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through
Videos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
Transcription and Post Transcript Modification
Transcription and Post Transcript Modification You Should Be Able To 1. Describe transcription. 2. Compare and contrast eukaryotic + prokaryotic transcription. 3. Explain mrna processing in eukaryotes.
Transcription. By : Lucia Dhiantika Witasari M.Biotech., Apt
Transcription By : Lucia Dhiantika Witasari M.Biotech., Apt REGULATION OF GENE EXPRESSION 11/26/2010 2 RNA Messenger RNAs (mrnas) encode the amino acid sequence of one or more polypeptides specified by
Transcription. DNA to RNA
Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy
DNA Prokaryote Transcription Steps (updated February 2013)
URS AACTGT ATATTA - 35-10 transcription Pribnow Box discriminator +1 AGGAGGT TTA TCCTCCA ATT Gene C TGA TAG ACT ATC rho or GC hairpin loop transcription termination DNA Prokaryote Transcription Steps (updated
Make the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
There are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal.
1 2 Continuous genes - Intron: Many eukaryotic genes contain coding regions called exons and noncoding regions called intervening sequences or introns. The average human gene contains from eight to nine
DNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses.
Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Genetic information is encoded as a sequence of nucleotides (guanine,
Videos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
Chapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
The Structure of RNA. The Central Dogma
12-3 12-3 RNA and Protein Synthesis The Structure of RNA The Central Dogma Phenotype A gene is a SEQUENCE of DNA that codes for a protein (or functional RNA). Phenotype is the individual s observable trait
Eukaryotic Gene Expression John O. Thomas
Eukaryotic Gene Expression John O. Thomas I) RNA polymerases A) There are four RNA polymerases in human cells. 1) RNA polymerase I, located in the nucleolar region of the nucleus, is responsible for the
The Flow of Genetic Information
Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins
Differential Gene Expression
Biology 4361 Developmental Biology Differential Gene Expression June 19, 2008 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:
Initiation and termination of transcription, Post transcription modification of the RNA. Mitesh Shrestha
Initiation and termination of transcription, Post transcription modification of the RNA Mitesh Shrestha Transcription: overview In prokaryotes transcription and translation are coupled. Proteins are synthesized
RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013
RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein
A. Incorrect! This feature does help with it suitability as genetic material.
College Biology - Problem Drill 08: Gene Structures and Functions No. 1 of 10 1. Which of the statements below is NOT true in explaining why DNA is a suitable genetic material? #01 (A) Its double helix
Mechanisms of Transcription. School of Life Science Shandong University
Mechanisms of Transcription School of Life Science Shandong University Ch 12: Mechanisms of Transcription 1. RNA polymerase and the transcription cycle 2. The transcription cycle in bacteria 3. Transcription
Differential Gene Expression
Developmental Biology Biology 4361 Differential Gene Expression October 13, 2005 core transcription initiation site 5 promoter 3 TATAT +1 upstream downstream Basal transcription factors (eukaryotes) TFIID
The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot
The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino
Genes and How They Work. Chapter 15
Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central
BEADLE & TATUM EXPERIMENT
FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in
DNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
Lesson Overview. Fermentation 13.1 RNA
13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA
CLEP Biology - Problem Drill 11: Transcription, Translation and The Genetic Code
CLEP Biology - Problem Drill 11: Transcription, Translation and The Genetic Code No. 1 of 10 1. Three types of RNA comprise the structural and functional core for protein synthesis, serving as a template
I. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
Chapter 11. Transcription. The biochemistry and molecular biology department of CMU
Chapter 11 Transcription The biochemistry and molecular biology department of CMU Transcription The synthesis of RNA molecules using DNA strands as the templates so that the genetic information can be
Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.
Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally
6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA
6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA DNA mrna Protein DNA is found in the nucleus, but making a protein occurs at the ribosome
RNA : functional role
RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying
7.2 Protein Synthesis. From DNA to Protein Animation
7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They
Key Area 1.3: Gene Expression
Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?
Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.
Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)
DNA Replication and Repair
DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands
Lecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
Regulation of bacterial gene expression
Regulation of bacterial gene expression Gene Expression Gene Expression: RNA and protein synthesis DNA ----------> RNA ----------> Protein transcription translation! DNA replication only occurs in cells
Wednesday, November 22, 17. Exons and Introns
Exons and Introns Introns and Exons Exons: coded regions of DNA that get transcribed and translated into proteins make up 5% of the genome Introns and Exons Introns: non-coded regions of DNA Must be removed
Molecular Biology (BIOL 4320) Exam #1 March 12, 2002
Molecular Biology (BIOL 4320) Exam #1 March 12, 2002 Name KEY SS# This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses after the question number.
Chapter 3 Gene Function. Transcription Prokaroyotes Eukaryotes Transcript processing Proteins Translation Genetic nomenclature
Chapter 3 Gene Function Transcription Prokaroyotes Eukaryotes Transcript processing Proteins Translation Genetic nomenclature Transcription RNA composition ATP, GTP, UTP, CTP are substrates for RNA polymerase.
Review of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
B. Incorrect! Centromeric DNA is largely heterochromatin, which is inactive DNA.
MCAT Biology - Problem Drill 06: Molecular Biology of Eukaryotes Question No. 1 of 10 1. Which type of DNA would have the highest level of expression? Question #01 (A) Heterochromatin. (B) Centromeric
DNA Evolution of knowledge about gene. Contains information about RNAs and proteins. Polynucleotide chains; Double stranded molecule;
Evolution of knowledge about gene G. Mendel Hereditary factors W.Johannsen, 1909 G.W.Beadle, E.L.Tatum, 1945 Ingram, 1957 Actual concepts The gene hereditary unit located in chromosomes Hypotheses One
Eukaryotic Transcription
Eukaryotic Transcription I. Differences between eukaryotic versus prokaryotic transcription. II. (core vs holoenzyme): RNA polymerase II - Promotor elements. - General Pol II transcription factors (GTF).
GRU5 LECTURE POST-TRANSCRIPTIONAL MODIFICATION AND TRANSCRIPTION
GRU5 LECTURE POST-TRANSCRIPTIONAL MODIFICATION AND TRANSCRIPTION Do Now 1. What was the DNA template for this mrna: 5 -A-A-C-G-U-3? (Write it 5 to 3 ) 2. State the Central Dogma of biology. 3. Name 3 differences
DNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks.
DNA REPLICATION 5 4 Phosphate 3 DNA structure Nitrogenous base 1 Deoxyribose 2 Nucleotide DNA strand = DNA polynucleotide 2004 Biology Olympiad Preparation Program 2 2004 Biology Olympiad Preparation Program
Chapter 14: From DNA to Protein
Chapter 14: From DNA to Protein Steps from DNA to Proteins Same two steps produce all proteins: 1) DNA is transcribed to form RNA Occurs in the nucleus RNA moves into cytoplasm 2) RNA is translated in
Chapter 2. An Introduction to Genes and Genomes
PowerPoint Lectures for Introduction to Biotechnology, Second Edition William J.Thieman and Michael A.Palladino Chapter 2 An Introduction to Genes and Genomes Lectures by Lara Dowland Chapter Contents
M1 - Biochemistry. Nucleic Acid Structure II/Transcription I
M1 - Biochemistry Nucleic Acid Structure II/Transcription I PH Ratz, PhD (Resources: Lehninger et al., 5th ed., Chapters 8, 24 & 26) 1 Nucleic Acid Structure II/Transcription I Learning Objectives: 1.
Protein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
Transcription steps. Transcription steps. Eukaryote RNA processing
Transcription steps Initiation at 5 end of gene binding of RNA polymerase to promoter unwinding of DNA Elongation addition of nucleotides to 3 end rules of base pairing requires Mg 2+ energy from NTP substrates
We can now identify three major pathways of information flow in the cell (in replication, information passes from one DNA molecule to other DNA
1 We can now identify three major pathways of information flow in the cell (in replication, information passes from one DNA molecule to other DNA molecules; in transcription, information passes from DNA
Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
Transcription & RNA Processing
Chapter 10. Transcription & RNA Processing 1. Transfer of Genetic Information: the Central Dogma 2. The Process of Gene Expression 3. Transcription & RNA Processing in Eukaryotes 4. Interrupted Genes in
CHapter 14. From DNA to Protein
CHapter 14 From DNA to Protein How? DNA to RNA to Protein to Trait Types of RNA 1. Messenger RNA: carries protein code or transcript 2. Ribosomal RNA: part of ribosomes 3. Transfer RNA: delivers amino
From RNA To Protein
From RNA To Protein 22-11-2016 Introduction mrna Processing heterogeneous nuclear RNA (hnrna) RNA that comprises transcripts of nuclear genes made by RNA polymerase II; it has a wide size distribution
Lesson 8. DNA: The Molecule of Heredity. Gene Expression and Regulation. Introduction to Life Processes - SCI 102 1
Lesson 8 DNA: The Molecule of Heredity Gene Expression and Regulation Introduction to Life Processes - SCI 102 1 Genes and DNA Hereditary information is found in discrete units called genes Genes are segments
From Gene to Protein. Chapter 17
From Gene to Protein Chapter 17 What you need to know: The key terms: gene expression, transcription, and translation. The major events of transcription. How eukaryotic cells modify RNA after transcription.
Chapter 12: Molecular Biology of the Gene
Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,
3'A C G A C C A G T A A A 5'
AP Biology Chapter 14 Reading Guide Gene Expression: From Gene to Protein Overview 1. What is gene expression? Concept 14.1 Genes specify proteins via transcription and translation Basic Principles of
Gene Expression: Transcription
Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make
Bis2A 12.2 Eukaryotic Transcription
OpenStax-CNX module: m56061 1 Bis2A 12.2 Eukaryotic Transcription Mitch Singer Based on Eukaryotic Transcription by OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative
8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
DNA is the MASTER PLAN. RNA is the BLUEPRINT of the Master Plan
Sec. 12-3 RNA and Protein Synthesis Roles of DNA and RNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 1 RNA uses the information from DNA to make proteins Differs from DNA: 1. Ribose
Gene function at the level of traits Gene function at the molecular level
Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines
Chapter 17. From Gene to Protein
Chapter 17 From Gene to Protein Overview: The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific
DIFFERENT ASPECTS OF GENE REGULATION
TARTU UNIVERSITY FACULTY OF BILOGY AND GEOGRAPHY DIFFERENT ASPECTS OF GENE REGULATION TARTU 2005 Sten Ilmjärv 2 TABLE OF CONTENT TABLE OF CONTENT...2 GLOSSARY...3 INTRODUCTION...4 1. THE GENE...5 2. GENE