Cowpea Breeding. Ainong Shi. University of Arkansas
|
|
- Barry Preston
- 6 years ago
- Views:
Transcription
1 Cowpea Breeding Ainong Shi University of Arkansas
2 UAF Vegetable Breeding UAF AR USA International Collaboration Classic Breeding Molecular Breeding Student Training Classic breeding such as crossing, generation advanced, and variety development Molecular breeding technology including QTL analysis, SNP discovery and genotyping, nextgeneration sequencing such as GBS, and how to use bioinformatics tools in breeding program HORT6033 Genetic Techniques in Plant Breeding (Even years, Fa) Molecular Plant Breeding Focus Greenhouse High tunnel Potential Cowpea Spinach Dandelion Chicory Collard Kale Cucumber Tomato
3 Classic Breeding Main Street Molecular breeding Plant Breeding Approach Abiotic and biotic resistance breeding (disease/pest resistance, drought and salt tolerance) P 1 x P 1 x P 2 F 1 F 2 F 3 F 4-5 F 6-7 F 8-10 Parent selection Predictive breeding True/false, self testing BC 1 F 1 Visual selection MAS for simple traits Preliminary Intermediate MAS for quantitative traits Backcross breeding Cultivar variety Release Final Yield Test Marker-assisted selection (MAS) Genome-wide selection (GWS) Marker-assisted backcross breeding (MABB) QTL-based and genome-wide predictive breeding Genotyping by sequencing (GBS) SNP discovery and validation QTL mapping and association analysis Candidate gene identified and clone
4 Cowpea Breeding Program in UAF Classic Breeding Molecular Breeding Objective of the project is to merge molecular breeding into classic breeding with added Genotyping by Sequencing (GBS) and SNP platform through marker assisted selection (MAS) to speed up cowpea breeding and to develop high yield varieties with abiotic and biotic stress tolerance and colorful seeds.
5 Classic Breeding of Cowpea Over 50 years history Released more than 12 varieties Over advanced lines Emphasized improved plant architecture, earliness, concentrated flowering and fruiting, and upright and bushtype cultivars Various mature seed pattern and pattern color such as blackeye, pinkeye, and red holstein, and various seed coat color such as black, cream, green, pink, red tan, and yellow cowpea
6 UAF Cowpea Varieties Erect Set Cream seed and white pod Comment: cowpea (Southern pea) varieties credited to Dr. Teddy Morelock and Mr. Dennis Motes!)
7
8 UAF Cowpea Varieties Pinkeye seed white pod
9 UAF Cowpea Varieties Early Scarlet Encore Pinkeye seed and purple pod
10 UAF Cowpea Varieties Excel Select Blackeye seed and purple pod
11 UAF Cowpea Varieties
12 UAF Cowpea Varieties Epoch
13
14
15 Cowpea seed coat color and pattern
16
17 Molecular Breeding of Cowpea Build genotyping by sequencing (GBS) and SNP platform: Discover genome-wide SNP Analyze cowpea genetic diversity Conduct genome-wide association and identify SNP markers for agronomic traits, morphologic traits, abiotic and biotic tolerance, and seed protein and sugar content Develop a SNP set for cowpea variety identification
18 Single Nucleotide Polymorphism (SNP) L1011 L1102 L1232 L3130 AAGTAGCTACGAGGTTAGTAAGCAAT AAGTAGCTACGAGGTTAGTAAGCAAT AAGTAGCTACGACGTTAGTAAGCAAT AAGTAGCTACGACGTTAGTAAGCAAT L1011 G M1102 G M1232 C L3130 C
19 Genotyping by Sequencing (GBS) ION PGM ION Proton HiSeq 2000 Illuminia
20 Genotyping by Sequencing (GBS)
21 Traits interests for cowpea breeding and genetics: Agronomic traits: grain (seed) yield and forage (leave) yield, 100-seed weight and seed size, maturity day, and processing quality such as seed coat and recovery % imbedded Morphologic traits: o Plant habit (erect, semiprostrate, prostrate) o Dry pod color [straw, green, purple, black, speckled, variable (inconsistent or changeable), mixed (two or more colors), brown] o Pod placement (above foliage, foliage level, below foliage, and mixed) o Mature seed pattern [eye, solid, speckled (small spots), mottled (large spots), holstein (large patch), saddle-eye, variable (inconsistent or changeable), mixed (two or more patterns)] o Pod position [erect, intermediate (30 to 60 degree) angle, pendant, mixed (two or more pod positions)] o Seed pattern color [black, brown, blue, green, grey, mixed (two or more colors), purple, red, tan, variable, white (cream), yellow] o Primary seed coat color [black, brown, blue, green, grey, mixed (two or more colors), purple, red tan, variable, white (cream), yellow] o Seed shape [crowder, seed flat on both ends, semicrowder, seed flat on one end and rounded on other noncrowder, seed rounded on both ends, mixed (two or more shapes)], o Seed texture (rough, smooth, wrinkled, mixed (two or more textures)] Abio- and biotic (disease and pest) resistance/tolerance: Images from CPMV google search o Cowpea wilt (Fusarium oxysporum f. sp. tracheiphilum) resistance o Cowpea Mosaic Virus resistance (CPMV) o Cowpea bacterial blight (CBB) resistance CBB o Cowpea aphid tolerance o Root-knot nematode (RKN, Meloidogyne spp.) tolerance Cowpea Wilt o Iron deficiency chlorosis (IDC) and low phosphorus efficiency Aphid o Salt, drought, and heat tolerance Seed protein and sugar content RKN
22 Genome-wide SNP discovery in cowpea using GBS Cowpea germplasm DNA extraction Genotyping by Sequencing Data Analysis SNP Discovery Plant materials: 730 cowpea genotypes including cultivars released in U.S., USDA accessions consisted of 54 countries, and advanced Arkansas breeding lines DNA extraction: genomic DNA is extracted from dried leaves using the CTAB Sequencing: DNA sequencing using GBS by HiSeq 2000/2050 in BGI SNP discovery: GBS data analysis using DNASTAR Lasergene Genomics Suite, TASSEL Result: about a million SNPs were postulated from the GBS data of the 730 cowpea germplasm by de novo assembly
23 QTL mapping and association analysis in cowpea Agronomic traits: grain and forage yield 100-seed weight maturity day Morphologic traits: Plant habit Dry pod color Pod placement Mature seed pattern Pod position Seed pattern seed coat color Seed shape Abio- and biotic tolerance: Cowpea wilt CPMV Bacterial blight aphid RKN IDC Low phosphorus efficiency Salt Drought Heat Seed protein and sugar content Phenotypic Data QTL Mapping Donor Screening Population Development Data Analysis Marker Identification Marker Implementation Genotypic Data Association Analysis Molecular Breeding using GBS / 60K SNP chip
24 SNP Markers for Cowpea Bacterial Blight Resistance Three QTLs, CoBB1, CoBB2, and CoBB3, were reported to be linked to CoBB resistance on linkage group LG3, LG5 and LG9 of cowpea (Agbicodo et al. 2010). CP02_ Two SNP markers, CP08_ and CP02_ were identified to be associated with CoBB resistance located at the same regions of CoBB1 and CoBB2, respectively. The accuracy of selecting resistance lines was 86.7% based on the data of 201 cowpea lines from this study. SNP Soy Pos CP02_ Gm02 50,192,757 CP08_ Gm08 5,433,936 1_0037 Gm02 45,862,359 1_0853 Gm08 3,450,676 CP08_ Agbicodo et al Euphytica 175: SNP 1_0183 Gm08 4,014,465 Beneficial allele Unbeneficial allele R 2 (%) Total line CP02_ TT CC CP08_ AA GG Combination [TT][AA] [CC][GG]
25 Vegetable Breeding and Genetics in University of Arkansas Cowpea (Southern peas) Spinach Dandelion Kale Cucumber Tomato THANKS!
Utilization of Genomic Information to Accelerate Soybean Breeding and Product Development through Marker Assisted Selection
Utilization of Genomic Information to Accelerate Soybean Breeding and Product Development through Marker Assisted Selection Presented by: Ruth Wagner August 5, 2014 SOY2014 Rico Caldo,Vergel Concibido,
More informationGenetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection
Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection Awais Khan Adaptation and Abiotic Stress Genetics, Potato and sweetpotato International Potato
More informationKey access and utilization descriptors for cowpea genetic resources
Key access and utilization descriptors for cowpea genetic resources This list consists of an initial set of characterization and evaluation descriptors for cowpea [Vigna unguiculata (L.) Walp.] genetic
More informationA brief introduction to Marker-Assisted Breeding. a BASF Plant Science Company
A brief introduction to Marker-Assisted Breeding a BASF Plant Science Company Gene Expression DNA is stored in chromosomes within the nucleus of each cell RNA Cell Chromosome Gene Isoleucin Proline Valine
More informationGENETICS - CLUTCH CH.20 QUANTITATIVE GENETICS.
!! www.clutchprep.com CONCEPT: MATHMATICAL MEASRUMENTS Common statistical measurements are used in genetics to phenotypes The mean is an average of values - A population is all individuals within the group
More informationAdvanced Plant Technology Program Vocabulary
Advanced Plant Technology Program Vocabulary A Below you ll find a list of words (and their simplified definitions) that our researchers use on a daily basis. Abiotic stress (noun): Stress brought on by
More informationStrategies for Funding Problem Solving Research on the Alliums. Michael J. Havey USDA-ARS and University of Wisconsin
Strategies for Funding Problem Solving Research on the Alliums Michael J. Havey USDA-ARS and University of Wisconsin USDA-NIFA Specialty Crops Research Initiative (SCRI) USDA Specialty Crops Research Initiative
More informationApplying next-generation sequencing to enable marker-assisted breeding for adaptive traits in a homegrown haricot bean (Phaseolus vulgaris L.
Applying next-generation sequencing to enable marker-assisted breeding for adaptive traits in a homegrown haricot bean (Phaseolus vulgaris L.) Andrew Tock Prof Eric Holub & Dr Guy Barker University of
More information1/21/ Exploring Mendelian Genetics. What is the principle of independent assortment? Independent Assortment. Biology.
Biology 1 of 31 11-3 Exploring Mendelian Exploring Genetics Mendelian Genetics 2 of 31 What is the principle of independent assortment? 3 of 31 1 The principle of independent assortment states that genes
More informationGenetic and Molecular Characterization of Host-Plant Resistance to Root-knot Nematodes and Fusarium Wilt in Cotton
Genetic and Molecular Characterization of Host-Plant Resistance to Root-knot Nematodes and Fusarium Wilt in Cotton Phil Roberts & Congli Wang, Department of Nematology Univ. of California, Riverside Project
More informationHCS806 Summer 2010 Methods in Plant Biology: Breeding with Molecular Markers
HCS806 Summer 2010 Methods in Plant Biology: Breeding with Molecular Markers Lecture 7. Populations The foundation of any crop improvement program is built on populations. This session will explore population
More information11 3 Exploring Mendelian
11 3 Exploring Mendelian 11-3 Exploring Mendelian Genetics Genetics 2 of 31 What is the principle of independent assortment? 3 of 31 The principle of independent assortment states that genes for different
More informationConstruction of high-density linkage maps for mapping quantitative trait loci for multiple traits in field pea (Pisum sativum L.)
Gali et al. BMC Plant Biology (2018) 18:172 https://doi.org/10.1186/s12870-018-1368-4 RESEARCH ARTICLE Open Access Construction of high-density linkage maps for mapping quantitative trait loci for multiple
More informationImproving barley and wheat germplasm for changing environments
AWARD NUMBER: 2011-68002-30029 Improving barley and wheat germplasm for changing environments Triticeae CAP (T-CAP) 56 participants, 28 institutions, 21 states Integration of wheat and barley research
More informationGenetics. Ms. Gunjan M. Chaudhari
Genetics Ms. Gunjan M. Chaudhari UNIT 1 Introduction to genetics Genetics:: The scientific study of heredity Heredity : The passing on of characteristics (traits) from parents to offspring Importance of
More informationMAS refers to the use of DNA markers that are tightly-linked to target loci as a substitute for or to assist phenotypic screening.
Marker assisted selection in rice Introduction The development of DNA (or molecular) markers has irreversibly changed the disciplines of plant genetics and plant breeding. While there are several applications
More informationBiology Genetics Practice Quiz
Biology Genetics Practice Quiz Multiple Choice Identify the choice that best completes the statement or answers the question. 1. The table above shows information related to blood types. What genotype(s)
More informationMENDELIAN GENETICS This presentation contains copyrighted material under the educational fair use exemption to the U.S. copyright law.
MENDELIAN GENETICS This presentation contains copyrighted material under the educational fair use exemption to the U.S. copyright law. Gregor Mendel! 19 th century Austrian monk! Interested in heredity!
More informationKansas State University Pearl Millet Breeding Program Desalegn D. Serba
Kansas State University Pearl Millet Breeding Program Desalegn D. Serba Kansas State University Agricultural Research Center - Hays ddserba@ksu.edu Mission K-State agriculture research is geared towards
More informationTraditional Genetic Improvement. Genetic variation is due to differences in DNA sequence. Adding DNA sequence data to traditional breeding.
1 Introduction What is Genomic selection and how does it work? How can we best use DNA data in the selection of cattle? Mike Goddard 5/1/9 University of Melbourne and Victorian DPI of genomic selection
More informationUSDA Specialty Crops Research Initiative (SCRI)
USDA Specialty Crops Research Initiative (SCRI) USDA Specialty Crops Research Initiative (SCRI) THANKS TO YOU!!! Responding to listening sessions by federal agencies Providing information on specialty
More informationSynthetic wheat. an underutilized genetic resource in Nordic wheat breeding. Morten Lillemo, IPM, UMB
an underutilized genetic resource in Nordic wheat breeding Morten Lillemo, IPM, UMB 2111 2005 Wheat evolution There is a huge genetic diversity in Ae. tauschii Genetic diversity of bread wheat is low,
More informationHCS806 Summer 2010 Methods in Plant Biology: Breeding with Molecular Markers
HCS Summer Methods in Plant Biology: Breeding with Molecular Markers Lecture 1. This course, breeding with molecular markers, will examine the role of marker assisted selection or genome assisted selection
More informationLecture 3 Monohybrid and Dihybrid Crosses
THE MONOHYBRID CROSS Lecture 3 Monohybrid and Dihybrid Crosses FOLLOWING THE INHERITANCE OF ONE TRAIT Monohybrid cross Parents differ by a single trait. Crossing two pea plants that differ in stem size,
More informationSTANDER, l.r., Betaseed, Inc. P.O. Box 859, Kimberly, ID The relationship between biotechnology and classical plant breeding.
STANDER, l.r., Betaseed, Inc. P.O. Box 859, Kimberly, ID 83341. The relationship between biotechnology and classical plant breeding. Plant breeders have been relatively successful over the years. Duvick
More informationUnited States Department of Agriculture Final Report. Alfalfa and Forage Program. Departments Monteros Lab {NO DATA ENTERED}
Title: Root Traits to Enhance Nutrient and Water Use in Alfalfa Sponsoring Agency Funding Source Accession No. Project Start Date Reporting Period Start Date Submitted By NIFA Non Formula 1004474 09/01/2014
More informationGenetics Transcription Translation Replication
Genetics Transcription Translation Replication 1. Which statement best describes the relationship between an allele and a gene? A. An allele is a variation of a gene that can be expressed as a phenotype.
More informationGene Mapping in Natural Plant Populations Guilt by Association
Gene Mapping in Natural Plant Populations Guilt by Association Leif Skøt What is linkage disequilibrium? 12 Natural populations as a tool for gene mapping 13 Conclusion 15 POPULATIONS GUILT BY ASSOCIATION
More informationPulse Improvement: Chickpea and Field Pea. W. Erskine & T.N. Khan CLIMA/DAFWA
Pulse Improvement: Chickpea and Field Pea W. Erskine & T.N. Khan CLIMA/DAFWA Content Pulse (Field Pea & Chickpea) importance Chickpea Breeding aims Current approaches Future Field Pea Breeding aims Current
More informationDevelopment of Early Maturing GEM lines with Value Added Traits: Moving U.S. Corn Belt GEM Germplasm Northward
Development of Early Maturing GEM lines with Value Added Traits: Moving U.S. Corn Belt GEM Germplasm Northward Marcelo J. Carena Department of Plant Sciences, North Dakota State University (NDSU) I am
More informationTexas A&M AgriLife Research LOWER RIO GRANDE VALLEY REGION RESEARCH GOALS AND IMPACTS. Texas A&M AgriLife Research and Extension Center at Weslaco
Texas A&M AgriLife Research LOWER RIO GRANDE VALLEY REGION RESEARCH GOALS AND IMPACTS Texas A&M AgriLife Research and Extension Center at Weslaco 2015 GOAL Protect water quality and increase the amount
More informationMEHDI FARID PAGE 1 OF 5
MEHDI FARID PAGE 1 OF 5 MEHDI FARID BSc. Agronomy, MSc. Crop Physiology, Ph.D. Plant Breeding & Genetics AFNS Department, University of Alberta Edmonton, Alberta T6G 2R3 587-778-3139 mfarid@ualberta.ca
More informationCOMPARATIVE GENOME ANALYSIS AND RESISTANCE GENE MAPPING IN GRAIN LEGUMES
COMPARATIVE GENOME ANALYSIS AND RESISTANCE 847004 GENE MAPPING IN GRAIN LEGUMES N.D. YOUNG Department of Plant Pathology, University of Minnesota, St. Paul, Minnesota, United States of America Abstract
More informationDeveloping New GM Products and Detection Methods
Developing New GM Products and Detection Methods Dave Grothaus Monsanto Company Slides Thanks to: International Life Sciences Institute Crop Life International Indus try Colleagues Hope Hart - Syngenta
More informationBLACKEYE VARIETAL IMPROVEMENT PROGRESS REPORT. P. A. Roberts, B. L. Huynh, W. C. Matthews and C. A. Frate 1 ABSTRACT
BLACKEYE VARIETAL IMPROVEMENT - 2014 PROGRESS REPORT P. A. Roberts, B. L. Huynh, W. C. Matthews and C. A. Frate 1 ABSTRACT Our breeding program is developing improved blackeye beans for California growers.
More informationAssociation Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010
Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010 Traditional QTL approach Uses standard bi-parental mapping populations o F2 or RI These have a limited number of
More informationWatanabe, J. A., 1,2) M. Ikegawa 1,3), T. Yamada 1) & K. N. Watanabe 1,2)
Fishing Genes from germplasm: Cloning, testing and use of gene-like fragments associated with root-knot nematode resistance in tuber-bearing Solanum genetic resources Patent: WO03/080838 A1 Watanabe, J.
More informationSNPs - GWAS - eqtls. Sebastian Schmeier
SNPs - GWAS - eqtls s.schmeier@gmail.com http://sschmeier.github.io/bioinf-workshop/ 17.08.2015 Overview Single nucleotide polymorphism (refresh) SNPs effect on genes (refresh) Genome-wide association
More informationMendel and the gene. The theory of inheritance
Mendel and the gene The theory of inheritance Subject : (BT101) Department of Biotechnology National Institute of Technology Warangal The monk in the garden: Gregor Mendel Johann Gregor Mendel (1822 1884),
More informationGregor Mendel. Austrian Monk Worked with pea plants
Gregor Mendel Austrian Monk Worked with pea plants A. True Breeding Pea Plants Self pollinate and produce new plants genetically identical to themselves Mendel decides to cross pollinate the plants Offspring
More informationLECTURE 1 : GENETICS
LECTURE 1 : GENETICS Introduction to Genetics and heredity Gregor Mendel Genetic terminology (glossary) Monohybrid crosses Patterns of inheritance Dihybrid crosses Test cross Introduction to Genetics GENETICS
More informationBrassica carinata crop improvement & molecular tools for improving crop performance
Brassica carinata crop improvement & molecular tools for improving crop performance Germplasm screening Germplasm collection and diversity What has been done in the US to date, plans for future Genetic
More informationMapping and Mapping Populations
Mapping and Mapping Populations Types of mapping populations F 2 o Two F 1 individuals are intermated Backcross o Cross of a recurrent parent to a F 1 Recombinant Inbred Lines (RILs; F 2 -derived lines)
More informationMendelian & Non Mendelian Genetics. Copy Dr. M. A. Fouad
Mendelian & Non Mendelian Genetics Copy right @ Dr. M. A. Fouad Mendelian Genetics Mendel s Law of Austrian monk born in 1822 in monastery known for research and teaching after his death (1884) acknowledgment
More informationMendelian Genetics 1
Mendelian Genetics Genetics Mendel and the Gene Idea Genetics: The study of heredity. 2 Heredity Two possible explanations for heredity: The Blending Hypothesis Genetic material from the parents mix. Similar
More informationUC Davis Bean Breeding Program
UC Davis Bean Breeding Program: Garbanzos 2017 2018 Report to the California Dry Bean Advisory Board Researchers: A. Palkovic (Assistant Specialist), Kay Watt (Graduate student), P. Gepts (Principal Investigator)
More information2012 FFA CDE Agronomy Lab Practical
2012 FFA CDE Agronomy Lab Practical VEGETATIVE WEED ID 1. This weed is NUTRIENT DEFICIENCY 2. The yellowing (chlorosis) and dying (necrosis) along the margins on the leaves of this corn plant are typical
More informationUSWBSI Barley CP Milestone Matrix Updated
USWBSI Barley CP Milestone Matrix Updated 10-10-13 RA: Variety Development and Host Resistance (VDHR) CP Objective 2: Map Novel QTL for resistance to FHB in barley BS, KS Dec 2013 Make initial crosses
More informationScience to Support Plant Protection for Horticulture AAFC s Science & Technology Branch
Science to Support Plant Protection for Horticulture AAFC s Science & Technology Branch Crop, Plant Protection and the Environment Committee March 15, 2018 Dr. Della Johnston Outline Strategic direction
More informationTACKLING NEW CHALLENGES FOR EUROPEAN SORGHUM THROUGH GENETICS AND NEW BREEDING STRATEGIES
1 ST EUROPEAN SORGHUM CONGRESS WORKSHOP INNOVATIVE RESEARCH TOWARDS GENETIC PROGRESS TACKLING NEW CHALLENGES FOR EUROPEAN SORGHUM THROUGH GENETICS AND NEW BREEDING STRATEGIES OPTIMIZING GENETIC VALUE PREDICTION
More informationMarker types. Potato Association of America Frederiction August 9, Allen Van Deynze
Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering,
More informationTABLE OF CONTENTS. Abbreviations List of figures List of Tables Acknowledgements Abstract..1-2
TABLE OF CONTENTS Abbreviations List of figures List of Tables Acknowledgements Abstract..1-2 Chapter 1: Introduction and Review of literature......3-30 1.1. Introduction: Wheat 1.1.1. Economic importance
More informationUSDA-ARS/ U.S. Wheat and Barley Scab Initiative FY16 Final Performance Report Due date: July 28, USWBSI Individual Project(s) 7/26/2017
USDA-ARS/ U.S. Wheat and Barley Scab Initiative FY16 Final Performance Report Due date: July 28, 2017 Cover Page Principle Investigator (PI): Guihua Bai Institution: USDA-ARS E-mail: gbai@ksu.edu Phone:
More informationGenomics-based approaches to improve drought tolerance of crops
Review TRENDS in Plant Science Vol.11 No.8 Full text provided by www.sciencedirect.com Genomics-based approaches to improve drought tolerance of crops Roberto Tuberosa and Silvio Salvi Department of Agroenvironmental
More informationTEXAS A&M PLANT BREEDING BULLETIN
TEXAS A&M PLANT BREEDING BULLETIN June Our Mission: Educate and develop Plant Breeders worldwide Our Vision: Alleviate hunger and poverty through genetic improvement of plants Four outstanding plant breeding
More informationSolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze
SolCAP Solanaceae Coordinated Agricultural Project Supported by the National Research Initiative Plant Genome Program of USDA CSREES for the Improvement of Potato and Tomato Executive Commitee : David
More informationCSU Wheat Breeding and Genetics Program Update
CSU Wheat Breeding and Genetics Program Update Scott D. Haley CSU Wheat Breeder Soil and Crop Sciences Department Colorado State University Fort Collins, Colorado 80523 email - scott.haley@colostate.edu
More informationPlant Breeding as an integral part of Sustainable Agriculture
2 Plant Breeding as an integral part of Sustainable Agriculture Dr. Dirk Zimmermann Sustainable Agriculture Campaigner Greenpeace Germany International Cotton Conference, Bremen, 17.03.2016 dirk.zimmermann@greenpeace.de
More informationPublic-Private Partnership in Pre-Breeding
Public-Private Partnership in Pre-Breeding Combining Knowledge from Field and Laboratory for Pre-Breeding in Barley Ahmed Jahoor and Therese Bengtsson PPP barley field trial, Iceland 2012. Photo: Magnus
More informationExploring Mendelian Genetics. Dihybrid crosses. Dihybrid crosses
Objective 8: Predict the results of dihybrid genetic crosses by using Punnett squares Exploring Mendelian Genetics 11.3 Dihybrid cross--a cross that involves two pairs of contrasting traits. A cross between
More informationThe 150+ Tomato Genome (re-)sequence Project; Lessons Learned and Potential
The 150+ Tomato Genome (re-)sequence Project; Lessons Learned and Potential Applications Richard Finkers Researcher Plant Breeding, Wageningen UR Plant Breeding, P.O. Box 16, 6700 AA, Wageningen, The Netherlands,
More informationUsing molecular marker technology in studies on plant genetic diversity Final considerations
Using molecular marker technology in studies on plant genetic diversity Final considerations Copyright: IPGRI and Cornell University, 2003 Final considerations 1 Contents! When choosing a technique...!
More informationModule 1 Principles of plant breeding
Covered topics, Distance Learning course Plant Breeding M1-M5 V2.0 Dr. Jan-Kees Goud, Wageningen University & Research The five main modules consist of the following content: Module 1 Principles of plant
More informationNon Mendelian Genetics
Non Mendelian Genetics TEKS 6 Science concepts. The student knows the mechanisms of genetics, including the role of nucleic acids and the principles of Mendelian Genetics. The student is expected to: 6F
More informationGenetics & The Work of Mendel
Genetics & The Work of Mendel 2011-2012 Gregor Mendel Modern genetics began in the mid-1800s in an abbey garden, where a monk named Gregor Mendel documented inheritance in peas used experimental method
More informationGenetics Test. Multiple Choice Identify the choice that best completes the statement or answers the question.
Genetics Test Multiple Choice Identify the choice that best completes the statement or answers the question. 41. Situations in which one allele for a gene is not completely dominant over another allele
More informationFruit and Nut Trees Genomics and Quantitative Genetics
Fruit and Nut Trees Genomics and Quantitative Genetics Jasper Rees Department of Biotechnology University of the Western Cape South Africa jrees@uwc.ac.za The Challenges of Tree Breeding Long breeding
More informationKey access and utilization descriptors for faba bean genetic resources
Key access and utilization descriptors for faba bean genetic resources This list consists of an initial set of characterization and evaluation descriptors for faba bean utilization. This strategic set
More informationGenetics and Biotechnology. Section 1. Applied Genetics
Section 1 Applied Genetics Selective Breeding! The process by which desired traits of certain plants and animals are selected and passed on to their future generations is called selective breeding. Section
More informationCrop Science Society of America
Crop Science Society of America Grand Challenge Statements Crop science is a highly integrative science employing the disciplines of conventional plant breeding, transgenic crop improvement, plant physiology,
More informationMolecular and Applied Genetics
Molecular and Applied Genetics Ian King, Iain Donnison, Helen Ougham, Julie King and Sid Thomas Developing links between rice and the grasses 6 Gene isolation 7 Informatics 8 Statistics and multivariate
More informationOrchardgrass Breeding and Genetics. Joseph G. Robins B. Shaun Bushman Kevin B. Jensen. Forage and Range Research Laboratory
Orchardgrass Breeding and Genetics Forage and Range Research Laboratory Joseph G. Robins B. Shaun Bushman Kevin B. Jensen Orchardgrass Grazing Mechanical harvest Seed production FRRL orchardgrass improvement
More informationSection. Test Name: Cell Reproduction and Genetics Test Id: Date: 02/08/2018
Test Name: Cell Reproduction and Genetics Test Id: 308393 Date: 02/08/2018 Section 1. Gregor Mendel was an Austrian monk that observed the different colors of pea plants in his monestary. He discovered
More informationChapter 9. Objectives. Table of Contents. Gregor Mendel. Gregor Mendel, continued. Section 1 Mendel s Legacy. Section 2 Genetic Crosses
Fundamentals of Genetics Table of Contents Objectives Describe how Mendel was able to control how his pea plants were pollinated. Describe the steps in Mendel s experiments on true-breeding garden peas.
More informationUse of Biochemical and Molecular Techniques in the DUS Examination and Cooperation between Relevant International Organizations
ISTA Congress 2013 / Discussion Forum Discussion on the use and International standardization of DNA technologies in the area of seeds Use of Biochemical and Molecular Techniques in the DUS Examination
More informationFirst printing 2M, January 2000
14prlr First printing 2M, January 2000 Information contained herein is available to all persons regardless of race, color sex, or national origin. Kuell: A New Soybean Variety for Alabama D. B. WEAVER,
More informationCh. 14 Mendel and the Gene Idea
Ch. 14 Mendel and the Gene Idea 2006-2007 Gregor Mendel Modern genetics began in the mid-1800s in an abbey garden, where a monk named Gregor Mendel documented inheritance in peas used experimental method
More informationFundamentals of Genetics. 4. Name the 7 characteristics, giving both dominant and recessive forms of the pea plants, in Mendel s experiments.
Fundamentals of Genetics 1. What scientist is responsible for our study of heredity? 2. Define heredity. 3. What plant did Mendel use for his hereditary experiments? 4. Name the 7 characteristics, giving
More informationOuter. Last. Possible gamete combinations for parent 1: RY RY ry ry F (first) O (outer) I (inner) L (last)
Dihybrid Crosses Explained: Mendel s Law of Independent Assortment says that genes for different traits can segregate independently during the formation of gametes. What does that mean? It means that the
More informationDO NOT OPEN UNTIL TOLD TO START
DO NOT OPEN UNTIL TOLD TO START BIO 312, Section 1, Spring 2011 February 21, 2011 Exam 1 Name (print neatly) Instructor 7 digit student ID INSTRUCTIONS: 1. There are 11 pages to the exam. Make sure you
More information2005 North Central American Society of Agronomy
2005 North Central American Society of Agronomy Climbing Above the Yield Plateau March 16, 2005 Leon G. Streit, Ph.D. Senior Research Scientist Pioneer Hi-Bred International, Inc. Outline Soybean Yield
More informationDevelopment of SNP markers linked to the Downy Mildew Resistance Gene Pl 8 in Sunflower
Development of SNP markers linked to the Downy Mildew Resistance Gene Pl 8 in Sunflower Lili Qi 1, Zahirul Talukder 2 Brent Hulke 1, Michael Foley 1 1 USDA-ARS, Northern Crop Science Laboratory 2 NDSU,
More informationIntroduction to Genetics. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences
Introduction to Genetics DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences GENETICS Introduction to Genetics and heredity Gregor Mendel a brief bio Genetic terminology (glossary) Monohybrid
More informationGENETICS AND MENDEL 2/4/2018. Mendel s Experiment. Genetic Terms. Genetic Terms. Mendel: Experiment 1 HISTORY OF DISCOVERERY OF HEREDITY
HISTORY OF DISCOVERERY OF HEREDITY 1851: Gregor Mendel, father of heredity studied pea plants GENETICS AND MENDEL prevented self pollination used cross pollination brought experimental and quantitative
More informationABSTRACT : 162 IQUIRA E & BELZILE F*
ABSTRACT : 162 CHARACTERIZATION OF SOYBEAN ACCESSIONS FOR SCLEROTINIA STEM ROT RESISTANCE AND ASSOCIATION MAPPING OF QTLS USING A GENOTYPING BY SEQUENCING (GBS) APPROACH IQUIRA E & BELZILE F* Département
More informationUpdated sesame genome assembly and fine mapping of plant height and seed coat color QTLs using a new high-density genetic map
Wang et al. BMC Genomics (26) 7:3 DOI.86/s2864-5-236-4 RESEARCH ARTICLE Open Access Updated sesame genome assembly and fine mapping of plant height and seed coat color QTLs using a new high-density genetic
More informationWritten as per the revised syllabus prescribed by the Maharashtra State Board of Secondary and Higher Secondary Education, Pune.
Written as per the revised syllabus prescribed by the Maharashtra State Board of Secondary and Higher Secondary Education, Pune. Precise Biology I STD. XII Sci. Salient Features Concise coverage of syllabus
More informationMaize breeders decide which combination of traits and environments is needed to breed for both inbreds and hybrids. A trait controlled by genes that
Preface Plant breeding is a science of evolution. The scientific basis of plant breeding started in the 1900s. The rediscovery of Mendelian genetics and the development of the statistical concepts of randomization
More informationBTRY 7210: Topics in Quantitative Genomics and Genetics
BTRY 7210: Topics in Quantitative Genomics and Genetics Jason Mezey Biological Statistics and Computational Biology (BSCB) Department of Genetic Medicine jgm45@cornell.edu Spring 2015, Thurs.,12:20-1:10
More informationLab Mendelian Genetics-Exploring Genetic Probability -Revisiting Mendel s Observations
NAMES: (one packet per partner pair to be turned in) DATE: Lab Mendelian Genetics-Exploring Genetic -Revisiting Mendel s Observations Purpose: Students will 1. Learn that probability is strongly related
More informationUSDA-ARS/ U.S. Wheat and Barley Scab Initiative FY16 Final Performance Report Due date: July 28, USWBSI Individual Project(s)
USDA-ARS/ U.S. Wheat and Barley Scab Initiative Due date: July 28, 2017 Cover Page Principle Investigator (PI): Brian Steffenson Institution: University of Minnesota E-mail: bsteffen@umn.edu Phone: 612-325-4735
More informationBreeding Climate-Smart Cowpeas for West Africa
Breeding Climate-Smart Cowpeas for West Africa Phil Roberts University of California Riverside, USA Tim Close, Bao-Lam Huynh, Stefano Lonardi Maria Munoz-Amatriain, Steve Wanamaker UC Riverside Issa Drabo
More informationKeystone Biology Remediation B2: Genetics
Keystone Biology Remediation B2: Genetics Assessment Anchors: to describe and/or predict observed patterns of inheritance (i.e. dominant, recessive, codominance, incomplete dominance, sex-linked, polygenic,
More informationSelection and breeding process of the crops. Breeding of stacked GM products and unintended effects
Selection and breeding process of the crops. Breeding of stacked GM products and unintended effects Critical steps in plant transformation Getting the gene into the plant genome Getting the plant cell
More informationPart I: Predicting Genetic Outcomes
Part I: Predicting Genetic Outcomes Deoxyribonucleic acid (DNA) is found in every cell of living organisms, and all of the cells in each organism contain the exact same copy of that organism s DNA. Because
More informationIntrogression of shoot fly resistance QTLs into elite postrainy season sorghum varieties using Marker Assisted Backcrossing (MAB)
Introgression of shoot fly resistance QTLs into elite postrainy season sorghum varieties using Marker Assisted Backcrossing (MAB) Sunita Gorthy Research Scholar Sorghum breeding International Crops Research
More informationA Fresh Look at Field Pea Breeding. Dr Garry Rosewarne Senior Research Scientist
A Fresh Look at Field Pea Breeding Dr Garry Rosewarne Senior Research Scientist Outline Field Pea Breeding in Australia Breeding approach Yield progression Modern statistical analysis Alternative Breeding
More informationEnhancing Water Use Efficiency in Corn. Michael Luethy Jacqueline Heard March 5, 2007
Enhancing Water Use Efficiency in Corn Michael Luethy Jacqueline Heard March 5, 2007 Impact of drought on maize yield Blister Dough Early vegetative Late vegetative Pollination Grain fill 5-10 % 10-25%
More informationVEGETATIVE WEED ID. 1. This weed is
VEGETATIVE WEED ID 1. This weed is NUTRIENT DEFICIENCY 2. The interveinal chlorosis on the upper leaves is typical of the following nutrient deficiency: A) Nitrogen B) Potassium C) Phosphorus D) Iron E)
More informationI.1 The Principle: Identification and Application of Molecular Markers
I.1 The Principle: Identification and Application of Molecular Markers P. Langridge and K. Chalmers 1 1 Introduction Plant breeding is based around the identification and utilisation of genetic variation.
More information