Improving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm

Transcription

1 Improving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm Anja Smith Director R&D Dharmacon, part of GE Healthcare Imagination at work

2 crrna:tracrrna program Cas9 nuclease Active crrna is comprised of 20 nt of spacer-derived sequence and ~ 22 nt of repeat-derived sequence Each crrna hybridizes to tracrrna through repeat-derived sequence Hybrid crrna:tracrrna complex recruits Cas9 endonuclease Cleaves DNA adjacent to protospaceradjacent motif (PAM) JD Sander & JK Joung, Nature Biotechnology (2014) 2

3 Cas9 protein can be programmed to perform gene editing in mammalian cells Jinek et al., Science : publications demonstrated ability of engineered CRISPR-Cas9 system to edit genes in human and mouse cells 3

4 CRISPR-Cas9 experimental workflow for NHEJ Lentiviral Cas9 Cas9 Cas9 Guide RNA Synthetic crrna:tracrrna OR Cas9 plasmid Cas9 protein OR Cas9 Cas9 ± antibiotic selection 3-14 days Cas9:crRNA:tracrRNA mixed population 3 day sgrna sgrna Lentiviral sgrna(s) sgrna plasmid Cas9 mrna OR Single colony expansion into 96-well plates 2-3 weeks IVT or synthetic sgrna Detect Cas9-induced double-strand DNA breaks: PCR-based detection assay, Sanger sequencing, phenotypic assay 4

5 Potential barrier to success: design of grna Most guide RNAs will create double-strand breaks and generate indels in their target gene, but Not all guide RNAs cut with equivalent efficiency Not all indels cause functional knockout of the protein Silent mutation would cause no major changes May occur in non-essential region of protein Editing of unintended targets can occur without proper analysis for specificity

6 Synthetic dual RNA approach: Edit-R products Why dual RNAs? Natural bacterial system crrna synthetic RNA comprising 20 nt target-specific sequence and fixed S. pyogenes repeat sequence tracrrna Long synthetic RNA which hybridizes with crrna, universal Why synthetic? Easier for researcher (no need for cloning, sequencing, in vitro transcription, etc.) DNA-free guide RNA: transient, fewer offtarget effects, less toxic Enables high-throughput applications like arrayed screening Provides possibility of chemical modifications to enhance functionality

7 Synthetic dual RNA approach Chemical synthesis of long RNAs crrna synthetic 42 mer RNA, custom 20 mer to target sequence tracrrna synthetic 74 mer RNA, universal 2 -ACE chemistry: faster coupling rates, higher yields and purity Synthetic single guide RNA 99 mer Comparable functionality More costly, low throughput, lower yield % indels DNMT3B PPIB 5' C U U C A U U G A C C U C A A C U A C A G U U U U A G U A A A U A A 3' U A U G U U C G C U C G C A C G G U G U C U A G A U A G C G C C G A G C A U A U G U G A A A A U U C G A A A G C U A G A G A U A A

8 Rational design algorithm for guide RNA selection

9 Considerations for developing a rational design algorithm for CRISPR-Cas9 guide RNA Functionality Algorithm should score and select for FUNCTIONAL knockout, not just indel formation Specificity Algorithm must accurately find and eliminate potential off-targets

10 Development of the Edit-R CRISPR RNA algorithm Test all possible crrna designs across known positive genes Over 1100 crrna across 10 genes Assess & quantify functionality Quantitative phenotypic reporter assay Analyze characteristics of good vs. poor designs Patterns; motifs, base preference, etc. Build and test a set of general criteria Assess selected designs in different assay systems

11 Screening assay for proteasome function 50 nm crrna:tracrrna 3 days U2OS cells stably expressing EGFP with an N-terminal fusion to a mutant ubiquitin (Gly76Val) Normally no fluorescence Measure GFP expression on imaging system Ubiquitin-EGFP is degraded when proteasome pathway is functioning (no signal) Ubiquitin-EGFP accumulates when proteasome function is disrupted (EGFP signal) 11

12 Functional assay validation crrna: tracrrna PPIB PSMD7 VCP crrna:tracrrna PSMD VCP sirna pool (control) % Indel U2OS Ubi[G76V]-EGFP Cas9 cells PPIB negative control, PSMD7 & VCP positive controls 50 nm crrna:tracrrna 12

13 Experimental workflow 1 day Lentiviral transduction Selection with blasticidin Cas9 U2OS Ubiquitin-GFP cells Cas9 cell line mixed population Synthetic crrna:tracrrna transfection 6-15 days Blasticidin-selected cell population expansion 3 days Cas9 cell line mixed population Phenotypic analysis All crrnas for 10 genes chemically synthesized > 1100 crrnas in total were screened

14 Functionality of all possible crrnas targeting PSMD8 in phenotypic assay GFP signal Exon 1 Exon 3 Exon 4 Exon 5 Exon 6 Exon 7 controls cut site distance from CDS start in transcript Edit-R CRISPR-Cas9 26 January

15 Creation of indels does not always result in functional knockout Five different crrna designs occurring in an early exon demonstrate ~ 40% indel frequency NONE gave phenotypic result, therefore none resulted in functional knockout of the protein crrna % indel Indel formation is a measure of CRISPR efficiency, but does not ensure the desired phenotype 15

16 Functional gene disruption depends on gene position & sequence VCP Early exon target sites can be functional or nonfunctional Factors other than location contribute to guide RNA functionality Anderson et al. J Biotechnology 211: (2015) 16

17 A selection of important features examined by the algorithm to select functional designs Cut site location within gene Sequence around cut site Sequence within/around PAM GC content Strand preference 17

18 Algorithm validation Additional assays and new gene targets used to test the functionality design rules When compared to low-scoring designs, do high-scoring designs: 1. Result in higher editing efficiency? 2. Give better knockout in additional phenotypic assays? 3. Work equally well for expressed sgrna as for synthetic crrna?

19 Comparison of gene editing efficiency for highscoring and low-scoring predesigned crrnas 10 genes 10 high-scoring crrnas 10 low-scoring crrnas HEK293T-CAG- Cas9 expressing cell line Amplicons generated for each crrna sequence in transfected and untreated cells Indexed and pooled for NGS analysis (percent perfect in treated v. untreated) Cas9 Synthetic crrna:tracrrna transfection 3 days Indel formation 19

20 crrnas that have high functionality scores show high editing efficiency High-scoring crrnas 93% achieve indels > 40% Low-scoring crrnas 33% achieve indels > 40% 20

21 ApoONE assay: higher scores correlate with higher functionality BCL2L1 PLK1 WEE1 Normalized ApoONE assay H1 H H1 H H1 H2 61 crrnas 37 crrnas 12 crrnas H1 = bottom half of scores H2 = top half of scores

22 Good correlation between crrnas and sgrnas with the same design 6 PSMD11 sgrna sgrna Normalized EGFP signal crrna un Target designs Algorithm-selected CRISPR guide RNA sequences are universally effective 22

23 Considerations for developing a rational design algorithm for CRISPR-Cas9 guide RNA Functionality Algorithm should score and select for FUNCTIONAL knockout, not just indel formation Specificity Algorithm must accurately find and eliminate potential off-targets

24 Tolerance for flaws along the guide RNA Recognition of protospacer-adjacent motif (PAM) by the crrna If mismatches are detected within the seed region, Cas9:RNA complex cannot effectively interrogate the remaining target region There is greater tolerance for mismatches or gaps the further away they occur from the PAM, leading to potential off-target cleavage. DNA NNNNNNNN N A M N N P NNNNNNNN N N NNNNNNNNNNNNNNNNNNNN N NNNNNNNNNNNNNNNNNNNN N N N DNA N A M NNNNNNNN N N P NNNNNNNNNNNNNNNNNNNN RNA NNNNNNNNNNNNNNNmNNmN DNA N A M NNNNNNNN N N P NNNNNNNNNNNNNNNNNNNN RNA NNmNNNNNNNNNNNNNNNNN

25 Edit-R algorithm: Scoring specificity 1. Develop a rigorous alignment tool to identify all possible off-targets 2. Weigh the probability of each imperfect alignment in causing offtarget cleavage 3. Assign a specificity score Gap in DNA NNNNNN N M NNNNNNNN A N N P NNNNmNNNNNNN-NNNNNNN Flaws m = mismatch NNNNNNNN-NNNNNNNNmNN - = gap DNA RNA Gap in RNA Edit-R alignment tool: More rigorous identification of both mismatches AND gaps between DNA target and guide RNA

26 Comparison of number of off-target alignments found by Edit-R tool versus other CRISPR tools Target 1 - GGTCATCTGGGAGAAAAGCG CGG hg38; chr14: # of alignments found 0 flaws 1 flaw 2 flaws 3 flaws Tool Tool No results Tool Tool Edit-R tool alignment Flaws = mismatches and gaps

27 Designs with gaps & mismatches can cause offtarget cleavage Target/ Off-target Intended target OT1 OT2 OT3 Flaws m = mismatch - = gap Sequence GGTCATCTGGGAGAAAAGCG GGTCCTCTGGGAGAAAAGACG One RNA gap, one mismatch GGT-ATCTGGGAGAAAAGCA One DNA gap, one mismatch GGTC-TCTGGGAGAAAAG-G Two DNA gaps PAM TGG CAG TGG AAG Target OT1 OT2 OT3 crrna: tracrrna Indel %

28 Summary The Edit-R CRISPR algorithm was trained on functional gene knockout data and can be applied across genome-wide guide RNA designs The Edit-R specificity tool detects gaps and mismatches to avoid potential off-targets for increased specificity Rational design algorithm RNA synthesis expertise Vector biology & lentiviral production sgrna Edit-R predesigned CRISPR guide RNA Pre-designed synthetic crrnas or lentiviral sgrnas for all genes in human, mouse, rat genomes 28

29 Edit-R arrayed synthetic crrna libraries Catalog crrna libraries Screening of popular gene families Cherry-pick crrna libraries Online ordering and configuration of plated pre-designed crrna 29

30 Edit-R lentiviral sgrna platform: individual sgrnas and pooled lentiviral sgrna libraries Cas9 nuclease Choice of six different promoters Blasticidin selectable marker sgrna Rational design for sgrna targeting sequence Puromycin selectable marker 30

31 Dharmacon CRISPR Configurator: custom designs Supports >30 different species 31

32 All content contained in this presentation (including, without limitation, text, design, graphics, logos, icons, images, as well as the selection and arrangement thereof), is the exclusive property of and owned by GE, its licensors or its content providers and is protected by copyright, trademark and other applicable laws. You may access, copy, download and print the material contained in this presentation for your personal and non-commercial use, provided you do not modify or delete any copyright, trademark or other proprietary notice that appears on the material you access, copy, download or print. Any other use of this, including but not limited to the modification, distribution, transmission, performance, broadcast, publication, uploading, licensing, reverse engineering, transfer or sale of, or the creation of derivative works from, any material, information, software, products or services obtained from this presentation, or use of the information for purposes competitive to GE, is expressly prohibited General Electric Company-All rights reserved. First published September 2015.