Identification of the major bacterial groups in the digestive tract of cod and haddock
|
|
- Nathan Townsend
- 6 years ago
- Views:
Transcription
1 Identification of the major bacterial groups in the digestive tract of cod and haddock Neil McEwan Institute of Biological, Environmental and Rural Sciences, Llanbadarn Campus, Aberystwyth University, Aberystwyth, Ceredigion, SY23 3AL, Wales Jim Treasurer Vikingfish, Ardtoe Marine Laboratory, Ardtoe, Acharacle, Ardnamurhcan, Argyll, PH38 4LZ Scotland Summary The bacterial diversity contained within samples collected from the stomach of both haddock and cod was examined. In both cases, examples of microbes identified in the digestive tract of other vertebrates were observed. However, the majority of sequences identified were most similar to sequences which had previously been found in environmental samples (e.g. soil samples). This is suggests that the bacterial community within the stomach of these fish is directly influenced by microbes being swallowed. This is different from the observations which have been reported for mammalian gut environments, where the food ingested (as opposed to the bacteria themselves) influence the bacterial population. This point is re-iterated by the relative abundance of sequences which were found which had high similarity to chloroplasts, which previously have constituted a minor level of contamination in other gut systems studied, suggestive of there not being a particularly strongly established bacterial population within the stomach of these fish.
2 Identification of the major bacterial groups in the digestive tract of cod and haddock Neil McEwan (Aberystwyth University, Aberystwyth, Wales) Jim Treasurer (Vikingfish, Ardtoe, Scotland) General background to the work undertaken Food is ingested into the digestive tract of all vertebrates. Research in both mammals and birds has shown that the process of breaking down the food to the basic constituents needed by the host animal generally cannot be achieved by the enzymes encoded by the vertebrate itself. Instead it is clear that, to varying degrees, the microbes of the gut play a role in maximising the breakdown of food sources, thereby making nutrients available to the host animal. Given the importance attached to recognising the microbes in the digestive tract of both mammals and birds, the current work was undertaken to initiate a similar level of understanding for the bacterial composition of the digestive tract of two economically important marine fish. In the first instance, it was proposed that examples of some of the more abundant groups of organisms present in the digestive tract be identified for both haddock and cod. Methodology Five haddock (90-110g) and five cod (50-90g) which were around 8 months old and had routinely been fed a diet of 3 mm size Biomar Biomarine were used in the experiment. They had been maintained in seawater tanks at Vikingfish and following killing were transported on ice to Aberystwyth for analysis. The intestine and stomach from each fish was removed and the digesta extracted immediately. DNA was extracted from all samples using a stool kit (Qiagen) which has previously proved a successful resource for harvesting DNA from a number of sources (e.g. rumen contents, horse faecal samples, rabbit caecal samples). The quality of DNA extracted was verified by two different techniques; spectrophometric analysis to assess purity levels (i.e. check that contamination from protein sources was low) and also by electrophoresis to check for size integrity of the extracted DNA (i.e. check that the DNA has not become fragmented during the extraction process). All samples showed DNA which appeared to have high purity, and also was relatively intact (i.e. 23kb or greater on an agarose gel).
3 DNA samples from each source type (e.g. haddock intestine, cod stomach, etc) were pooled for molecular biological analysis. Regions of the bacterial 16S ribosomal genes from total DNA extracts were amplified by PCR, using primers previously shown to amplify sequences from other gut environments, and other ecosystems such as soil. The PCR step was designed to produce an amplicons of around 900 nucleotides in length, which is generally accepted as being sufficiently long to permit taxonomic and/or phylogenetical analysis to take place. Analysis of the amplicons generated following PCR by electrophoresis showed that samples from the stomach of both cod and haddock produced strong signals of the predicted size. In contrast, the results from intestinal samples were less successful, with weak product samples being obtained from the haddock material, and those from cod failing to produce an amplicon. Despite repeating the PCR process, neither intestinal sample gave a better product and so a decision was made to concentrate on the stomach samples in order that comparisons between samples from both species would be possible. PCR products from stomach samples from both species were cloned into a pcr 4- TOPO vector (Invitrogen) in preparation for cloning in E. coli strain (MACH 1 TM T 1 R ). Resulting colonies were subjected to a preliminary screen for inserts, based on blue/white colouration. All colonies which remained white after a brief incubation at 4 C were selected as candidate clones for sequencing. Sequencing was performed in both directions using the M13 Forward and M13 Reverse primers recommended for use with this cloning vector. Resulting DNA sequences were then compared by BLAST (Basic Local Alignment Search Tool) using the NCBI / GenBank database. For each sample, the organism with the highest identity level for the sequence being investigated was noted, together with the type of environment in which this organism was first identified. These results are reported in Table 1. General observations arising from experimental work Previously we have found that the pcr 4-TOPO vector in conjunction with E. coli strain (MACH 1 TM T 1 R ) has proved a highly reliable method of cloning PCR products in preparation for DNA sequencing. However, in the current investigation, numbers of
4 colonies were considerably less than those we have normally found. Typically less than 10 colonies of cloned cells were identified on any particular agar plate, which is in sharp contrast to the number of colonies which we would normally anticipate (i.e ). This resulted in multiple attempts at generating sufficient clones, in each case resulting in considerably lower numbers of clones than would normally be expected. All clones which remained white after a brief incubation at 4 C were selected for sequencing. Normally at this point a very small number (typically only 1-2%) of the PCR products which have been cloned are identified as having come from chloroplasts. This is due to the fact that chloroplasts also have 16S ribosomal genes, and some of the chloroplast DNA present in the plant material used as a food source for the animals we are working with has been amplified. In the current work, around half of the sequences being analysed had to be removed from the study as they were clearly of chloroplast origin. The reason for this abnormally high number of chloroplast sequences being obtained is unclear. Most probably, it is either due to the DNA in the stomach bacteria being particularly well-suited to amplification by this specific pair of primers, or alternatively the number of bacteria in the stomach is relatively low in comparison to that seen in other gut systems with which we have worked. Either of these explanations is feasible, and the two are not mutually exclusive, with a combination of the two being possible. Although the primers used for PCR in this investigation have been used with considerable success for gut samples from other sources, it is well-known that some primer pairs just appear to be unsuited for specific types of work. Troubleshooting of primer optimisation has the potential to be a lengthy process, and was unlikely to be realistically achievable within the timescale allocated to this work.
5 Results of sequence analysis Analysis of the sequences obtained is shown in Table 1 below. Source Most similar species GenBank Number Type of bacterial group Identity (%) Source of best identity / comments Haddock Microbacterium hominis AM Actinobacteria 98 lung aspirate Haddock Propionibacterium acnes DQ Actinobacteria 99 soil Haddock Propionibacterium acnes DQ Actinobacteria 99 soil Haddock Propionibacterium acnes AY Actinobacteria 98 Haddock Staphylococcus epidermidis AF Firmicutes 99 skin Haddock Propionibacterium acnes DQ Actinobacteria 99 soil Haddock Enterobacter intermedius AF Gammaproteobacteria 99 99% identical to sample Haddock Enterobacter intermedius AF Gammaproteobacteria 99 from rainbow trout gut Haddock Clostridia sp. EU Firmicutes 95 cow manure Haddock Nitrosomonas sp. EU Betaproteobacteria 97 prawn farm sediment Haddock Uncultured Lachnospiraceae EF Firmicutes 94 human intestinal tract Haddock Uncultured Mycobacterium sp EU Actinobacteria 99 aircraft cabin air Haddock Uncultured bacterium DQ Firmicutes 94 human faeces Haddock Burkholderia sp AF Betaproteobacteria 99 volcanic deposits Cod Uncultured Firmicute AY Firmicutes 99 forest floor Cod Propionibacterium sp EU Actinobacteria 99 mud volcano Cod Morganella morganii AB Gammaproteobacteria 98 yellowtail muscle samples Cod Vibrio sp AB Gammaproteobacteria 99 marine bacterium Cod Vibrio sp AB Gammaproteobacteria 99 marine bacterium Cod Uncultured Firmicute AY Firmicutes 97 forest floor Cod Leuconostoc citreum AB Firmicutes 100 French cheeses Cod Burkholderia fungorum EF Betaproteobacteria 99 soil Cod Uncultured Firmicute EF Firmicutes 95 human faeces Cod Propionibacterium sp AF Actinobacteria 99 soil Table 1. Summary of the relationship between the sequences generated in this work and those already present in the GenBank public database. The number of sequences generated by this work was lower than initially anticipated. Two primary reasons were attributed to this; the low number of clones generated in the first instance, and the unexpectedly high number of these clones which contained DNA which had originated from chloroplasts. All identity values are based on preliminary sequence analysis which would have to be verified more closely before data were made public. However, identity levels are unlikely to change more than 1-2%, meaning that although the species might change in some cases, the broader classification (e.g. firmicutes) will remain unchanged.
6 However, inspection of the range of organism which were detected is also very interesting, as it demonstrates that, as with most environments, there is a wide range of different bacterial species present (e.g. firmicutes, proteobacteria, etc). The type of environment in which the best hit species was first identified also provides interesting information. There are a few sequences which have their origin in a gut environment either in the form of samples collected directly from intestinal material (including two with high similarity to an isolate from the digestive tract of a trout), or indirectly from faecal samples. However, the majority of the samples fall into the category of what can best be described as environmental samples, being typical of those seen in sediments, soil or air. This observation may also be explained in one of two ways. Firstly, it is possible that these results are a reflection of the successful nature of relatively closely related bacterial species in colonising very different environmental niches. Thus, although related to an organism which occupies a different niche, the sequences identified in this work may be representative of those found in this particular gut environment. Secondly, the bacteria from which the DNA had been extracted may include a number of organisms which genuinely do fall into the category of environmental samples. If this is the case, then their presence in the stomach may be a reflection of the lifestyle of the fish. Instead of being truly organisms which have evolved for existence in the digestive tract, it is possible that these individuals are actually transient in nature and have been swallowed by the fish. This is another likely scenario, as these bacteria could be present both in water entering the mouth, or even in any sediments which might be engulfed. Concluding remarks The number of sequenced obtained in the current work was less than had originally been expected. This could be attributed to two different observations which both contributed to this low number. Firstly there was the apparent recalcitrance of the PCR products to clone, and secondly there was unexpectedly high level of chloroplast sequences observed, which had to be removed from the subsequent analysis.
7 A few of the sequences obtained showed similarity to sequences previously obtained from gut samples. However, in most cases, the best hits identified were from samples obtained from environmental niches. It is unclear if these are genuinely environmental bacteria which were the source of these sequences. However, by pursuing the samples from the intestine in more detail may provide an answer to this problem, as it is less likely that an environmental sample is going to persist and survive further down the digestive tract.
COMPARISON OF CLONING AND SEQUENCING VS. TERMINAL RESTRICTION FRAGMENT ANALYSIS OF BACTERIA FROM HUMAN FECES. David Doherty and Danielle Elizondo
COMPARISON OF CLONING AND SEQUENCING VS. TERMINAL RESTRICTION FRAGMENT ANALYSIS OF BACTERIA FROM HUMAN FECES. David Doherty and Danielle Elizondo October 24 th 2001 Abstract Extracted DNA from the Probiotic
More informationData Sheet Quick PCR Cloning Kit
Data Sheet Quick PCR Cloning Kit 6044 Cornerstone Ct. West, Ste. E DESCRIPTION: The Quick PCR Cloning Kit is a simple and highly efficient method to insert any gene or DNA fragment into a vector, without
More informationBiotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
More informationCat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix
Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR
More informationDay 3. Examine gels from PCR. Learn about more molecular methods in microbial ecology
Day 3 Examine gels from PCR Learn about more molecular methods in microbial ecology Genes We Targeted 1: dsrab 1800bp 2: mcra 750bp 3: Bacteria 1450bp 4: Archaea 950bp 5: Archaea + 950bp 6: Negative control
More informationRecombinant DNA recombinant DNA DNA cloning gene cloning
DNA Technology Recombinant DNA In recombinant DNA, DNA from two different sources, often two species, are combined into the same DNA molecule. DNA cloning permits production of multiple copies of a specific
More informationHE Swift Cloning Kit
HE Swift Cloning Kit For high-efficient cloning of PCR products either blunt or sticky-end Kit Contents Contents VTT-BB05 phe Vector (35 ng/µl) 20 µl T4 DNA Ligase (3 U/µl) 20 µl 2 Reaction Buffer 100
More informationOverview: The DNA Toolbox
Overview: The DNA Toolbox Sequencing of the genomes of more than 7,000 species was under way in 2010 DNA sequencing has depended on advances in technology, starting with making recombinant DNA In recombinant
More informationPolymerase Chain Reaction
Polymerase Chain Reaction Amplify your insert or verify its presence 3H Taq platinum PCR mix primers Ultrapure Water PCR tubes PCR machine A. Insert amplification For insert amplification, use the Taq
More informationCHARACTERIZATION OF THE MICROBIAL DIVERSITY OF RABBIT INTESTINAL TRACT BY RESTRICTION FRAGMENT LENGTH POLYMORPHISM
CHARACTERIZATION OF THE MICROBIAL DIVERSITY OF RABBIT INTESTINAL TRACT BY RESTRICTION FRAGMENT LENGTH POLYMORPHISM BADIOLA I. 1, PÉREZ DE ROZAS A. M. 1, ROCA M. 1, CARABAÑO R. 2, GÓMEZ M. 2, GARCÍA J.
More informationJournal of Experimental Microbiology and Immunology (JEMI) Vol. 6:20-25 Copyright December 2004, M&I UBC
Preparing Plasmid Constructs to Investigate the Characteristics of Thiol Reductase and Flavin Reductase With Regard to Solubilizing Insoluble Proteinase Inhibitor 2 in Bacterial Protein Overexpression
More informationUnderstanding the Cellular Mechanism of the Excess Microsporocytes I (EMSI) Gene. Andrew ElBardissi, The Pennsylvania State University
Understanding the Cellular Mechanism of the Excess Microsporocytes I (EMSI) Gene Andrew ElBardissi, The Pennsylvania State University Abstract: Hong Ma, The Pennsylvania State University The Excess Microsporocytes
More informationSTABILITY OF INTESTINAL TRACT MICROFLORA AS DETERMINED BY TRF PATTERN ANALYSIS OF 16S RIBOSOMAL RNA GENE. By Catherine Houchen-Wise
STABILITY OF INTESTINAL TRACT MICROFLORA AS DETERMINED BY TRF PATTERN ANALYSIS OF 16S RIBOSOMAL RNA GENE By Catherine Houchen-Wise ABSTRACT To determine the stability of prokaryotic microflora in the intestinal
More informationAntisense RNA Targeting the First Periplasmic Domain of YidC in Escherichia coli Appears to Induce Filamentation but Does Not Affect Cell Viability
Antisense RNA Targeting the First Periplasmic Domain of YidC in Escherichia coli Appears to Induce Filamentation but Does Not Affect Cell Viability Riaaz Lalani, Nathaniel Susilo, Elisa Xiao, Andrea Xu
More informationIdentification of a Cucumber mosaic virus Subgroup II Strain Associated with Virus-like Symptoms on Hosta in Ohio
2013 Plant Management Network. Accepted for publication 18 December 2012. Published. Identification of a Cucumber mosaic virus Subgroup II Strain Associated with Virus-like Symptoms on Hosta in Ohio John
More informationpeco TM -T7-nGST, Eco cloning Kit User Manual (Patent pending)
peco TM -T7-nGST, Eco cloning Kit User Manual (Patent pending) Cloning PCR products for E Coli expression of N-term GST-tagged protein Cat# Contents Amounts Application IC-1004 peco-t7-ngst vector built-in
More informationGenBuilder TM Cloning Kit User Manual
GenBuilder TM Cloning Kit User Manual Cat.no L00701 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ. DNA
More informationName: Ally Bonney. Date: January 29, 2015 February 24, Purpose
Name: Ally Bonney Title: Genome sequencing and annotation of Pseudomonas veronii isolated from Oregon State University soil and 16S rrna characterization of Corvallis, OR soil microbial populations Date:
More informationMCB 102 University of California, Berkeley August 11 13, Problem Set 8
MCB 102 University of California, Berkeley August 11 13, 2009 Isabelle Philipp Handout Problem Set 8 The answer key will be posted by Tuesday August 11. Try to solve the problem sets always first without
More informationVector Linearization. igem TU/e 2016 Biomedical Engineering
igem TU/e 2016 Biomedical Engineering Eindhoven University of Technology Room: Ceres 0.04 Den Dolech 2, 5612 AZ Eindhoven The Netherlands Tel. no. +31 50 247 55 59 2016.igem.org/Team:TU_Eindhoven Vector
More informationEnhanced Arginase production: rocf
Enhanced Arginase production: rocf Purpose and Justification: Bacillus subtilis produces urease, which catalyses the hydrolysis of urea into ammonium and carbonate. Since the cell wall of the bacteria
More informationFigure 1. Map of cloning vector pgem T-Easy (bacterial plasmid DNA)
Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 6: Ligation & Bacterial Transformation (Bring your text and laptop to class if you wish to work on your assignment during
More informationGenBuilder TM Plus Cloning Kit User Manual
GenBuilder TM Plus Cloning Kit User Manual Cat. No. L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationGenBuilder TM Plus Cloning Kit User Manual
GenBuilder TM Plus Cloning Kit User Manual Cat.no L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ.
More informationGENETIC ENGINEERING worksheet
Section A: Genetic Engineering Overview 1. What is genetic engineering? 2. Put the steps of genetic engineering in order. Recombinant product is isolated, purified and analyzed before marketing. The DNA
More informationBiology 4100 Minor Assignment 1 January 19, 2007
Biology 4100 Minor Assignment 1 January 19, 2007 This assignment is due in class on February 6, 2007. It is worth 7.5% of your final mark for this course. Your assignment must be typed double-spaced on
More informationStudent Learning Outcomes (SLOS)
Student Learning Outcomes (SLOS) KNOWLEDGE AND LEARNING SKILLS USE OF KNOWLEDGE AND LEARNING SKILLS - how to use Annhyb to save and manage sequences - how to use BLAST to compare sequences - how to get
More informationContents. 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA Introduction Principle...
Contents 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA... 1 Introduction... 1 Principle... 1 Reagents Required and Their Role... 2 Procedure... 3 Observation... 4 Result
More informationCold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual
Fusion Cloning technology Cold Fusion Cloning Kit Store the master mixture and positive controls at -20 C Store the competent cells at -80 C. (ver. 120909) A limited-use label license covers this product.
More informationpcmv6-neo Vector Application Guide Table of Contents Package Contents and Storage Conditions Each kit comes with the following components:
pcmv6-neo Vector Application Guide Table of Contents Package Contents and Storage Conditions... 1 Product Description... 1 Introduction... 1 Production and Quality Assurance... 2 Methods... 2 Other required
More informationLigation Independent Cloning (LIC) Procedure
Ligation Independent Cloning (LIC) Procedure Ligation Independent Cloning (LIC) LIC cloning allows insertion of DNA fragments without using restriction enzymes into specific vectors containing engineered
More informationModule Code: BIO00007C
Examination Candidate Number: Desk Number: BSc and MSc Degree Examinations 2018-9 Department : BIOLOGY Title of Exam: Genetics Time Allowed: 1 Hour 30 Minutes Marking Scheme: Total marks available for
More informationCLONING AND EXPRESSION OF PSEUDOMONAS AERUGINOSA PA01 GENES IN E.COLI DH5Α FOR THE DETECTION OF ARSENIC IN CONTAMINATED WATER SAMPLE
CLONING AND EXPRESSION OF PSEUDOMONAS AERUGINOSA PA01 GENES IN E.COLI DH5Α FOR THE DETECTION OF ARSENIC IN CONTAMINATED WATER SAMPLE A report Submitted to KSCST for 40 th series of SPP 2017 Project Proposal
More informationTitle: Understanding the impact of orientation on gene expression of lux operon in pkn800 transformation into Escherichia coli DH5α
Seim - 1 Name: Darian Seim Title: Understanding the impact of orientation on gene expression of lux operon in pkn800 transformation into Escherichia coli DH5α Date: April 12 th, 2016 April 18 th, 2016
More informationChapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.
Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers
More informationVector Linearization. igem TU/e 2015 Biomedical Engineering
igem TU/e 2015 Biomedical Engineering Eindhoven University of Technology Room: Ceres 0.04 Den Dolech 2, 5612 AZ Eindhoven The Netherlands Tel. no. +31 50 247 55 59 2015.igem.org/Team:TU_Eindhoven Vector
More informationMycobacterium paratuberculosis
BACTOTYPE PCR Amplification Kit Mycobacterium paratuberculosis Labor Diagnostik Leipzig Manual Technology The product group BACTOTYPE PCR Amplification Kit comprises optimised systems for the identification
More informationBiology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write.
Name KEY Section Biology 201 (Genetics) Exam #3 120 points 20 November 2006 Read the question carefully before answering. Think before you write. You will have up to 50 minutes to take this exam. After
More informationCHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? CHAPTER 2A STUDENT GUIDE 2013 Amgen Foundation. All rights reserved.
CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? 35 INTRODUCTION In the Program Introduction, you learned that the increase in diabetes in the United States has resulted in a great demand for its treatment,
More informationLaura Sims PhD UC Berkeley Forest Pathology and Mycology Lab
Laura Sims PhD UC Berkeley Forest Pathology and Mycology Lab Outline What can molecular biology tell us about a pathogen? Tools and techniques used for diagnostics ELISA PCR Sequencing Sequence alignment
More informationAll subjects gave written informed consent before participating in this study, which
Supplementary Information Materials and Methods Sequence generation and analysis All subjects gave written informed consent before participating in this study, which was approved by the Washington University
More informationNZYGene Synthesis kit
Kit components Component Concentration Amount NZYGene Synthesis kit Catalogue number: MB33901, 10 reactions GS DNA Polymerase 1U/ μl 30 μl Reaction Buffer for GS DNA Polymerase 10 150 μl dntp mix 2 mm
More informationChapter 10 (Part II) Gene Isolation and Manipulation
Biology 234 J. G. Doheny Chapter 10 (Part II) Gene Isolation and Manipulation Practice Questions: Answer the following questions with one or two sentences. 1. What does PCR stand for? 2. What does the
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/315/5819/1709/dc1 Supporting Online Material for RISPR Provides Acquired Resistance Against Viruses in Prokaryotes Rodolphe Barrangou, Christophe Fremaux, Hélène Deveau,
More informationpgm-t Cloning Kit Cat. # : GVT202 Size : 20 Reactions Store at -20
pgm-t Cloning Kit Cat. # : GVT202 Size : 20 Reactions Store at -20 1 Kit Contents Contents pgm-t Cloning Kit pgm-t Vector (50 ng/μl) 20 μl T4 DNA Ligase (3 U/μl) 20 μl 10X T4 DNA Ligation Buffer 30 μl
More informationBiotechnology:Principles and Processes
Biotechnology:Principles and Processes Very Short Answers Questions: 1. Define biotechnology? A: The integration of natural science and organisms, cells, parts thereof, and molecular analogues for products
More informationPuro. Knockout Detection (KOD) Kit
Puro Knockout Detection (KOD) Kit Cat. No. CC-03 18 Oct. 2016 Contents I. Kit Contents and Storage II. Product Overview III. Methods Experimental Outline Genomic DNA Preparation Obtain Hybrid DNA Digest
More informationinventory of Narragansett Bay
Genetic barcoding of Green Algae Ulva sp. for algal inventory of Narragansett Bay Benjamin Gibson Abstract: Through the use of DNA isolation, PCR amplification, plasmid cloning and plasmid purification,
More informationGenetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
More information7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau
7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial
More informationBi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8
Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically
More informationProblem Set 8. Answer Key
MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no
More informationB. Incorrect! Ligation is also a necessary step for cloning.
Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease
More informationpgm-t Cloning Kit For direct cloning of PCR products generated by Taq DNA polymerases For research use only Cat. # : GVT202 Size : 20 Reactions
pgm-t Cloning Kit For direct cloning of PCR products generated by Taq DNA polymerases Cat. # : GVT202 Size : 20 Reactions Store at -20 For research use only 1 pgm-t Cloning Kit Cat. No.: GVT202 Kit Contents
More informationSupplemental Materials. DNA preparation. Dehalogenimonas lykanthroporepellens strain BL-DC-9 T (=ATCC
Supplemental Materials DNA preparation. Dehalogenimonas lykanthroporepellens strain BL-DC-9 T (=ATCC BAA-1523 = JCM 15061) was grown in defined basal medium amended with 0.5 mm 1,1,2- trichloroethane (1,1,2-TCA)
More informationInfluence of tlp5, che1p, tlp4a, and che4stas Promoters on Chemotaxis in Azospirillum brasilense
University of Tennessee, Knoxville Trace: Tennessee Research and Creative Exchange University of Tennessee Honors Thesis Projects University of Tennessee Honors Program 5-2015 Influence of tlp5, che1p,
More informationPage 1 of 10 MIDTERM EXAM OF BIO
Page 1 of 10 MIDTRM XAM OF IO3151 2017 Name: Student number: Part I: Calculations 1 2 3 4 NaCl: Water: 5 6 7 Volume of NaCl: 8 Plasmid A: Amount of 1 Kb insert: Part II: ioinformatics 1 2 3 Forward: Reverse:
More informationPlantDirect TM Multiplex PCR System
PlantDirect TM Multiplex PCR System Technical Manual No. 0178 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 3 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed
More informationBiotechnology DNA technology
Biotechnology Biotechnology is the manipulation of organisms or their components to make useful products The applications of DNA technology affect everything from agriculture, to criminal law, to medical
More informationBiol/Chem 475 Spring 2007
Biol/Chem 475 Spring 2007 Goal of lab: For most of the quarter, we will be exploring a gene family that was first discovered in fruitlfies and then found to be present in humans and worms and fish and
More informationStandards for Safety Assessments of Food Additives produced Using Genetically Modified Microorganisms
Standards for Safety Assessments of Food Additives produced Using Genetically Modified Microorganisms (Food Safety Commission Decision of March 25, 2004) Chapter 1 General Provisions No. 1 Background on
More informationMolecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
More informationPasteurella multocida
BACTOTYPE PCR Amplification Kit Pasteurella multocida Labor Diagnostik Leipzig Manual Technology The product group BACTOTYPE PCR Amplification Kit comprises optimised systems for the identification of
More informationSupplementary Information
Supplementary Information Vidigal and Ventura a wt locus 5 region 3 region CCTCTGCCACTGCGAGGGCGTCCAATGGTGCTTG(...)AACAGGTGGAATATCCCTACTCTA predicted deletion clone 1 clone 2 clone 3 CCTCTGCCACTGCGAGGGCGTC-AGGTGGAATATCCCTACTCTA
More informationDay 3. Examine gels from PCR. Learn about more molecular methods in microbial ecology
Day 3 Examine gels from PCR Learn about more molecular methods in microbial ecology 1: dsrab 1800bp 2: mcra 750bp 3: Bacteria 1450bp 4: Archaea 950bp 5: Archaea + 950bp 6: Negative control Genes We Targeted
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationBootcamp: Molecular Biology Techniques and Interpretation
Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing
More information3 Designing Primers for Site-Directed Mutagenesis
3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed
More informationREPORT DOCUMENTATION PAGE (SF298) (Continuation Sheet) DARPA BAA03-02 Proposal: Analysis of GI community shifts in response to dietary fiber
REPORT DOCUMENTATION PAGE (SF298) (Continuation Sheet) Final Progress Report August 05, 2003 August 31, 2004 DARPA BAA03-02 Proposal: Analysis of GI community shifts in response to dietary fiber Contract
More informationHetero-Stagger PCR Cloning Kit
Product Name: Code No: Size: DynaExpress Hetero-Stagger PCR Cloning Kit DS150 20 reactions Kit Components: Box 1 (-20 ) phst-1 Vector, linearized Annealing Buffer Ligase Mixture phst Forward Sequence Primer
More informationConversion of plasmids into Gateway compatible cloning
Conversion of plasmids into Gateway compatible cloning Rafael Martinez 14072011 Overview: 1. Select the right Gateway cassette (A, B or C). 2. Design primers to amplify the right Gateway cassette from
More informationStep 1: Digest vector with Reason for Step 1. Step 2: Digest T4 genomic DNA with Reason for Step 2: Step 3: Reason for Step 3:
Biol/Chem 475 Spring 2007 Study Problems for Quiz 2 Quiz 2 (~50 pts) is scheduled for Monday May 14 It will cover all handouts and lab exercises to date except the handout/worksheet (yet to be distributed)
More informationOverview: The DNA Toolbox
Overview: The DNA Toolbox Sequencing of the genomes of more than 7,000 species was under way in 2010 DNA sequencing has depended on advances in technology, starting with making recombinant DNA In recombinant
More informationMolecular Evolution and Ecology. Martin Polz
Molecular Evolution and Ecology Martin Polz mpolz@mit.edu Overview I. Molecular evolution 1. History of life on Earth 2. Genes as chronometers 3. Tree of life II. Molecular ecology 1. Prokaryotic abundance
More informationBIOTECHNOLOGY. Sticky & blunt ends. Restriction endonucleases. Gene cloning an overview. DNA isolation & restriction
BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY Recombinant DNA technology involves sticking together bits of DNA from different sources. Made possible because DNA & the genetic code are universal. 2004 Biology
More informationReading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
More informationFun with DNA polymerase
Fun with DNA polymerase Why would we want to be able to make copies of DNA? Can you think of a situation where you have only a small amount and would like more? Enzymatic DNA synthesis To use DNA polymerase
More informationDNA Technology. Asilomar Singer, Zinder, Brenner, Berg
DNA Technology Asilomar 1973. Singer, Zinder, Brenner, Berg DNA Technology The following are some of the most important molecular methods we will be using in this course. They will be used, among other
More informationBCH 462 Competent Cells Formation and Transformation of Competent Cells with plasmid DNA.
Lab#2 BCH 462 Competent Cells Formation and Transformation of Competent Cells with plasmid DNA. Outlines: 1-Insertion of foreign gene to the plasmid. 2-Competent cell. 3-Transformation of bacterial cell.
More informationCloneDirect Rapid Ligation Kit
CloneDirect Rapid Ligation Kit Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608) 831-9012 lucigen@lucigen.com www.lucigen.com FOR RESEARCH
More informationChapter 10 Genetic Engineering: A Revolution in Molecular Biology
Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical
More informationChromium Uptake by a Bacteria Isolated From Lemna Rhizosphere in a Lentic Ecosystem
International International Multidisciplinary Multidisciplinary e-journal e Journal / INDRANI SAHA*, DR. ARUP KUMAR ISSN 2277 MITRA*, - 4262 Chromium Uptake by a Bacteria Isolated From Lemna Rhizosphere
More informationAMV First Strand cdna Synthesis Kit
DNA AMPLIFICATION & PCR AMV First Strand cdna Synthesis Kit Instruction Manual NEB #E6550S Store at 20 C ISO 9001 Registered Quality Management ISO 14001 Registered Environmental Management ISO 13485 Registered
More informationAntisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression
Vol. 1:7-15 Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression Ji, Tom, Lu, Aneka, Wu, Kaylee Department of Microbiology and Immunology, University of British Columbia
More information2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
More informationMolecular methods for detection of Antibiotic Resistance in environmental matrices: limits, prospects and challenges.
Dr. Angela Cicatelli acicatelli@unisa.it Molecular methods for detection of Antibiotic Resistance in environmental matrices: limits, prospects and challenges. 1st Workshop on "Risk prognosis of environmental
More informationYG1 Control. YG1 PstI XbaI. YG5 PstI XbaI Water Buffer DNA Enzyme1 Enzyme2
9/9/03 Aim: Digestion and gel extraction of YG, YG3, YG5 and 8/C. Strain: E. coli DH5α Plasmid: Bba_J600, psbc3 4,, 3 6 7, 8 9 0, 3, 4 8/C 8/C SpeI PstI 3 3 x3 YG YG PstI XbaI.5 3.5 x YG3 YG3 PstI XbaI
More information-Is the process of manipulating genes and genomes
Genetic Engineering -Is the process of manipulating genes and genomes Biotechnology -Is the process of manipulating organisms or their components for the purpose of making useful products Restriction Enzymes
More informationCHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
More informationChapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering
Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death
More informationCHAPTER FOUR. Characterization of parasporal genes in. Paenibacillus popilliae and Paenibacillus lentimorbus. Abstract
CHAPTER FOUR Characterization of parasporal genes in Paenibacillus popilliae and Paenibacillus lentimorbus Abstract The parasporal gene, cry18aa1, was cloned and sequenced by Zhang et al. (4) from the
More informationAmplicon Sequencing Template Preparation
Amplicon Sequencing Template Preparation The DNA sample preparation procedure for Amplicon Sequencing consists of a simple PCR amplification reaction, but uses special Fusion Primers (Figure 1-1). The
More informationDevelopment of Positive Control for Hepatitis B Virus
Human Journals Research Article December 2015 Vol.:2, Issue:2 All rights are reserved by Saurabh Bandhavkar et al. Development of Positive Control for Hepatitis B Virus Keywords: Hepatitis B virus, pbluescript,
More informationInsight into microbial world molecular biology research in environmental microbiology
Insight into microbial world molecular biology research in environmental microbiology Aleksandra Ziembi ska The Silesian University of Technology, Environmental Biotechnology Department aleksandra.ziembinska@polsl.pl
More informationAnswer sheet. Student number:
Page 1 of 9 MIDTERM EXAM OF BIO/BPS3151 2016 Answer sheet Name: Student number: Part II: Calculations 1 128g 2 58.5g 3 NaCl: 1L Water: 0.2L 4 2.5 g/l 5 0.4 6 1:4:2 7 900 ml 8 Plasmid A: 3.75 µl Plasmid
More informationCH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
More informationGenome annotation & EST
Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary
More informationThings Were Not As They Appeared - Characterization of Chitinase and Reductase Genes in. Bacterial Isolates From the Salamander Microbiome
Things Were Not As They Appeared - Characterization of Chitinase and Reductase Genes in Bacterial Isolates From the Salamander Microbiome Erin Carter Department of Biological Sciences, Fordham University,
More informationGENETICS - CLUTCH CH.5 GENETICS OF BACTERIA AND VIRUSES.
!! www.clutchprep.com CONCEPT: WORKING WITH MICROORGANISMS Bacteria are easy to with in a laboratory setting They are fast dividing, take up little space, and are easily grown in a lab - Plating is when
More information