Cowpea Breeding. Ainong Shi. University of Arkansas

Size: px
Start display at page:

Download "Cowpea Breeding. Ainong Shi. University of Arkansas"

Transcription

1 Cowpea Breeding Ainong Shi University of Arkansas

2 UAF Vegetable Breeding UAF AR USA International Collaboration Classic Breeding Molecular Breeding Student Training Classic breeding such as crossing, generation advanced, and variety development Molecular breeding technology including QTL analysis, SNP discovery and genotyping, nextgeneration sequencing such as GBS, and how to use bioinformatics tools in breeding program HORT6033 Genetic Techniques in Plant Breeding (Even years, Fa) Molecular Plant Breeding Focus Greenhouse High tunnel Potential Cowpea Spinach Dandelion Chicory Collard Kale Cucumber Tomato

3 Classic Breeding Main Street Molecular breeding Plant Breeding Approach Abiotic and biotic resistance breeding (disease/pest resistance, drought and salt tolerance) P 1 x P 1 x P 2 F 1 F 2 F 3 F 4-5 F 6-7 F 8-10 Parent selection Predictive breeding True/false, self testing BC 1 F 1 Visual selection MAS for simple traits Preliminary Intermediate MAS for quantitative traits Backcross breeding Cultivar variety Release Final Yield Test Marker-assisted selection (MAS) Genome-wide selection (GWS) Marker-assisted backcross breeding (MABB) QTL-based and genome-wide predictive breeding Genotyping by sequencing (GBS) SNP discovery and validation QTL mapping and association analysis Candidate gene identified and clone

4 Cowpea Breeding Program in UAF Classic Breeding Molecular Breeding Objective of the project is to merge molecular breeding into classic breeding with added Genotyping by Sequencing (GBS) and SNP platform through marker assisted selection (MAS) to speed up cowpea breeding and to develop high yield varieties with abiotic and biotic stress tolerance and colorful seeds.

5 Classic Breeding of Cowpea Over 50 years history Released more than 12 varieties Over advanced lines Emphasized improved plant architecture, earliness, concentrated flowering and fruiting, and upright and bushtype cultivars Various mature seed pattern and pattern color such as blackeye, pinkeye, and red holstein, and various seed coat color such as black, cream, green, pink, red tan, and yellow cowpea

6 UAF Cowpea Varieties Erect Set Cream seed and white pod Comment: cowpea (Southern pea) varieties credited to Dr. Teddy Morelock and Mr. Dennis Motes!)

7

8 UAF Cowpea Varieties Pinkeye seed white pod

9 UAF Cowpea Varieties Early Scarlet Encore Pinkeye seed and purple pod

10 UAF Cowpea Varieties Excel Select Blackeye seed and purple pod

11 UAF Cowpea Varieties

12 UAF Cowpea Varieties Epoch

13

14

15 Cowpea seed coat color and pattern

16

17 Molecular Breeding of Cowpea Build genotyping by sequencing (GBS) and SNP platform: Discover genome-wide SNP Analyze cowpea genetic diversity Conduct genome-wide association and identify SNP markers for agronomic traits, morphologic traits, abiotic and biotic tolerance, and seed protein and sugar content Develop a SNP set for cowpea variety identification

18 Single Nucleotide Polymorphism (SNP) L1011 L1102 L1232 L3130 AAGTAGCTACGAGGTTAGTAAGCAAT AAGTAGCTACGAGGTTAGTAAGCAAT AAGTAGCTACGACGTTAGTAAGCAAT AAGTAGCTACGACGTTAGTAAGCAAT L1011 G M1102 G M1232 C L3130 C

19 Genotyping by Sequencing (GBS) ION PGM ION Proton HiSeq 2000 Illuminia

20 Genotyping by Sequencing (GBS)

21 Traits interests for cowpea breeding and genetics: Agronomic traits: grain (seed) yield and forage (leave) yield, 100-seed weight and seed size, maturity day, and processing quality such as seed coat and recovery % imbedded Morphologic traits: o Plant habit (erect, semiprostrate, prostrate) o Dry pod color [straw, green, purple, black, speckled, variable (inconsistent or changeable), mixed (two or more colors), brown] o Pod placement (above foliage, foliage level, below foliage, and mixed) o Mature seed pattern [eye, solid, speckled (small spots), mottled (large spots), holstein (large patch), saddle-eye, variable (inconsistent or changeable), mixed (two or more patterns)] o Pod position [erect, intermediate (30 to 60 degree) angle, pendant, mixed (two or more pod positions)] o Seed pattern color [black, brown, blue, green, grey, mixed (two or more colors), purple, red, tan, variable, white (cream), yellow] o Primary seed coat color [black, brown, blue, green, grey, mixed (two or more colors), purple, red tan, variable, white (cream), yellow] o Seed shape [crowder, seed flat on both ends, semicrowder, seed flat on one end and rounded on other noncrowder, seed rounded on both ends, mixed (two or more shapes)], o Seed texture (rough, smooth, wrinkled, mixed (two or more textures)] Abio- and biotic (disease and pest) resistance/tolerance: Images from CPMV google search o Cowpea wilt (Fusarium oxysporum f. sp. tracheiphilum) resistance o Cowpea Mosaic Virus resistance (CPMV) o Cowpea bacterial blight (CBB) resistance CBB o Cowpea aphid tolerance o Root-knot nematode (RKN, Meloidogyne spp.) tolerance Cowpea Wilt o Iron deficiency chlorosis (IDC) and low phosphorus efficiency Aphid o Salt, drought, and heat tolerance Seed protein and sugar content RKN

22 Genome-wide SNP discovery in cowpea using GBS Cowpea germplasm DNA extraction Genotyping by Sequencing Data Analysis SNP Discovery Plant materials: 730 cowpea genotypes including cultivars released in U.S., USDA accessions consisted of 54 countries, and advanced Arkansas breeding lines DNA extraction: genomic DNA is extracted from dried leaves using the CTAB Sequencing: DNA sequencing using GBS by HiSeq 2000/2050 in BGI SNP discovery: GBS data analysis using DNASTAR Lasergene Genomics Suite, TASSEL Result: about a million SNPs were postulated from the GBS data of the 730 cowpea germplasm by de novo assembly

23 QTL mapping and association analysis in cowpea Agronomic traits: grain and forage yield 100-seed weight maturity day Morphologic traits: Plant habit Dry pod color Pod placement Mature seed pattern Pod position Seed pattern seed coat color Seed shape Abio- and biotic tolerance: Cowpea wilt CPMV Bacterial blight aphid RKN IDC Low phosphorus efficiency Salt Drought Heat Seed protein and sugar content Phenotypic Data QTL Mapping Donor Screening Population Development Data Analysis Marker Identification Marker Implementation Genotypic Data Association Analysis Molecular Breeding using GBS / 60K SNP chip

24 SNP Markers for Cowpea Bacterial Blight Resistance Three QTLs, CoBB1, CoBB2, and CoBB3, were reported to be linked to CoBB resistance on linkage group LG3, LG5 and LG9 of cowpea (Agbicodo et al. 2010). CP02_ Two SNP markers, CP08_ and CP02_ were identified to be associated with CoBB resistance located at the same regions of CoBB1 and CoBB2, respectively. The accuracy of selecting resistance lines was 86.7% based on the data of 201 cowpea lines from this study. SNP Soy Pos CP02_ Gm02 50,192,757 CP08_ Gm08 5,433,936 1_0037 Gm02 45,862,359 1_0853 Gm08 3,450,676 CP08_ Agbicodo et al Euphytica 175: SNP 1_0183 Gm08 4,014,465 Beneficial allele Unbeneficial allele R 2 (%) Total line CP02_ TT CC CP08_ AA GG Combination [TT][AA] [CC][GG]

25 Vegetable Breeding and Genetics in University of Arkansas Cowpea (Southern peas) Spinach Dandelion Kale Cucumber Tomato THANKS!

Utilization of Genomic Information to Accelerate Soybean Breeding and Product Development through Marker Assisted Selection

Utilization of Genomic Information to Accelerate Soybean Breeding and Product Development through Marker Assisted Selection Utilization of Genomic Information to Accelerate Soybean Breeding and Product Development through Marker Assisted Selection Presented by: Ruth Wagner August 5, 2014 SOY2014 Rico Caldo,Vergel Concibido,

More information

Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection

Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection Awais Khan Adaptation and Abiotic Stress Genetics, Potato and sweetpotato International Potato

More information

Key access and utilization descriptors for cowpea genetic resources

Key access and utilization descriptors for cowpea genetic resources Key access and utilization descriptors for cowpea genetic resources This list consists of an initial set of characterization and evaluation descriptors for cowpea [Vigna unguiculata (L.) Walp.] genetic

More information

A brief introduction to Marker-Assisted Breeding. a BASF Plant Science Company

A brief introduction to Marker-Assisted Breeding. a BASF Plant Science Company A brief introduction to Marker-Assisted Breeding a BASF Plant Science Company Gene Expression DNA is stored in chromosomes within the nucleus of each cell RNA Cell Chromosome Gene Isoleucin Proline Valine

More information

GENETICS - CLUTCH CH.20 QUANTITATIVE GENETICS.

GENETICS - CLUTCH CH.20 QUANTITATIVE GENETICS. !! www.clutchprep.com CONCEPT: MATHMATICAL MEASRUMENTS Common statistical measurements are used in genetics to phenotypes The mean is an average of values - A population is all individuals within the group

More information

Advanced Plant Technology Program Vocabulary

Advanced Plant Technology Program Vocabulary Advanced Plant Technology Program Vocabulary A Below you ll find a list of words (and their simplified definitions) that our researchers use on a daily basis. Abiotic stress (noun): Stress brought on by

More information

Strategies for Funding Problem Solving Research on the Alliums. Michael J. Havey USDA-ARS and University of Wisconsin

Strategies for Funding Problem Solving Research on the Alliums. Michael J. Havey USDA-ARS and University of Wisconsin Strategies for Funding Problem Solving Research on the Alliums Michael J. Havey USDA-ARS and University of Wisconsin USDA-NIFA Specialty Crops Research Initiative (SCRI) USDA Specialty Crops Research Initiative

More information

Applying next-generation sequencing to enable marker-assisted breeding for adaptive traits in a homegrown haricot bean (Phaseolus vulgaris L.

Applying next-generation sequencing to enable marker-assisted breeding for adaptive traits in a homegrown haricot bean (Phaseolus vulgaris L. Applying next-generation sequencing to enable marker-assisted breeding for adaptive traits in a homegrown haricot bean (Phaseolus vulgaris L.) Andrew Tock Prof Eric Holub & Dr Guy Barker University of

More information

1/21/ Exploring Mendelian Genetics. What is the principle of independent assortment? Independent Assortment. Biology.

1/21/ Exploring Mendelian Genetics. What is the principle of independent assortment? Independent Assortment. Biology. Biology 1 of 31 11-3 Exploring Mendelian Exploring Genetics Mendelian Genetics 2 of 31 What is the principle of independent assortment? 3 of 31 1 The principle of independent assortment states that genes

More information

Genetic and Molecular Characterization of Host-Plant Resistance to Root-knot Nematodes and Fusarium Wilt in Cotton

Genetic and Molecular Characterization of Host-Plant Resistance to Root-knot Nematodes and Fusarium Wilt in Cotton Genetic and Molecular Characterization of Host-Plant Resistance to Root-knot Nematodes and Fusarium Wilt in Cotton Phil Roberts & Congli Wang, Department of Nematology Univ. of California, Riverside Project

More information

HCS806 Summer 2010 Methods in Plant Biology: Breeding with Molecular Markers

HCS806 Summer 2010 Methods in Plant Biology: Breeding with Molecular Markers HCS806 Summer 2010 Methods in Plant Biology: Breeding with Molecular Markers Lecture 7. Populations The foundation of any crop improvement program is built on populations. This session will explore population

More information

11 3 Exploring Mendelian

11 3 Exploring Mendelian 11 3 Exploring Mendelian 11-3 Exploring Mendelian Genetics Genetics 2 of 31 What is the principle of independent assortment? 3 of 31 The principle of independent assortment states that genes for different

More information

Construction of high-density linkage maps for mapping quantitative trait loci for multiple traits in field pea (Pisum sativum L.)

Construction of high-density linkage maps for mapping quantitative trait loci for multiple traits in field pea (Pisum sativum L.) Gali et al. BMC Plant Biology (2018) 18:172 https://doi.org/10.1186/s12870-018-1368-4 RESEARCH ARTICLE Open Access Construction of high-density linkage maps for mapping quantitative trait loci for multiple

More information

Improving barley and wheat germplasm for changing environments

Improving barley and wheat germplasm for changing environments AWARD NUMBER: 2011-68002-30029 Improving barley and wheat germplasm for changing environments Triticeae CAP (T-CAP) 56 participants, 28 institutions, 21 states Integration of wheat and barley research

More information

Genetics. Ms. Gunjan M. Chaudhari

Genetics. Ms. Gunjan M. Chaudhari Genetics Ms. Gunjan M. Chaudhari UNIT 1 Introduction to genetics Genetics:: The scientific study of heredity Heredity : The passing on of characteristics (traits) from parents to offspring Importance of

More information

MAS refers to the use of DNA markers that are tightly-linked to target loci as a substitute for or to assist phenotypic screening.

MAS refers to the use of DNA markers that are tightly-linked to target loci as a substitute for or to assist phenotypic screening. Marker assisted selection in rice Introduction The development of DNA (or molecular) markers has irreversibly changed the disciplines of plant genetics and plant breeding. While there are several applications

More information

Biology Genetics Practice Quiz

Biology Genetics Practice Quiz Biology Genetics Practice Quiz Multiple Choice Identify the choice that best completes the statement or answers the question. 1. The table above shows information related to blood types. What genotype(s)

More information

MENDELIAN GENETICS This presentation contains copyrighted material under the educational fair use exemption to the U.S. copyright law.

MENDELIAN GENETICS This presentation contains copyrighted material under the educational fair use exemption to the U.S. copyright law. MENDELIAN GENETICS This presentation contains copyrighted material under the educational fair use exemption to the U.S. copyright law. Gregor Mendel! 19 th century Austrian monk! Interested in heredity!

More information

Kansas State University Pearl Millet Breeding Program Desalegn D. Serba

Kansas State University Pearl Millet Breeding Program Desalegn D. Serba Kansas State University Pearl Millet Breeding Program Desalegn D. Serba Kansas State University Agricultural Research Center - Hays ddserba@ksu.edu Mission K-State agriculture research is geared towards

More information

Traditional Genetic Improvement. Genetic variation is due to differences in DNA sequence. Adding DNA sequence data to traditional breeding.

Traditional Genetic Improvement. Genetic variation is due to differences in DNA sequence. Adding DNA sequence data to traditional breeding. 1 Introduction What is Genomic selection and how does it work? How can we best use DNA data in the selection of cattle? Mike Goddard 5/1/9 University of Melbourne and Victorian DPI of genomic selection

More information

USDA Specialty Crops Research Initiative (SCRI)

USDA Specialty Crops Research Initiative (SCRI) USDA Specialty Crops Research Initiative (SCRI) USDA Specialty Crops Research Initiative (SCRI) THANKS TO YOU!!! Responding to listening sessions by federal agencies Providing information on specialty

More information

Synthetic wheat. an underutilized genetic resource in Nordic wheat breeding. Morten Lillemo, IPM, UMB

Synthetic wheat. an underutilized genetic resource in Nordic wheat breeding. Morten Lillemo, IPM, UMB an underutilized genetic resource in Nordic wheat breeding Morten Lillemo, IPM, UMB 2111 2005 Wheat evolution There is a huge genetic diversity in Ae. tauschii Genetic diversity of bread wheat is low,

More information

HCS806 Summer 2010 Methods in Plant Biology: Breeding with Molecular Markers

HCS806 Summer 2010 Methods in Plant Biology: Breeding with Molecular Markers HCS Summer Methods in Plant Biology: Breeding with Molecular Markers Lecture 1. This course, breeding with molecular markers, will examine the role of marker assisted selection or genome assisted selection

More information

Lecture 3 Monohybrid and Dihybrid Crosses

Lecture 3 Monohybrid and Dihybrid Crosses THE MONOHYBRID CROSS Lecture 3 Monohybrid and Dihybrid Crosses FOLLOWING THE INHERITANCE OF ONE TRAIT Monohybrid cross Parents differ by a single trait. Crossing two pea plants that differ in stem size,

More information

STANDER, l.r., Betaseed, Inc. P.O. Box 859, Kimberly, ID The relationship between biotechnology and classical plant breeding.

STANDER, l.r., Betaseed, Inc. P.O. Box 859, Kimberly, ID The relationship between biotechnology and classical plant breeding. STANDER, l.r., Betaseed, Inc. P.O. Box 859, Kimberly, ID 83341. The relationship between biotechnology and classical plant breeding. Plant breeders have been relatively successful over the years. Duvick

More information

United States Department of Agriculture Final Report. Alfalfa and Forage Program. Departments Monteros Lab {NO DATA ENTERED}

United States Department of Agriculture Final Report. Alfalfa and Forage Program. Departments Monteros Lab {NO DATA ENTERED} Title: Root Traits to Enhance Nutrient and Water Use in Alfalfa Sponsoring Agency Funding Source Accession No. Project Start Date Reporting Period Start Date Submitted By NIFA Non Formula 1004474 09/01/2014

More information

Genetics Transcription Translation Replication

Genetics Transcription Translation Replication Genetics Transcription Translation Replication 1. Which statement best describes the relationship between an allele and a gene? A. An allele is a variation of a gene that can be expressed as a phenotype.

More information

Gene Mapping in Natural Plant Populations Guilt by Association

Gene Mapping in Natural Plant Populations Guilt by Association Gene Mapping in Natural Plant Populations Guilt by Association Leif Skøt What is linkage disequilibrium? 12 Natural populations as a tool for gene mapping 13 Conclusion 15 POPULATIONS GUILT BY ASSOCIATION

More information

Pulse Improvement: Chickpea and Field Pea. W. Erskine & T.N. Khan CLIMA/DAFWA

Pulse Improvement: Chickpea and Field Pea. W. Erskine & T.N. Khan CLIMA/DAFWA Pulse Improvement: Chickpea and Field Pea W. Erskine & T.N. Khan CLIMA/DAFWA Content Pulse (Field Pea & Chickpea) importance Chickpea Breeding aims Current approaches Future Field Pea Breeding aims Current

More information

Development of Early Maturing GEM lines with Value Added Traits: Moving U.S. Corn Belt GEM Germplasm Northward

Development of Early Maturing GEM lines with Value Added Traits: Moving U.S. Corn Belt GEM Germplasm Northward Development of Early Maturing GEM lines with Value Added Traits: Moving U.S. Corn Belt GEM Germplasm Northward Marcelo J. Carena Department of Plant Sciences, North Dakota State University (NDSU) I am

More information

Texas A&M AgriLife Research LOWER RIO GRANDE VALLEY REGION RESEARCH GOALS AND IMPACTS. Texas A&M AgriLife Research and Extension Center at Weslaco

Texas A&M AgriLife Research LOWER RIO GRANDE VALLEY REGION RESEARCH GOALS AND IMPACTS. Texas A&M AgriLife Research and Extension Center at Weslaco Texas A&M AgriLife Research LOWER RIO GRANDE VALLEY REGION RESEARCH GOALS AND IMPACTS Texas A&M AgriLife Research and Extension Center at Weslaco 2015 GOAL Protect water quality and increase the amount

More information

MEHDI FARID PAGE 1 OF 5

MEHDI FARID PAGE 1 OF 5 MEHDI FARID PAGE 1 OF 5 MEHDI FARID BSc. Agronomy, MSc. Crop Physiology, Ph.D. Plant Breeding & Genetics AFNS Department, University of Alberta Edmonton, Alberta T6G 2R3 587-778-3139 mfarid@ualberta.ca

More information

COMPARATIVE GENOME ANALYSIS AND RESISTANCE GENE MAPPING IN GRAIN LEGUMES

COMPARATIVE GENOME ANALYSIS AND RESISTANCE GENE MAPPING IN GRAIN LEGUMES COMPARATIVE GENOME ANALYSIS AND RESISTANCE 847004 GENE MAPPING IN GRAIN LEGUMES N.D. YOUNG Department of Plant Pathology, University of Minnesota, St. Paul, Minnesota, United States of America Abstract

More information

Developing New GM Products and Detection Methods

Developing New GM Products and Detection Methods Developing New GM Products and Detection Methods Dave Grothaus Monsanto Company Slides Thanks to: International Life Sciences Institute Crop Life International Indus try Colleagues Hope Hart - Syngenta

More information

BLACKEYE VARIETAL IMPROVEMENT PROGRESS REPORT. P. A. Roberts, B. L. Huynh, W. C. Matthews and C. A. Frate 1 ABSTRACT

BLACKEYE VARIETAL IMPROVEMENT PROGRESS REPORT. P. A. Roberts, B. L. Huynh, W. C. Matthews and C. A. Frate 1 ABSTRACT BLACKEYE VARIETAL IMPROVEMENT - 2014 PROGRESS REPORT P. A. Roberts, B. L. Huynh, W. C. Matthews and C. A. Frate 1 ABSTRACT Our breeding program is developing improved blackeye beans for California growers.

More information

Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010

Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010 Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010 Traditional QTL approach Uses standard bi-parental mapping populations o F2 or RI These have a limited number of

More information

Watanabe, J. A., 1,2) M. Ikegawa 1,3), T. Yamada 1) & K. N. Watanabe 1,2)

Watanabe, J. A., 1,2) M. Ikegawa 1,3), T. Yamada 1) & K. N. Watanabe 1,2) Fishing Genes from germplasm: Cloning, testing and use of gene-like fragments associated with root-knot nematode resistance in tuber-bearing Solanum genetic resources Patent: WO03/080838 A1 Watanabe, J.

More information

SNPs - GWAS - eqtls. Sebastian Schmeier

SNPs - GWAS - eqtls. Sebastian Schmeier SNPs - GWAS - eqtls s.schmeier@gmail.com http://sschmeier.github.io/bioinf-workshop/ 17.08.2015 Overview Single nucleotide polymorphism (refresh) SNPs effect on genes (refresh) Genome-wide association

More information

Mendel and the gene. The theory of inheritance

Mendel and the gene. The theory of inheritance Mendel and the gene The theory of inheritance Subject : (BT101) Department of Biotechnology National Institute of Technology Warangal The monk in the garden: Gregor Mendel Johann Gregor Mendel (1822 1884),

More information

Gregor Mendel. Austrian Monk Worked with pea plants

Gregor Mendel. Austrian Monk Worked with pea plants Gregor Mendel Austrian Monk Worked with pea plants A. True Breeding Pea Plants Self pollinate and produce new plants genetically identical to themselves Mendel decides to cross pollinate the plants Offspring

More information

LECTURE 1 : GENETICS

LECTURE 1 : GENETICS LECTURE 1 : GENETICS Introduction to Genetics and heredity Gregor Mendel Genetic terminology (glossary) Monohybrid crosses Patterns of inheritance Dihybrid crosses Test cross Introduction to Genetics GENETICS

More information

Brassica carinata crop improvement & molecular tools for improving crop performance

Brassica carinata crop improvement & molecular tools for improving crop performance Brassica carinata crop improvement & molecular tools for improving crop performance Germplasm screening Germplasm collection and diversity What has been done in the US to date, plans for future Genetic

More information

Mapping and Mapping Populations

Mapping and Mapping Populations Mapping and Mapping Populations Types of mapping populations F 2 o Two F 1 individuals are intermated Backcross o Cross of a recurrent parent to a F 1 Recombinant Inbred Lines (RILs; F 2 -derived lines)

More information

Mendelian & Non Mendelian Genetics. Copy Dr. M. A. Fouad

Mendelian & Non Mendelian Genetics. Copy Dr. M. A. Fouad Mendelian & Non Mendelian Genetics Copy right @ Dr. M. A. Fouad Mendelian Genetics Mendel s Law of Austrian monk born in 1822 in monastery known for research and teaching after his death (1884) acknowledgment

More information

Mendelian Genetics 1

Mendelian Genetics 1 Mendelian Genetics Genetics Mendel and the Gene Idea Genetics: The study of heredity. 2 Heredity Two possible explanations for heredity: The Blending Hypothesis Genetic material from the parents mix. Similar

More information

UC Davis Bean Breeding Program

UC Davis Bean Breeding Program UC Davis Bean Breeding Program: Garbanzos 2017 2018 Report to the California Dry Bean Advisory Board Researchers: A. Palkovic (Assistant Specialist), Kay Watt (Graduate student), P. Gepts (Principal Investigator)

More information

2012 FFA CDE Agronomy Lab Practical

2012 FFA CDE Agronomy Lab Practical 2012 FFA CDE Agronomy Lab Practical VEGETATIVE WEED ID 1. This weed is NUTRIENT DEFICIENCY 2. The yellowing (chlorosis) and dying (necrosis) along the margins on the leaves of this corn plant are typical

More information

USWBSI Barley CP Milestone Matrix Updated

USWBSI Barley CP Milestone Matrix Updated USWBSI Barley CP Milestone Matrix Updated 10-10-13 RA: Variety Development and Host Resistance (VDHR) CP Objective 2: Map Novel QTL for resistance to FHB in barley BS, KS Dec 2013 Make initial crosses

More information

Science to Support Plant Protection for Horticulture AAFC s Science & Technology Branch

Science to Support Plant Protection for Horticulture AAFC s Science & Technology Branch Science to Support Plant Protection for Horticulture AAFC s Science & Technology Branch Crop, Plant Protection and the Environment Committee March 15, 2018 Dr. Della Johnston Outline Strategic direction

More information

TACKLING NEW CHALLENGES FOR EUROPEAN SORGHUM THROUGH GENETICS AND NEW BREEDING STRATEGIES

TACKLING NEW CHALLENGES FOR EUROPEAN SORGHUM THROUGH GENETICS AND NEW BREEDING STRATEGIES 1 ST EUROPEAN SORGHUM CONGRESS WORKSHOP INNOVATIVE RESEARCH TOWARDS GENETIC PROGRESS TACKLING NEW CHALLENGES FOR EUROPEAN SORGHUM THROUGH GENETICS AND NEW BREEDING STRATEGIES OPTIMIZING GENETIC VALUE PREDICTION

More information

Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze

Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering,

More information

TABLE OF CONTENTS. Abbreviations List of figures List of Tables Acknowledgements Abstract..1-2

TABLE OF CONTENTS. Abbreviations List of figures List of Tables Acknowledgements Abstract..1-2 TABLE OF CONTENTS Abbreviations List of figures List of Tables Acknowledgements Abstract..1-2 Chapter 1: Introduction and Review of literature......3-30 1.1. Introduction: Wheat 1.1.1. Economic importance

More information

USDA-ARS/ U.S. Wheat and Barley Scab Initiative FY16 Final Performance Report Due date: July 28, USWBSI Individual Project(s) 7/26/2017

USDA-ARS/ U.S. Wheat and Barley Scab Initiative FY16 Final Performance Report Due date: July 28, USWBSI Individual Project(s) 7/26/2017 USDA-ARS/ U.S. Wheat and Barley Scab Initiative FY16 Final Performance Report Due date: July 28, 2017 Cover Page Principle Investigator (PI): Guihua Bai Institution: USDA-ARS E-mail: gbai@ksu.edu Phone:

More information

Genomics-based approaches to improve drought tolerance of crops

Genomics-based approaches to improve drought tolerance of crops Review TRENDS in Plant Science Vol.11 No.8 Full text provided by www.sciencedirect.com Genomics-based approaches to improve drought tolerance of crops Roberto Tuberosa and Silvio Salvi Department of Agroenvironmental

More information

TEXAS A&M PLANT BREEDING BULLETIN

TEXAS A&M PLANT BREEDING BULLETIN TEXAS A&M PLANT BREEDING BULLETIN June Our Mission: Educate and develop Plant Breeders worldwide Our Vision: Alleviate hunger and poverty through genetic improvement of plants Four outstanding plant breeding

More information

SolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze

SolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze SolCAP Solanaceae Coordinated Agricultural Project Supported by the National Research Initiative Plant Genome Program of USDA CSREES for the Improvement of Potato and Tomato Executive Commitee : David

More information

CSU Wheat Breeding and Genetics Program Update

CSU Wheat Breeding and Genetics Program Update CSU Wheat Breeding and Genetics Program Update Scott D. Haley CSU Wheat Breeder Soil and Crop Sciences Department Colorado State University Fort Collins, Colorado 80523 email - scott.haley@colostate.edu

More information

Plant Breeding as an integral part of Sustainable Agriculture

Plant Breeding as an integral part of Sustainable Agriculture 2 Plant Breeding as an integral part of Sustainable Agriculture Dr. Dirk Zimmermann Sustainable Agriculture Campaigner Greenpeace Germany International Cotton Conference, Bremen, 17.03.2016 dirk.zimmermann@greenpeace.de

More information

Public-Private Partnership in Pre-Breeding

Public-Private Partnership in Pre-Breeding Public-Private Partnership in Pre-Breeding Combining Knowledge from Field and Laboratory for Pre-Breeding in Barley Ahmed Jahoor and Therese Bengtsson PPP barley field trial, Iceland 2012. Photo: Magnus

More information

Exploring Mendelian Genetics. Dihybrid crosses. Dihybrid crosses

Exploring Mendelian Genetics. Dihybrid crosses. Dihybrid crosses Objective 8: Predict the results of dihybrid genetic crosses by using Punnett squares Exploring Mendelian Genetics 11.3 Dihybrid cross--a cross that involves two pairs of contrasting traits. A cross between

More information

The 150+ Tomato Genome (re-)sequence Project; Lessons Learned and Potential

The 150+ Tomato Genome (re-)sequence Project; Lessons Learned and Potential The 150+ Tomato Genome (re-)sequence Project; Lessons Learned and Potential Applications Richard Finkers Researcher Plant Breeding, Wageningen UR Plant Breeding, P.O. Box 16, 6700 AA, Wageningen, The Netherlands,

More information

Using molecular marker technology in studies on plant genetic diversity Final considerations

Using molecular marker technology in studies on plant genetic diversity Final considerations Using molecular marker technology in studies on plant genetic diversity Final considerations Copyright: IPGRI and Cornell University, 2003 Final considerations 1 Contents! When choosing a technique...!

More information

Module 1 Principles of plant breeding

Module 1 Principles of plant breeding Covered topics, Distance Learning course Plant Breeding M1-M5 V2.0 Dr. Jan-Kees Goud, Wageningen University & Research The five main modules consist of the following content: Module 1 Principles of plant

More information

Non Mendelian Genetics

Non Mendelian Genetics Non Mendelian Genetics TEKS 6 Science concepts. The student knows the mechanisms of genetics, including the role of nucleic acids and the principles of Mendelian Genetics. The student is expected to: 6F

More information

Genetics & The Work of Mendel

Genetics & The Work of Mendel Genetics & The Work of Mendel 2011-2012 Gregor Mendel Modern genetics began in the mid-1800s in an abbey garden, where a monk named Gregor Mendel documented inheritance in peas used experimental method

More information

Genetics Test. Multiple Choice Identify the choice that best completes the statement or answers the question.

Genetics Test. Multiple Choice Identify the choice that best completes the statement or answers the question. Genetics Test Multiple Choice Identify the choice that best completes the statement or answers the question. 41. Situations in which one allele for a gene is not completely dominant over another allele

More information

Fruit and Nut Trees Genomics and Quantitative Genetics

Fruit and Nut Trees Genomics and Quantitative Genetics Fruit and Nut Trees Genomics and Quantitative Genetics Jasper Rees Department of Biotechnology University of the Western Cape South Africa jrees@uwc.ac.za The Challenges of Tree Breeding Long breeding

More information

Key access and utilization descriptors for faba bean genetic resources

Key access and utilization descriptors for faba bean genetic resources Key access and utilization descriptors for faba bean genetic resources This list consists of an initial set of characterization and evaluation descriptors for faba bean utilization. This strategic set

More information

Genetics and Biotechnology. Section 1. Applied Genetics

Genetics and Biotechnology. Section 1. Applied Genetics Section 1 Applied Genetics Selective Breeding! The process by which desired traits of certain plants and animals are selected and passed on to their future generations is called selective breeding. Section

More information

Crop Science Society of America

Crop Science Society of America Crop Science Society of America Grand Challenge Statements Crop science is a highly integrative science employing the disciplines of conventional plant breeding, transgenic crop improvement, plant physiology,

More information

Molecular and Applied Genetics

Molecular and Applied Genetics Molecular and Applied Genetics Ian King, Iain Donnison, Helen Ougham, Julie King and Sid Thomas Developing links between rice and the grasses 6 Gene isolation 7 Informatics 8 Statistics and multivariate

More information

Orchardgrass Breeding and Genetics. Joseph G. Robins B. Shaun Bushman Kevin B. Jensen. Forage and Range Research Laboratory

Orchardgrass Breeding and Genetics. Joseph G. Robins B. Shaun Bushman Kevin B. Jensen. Forage and Range Research Laboratory Orchardgrass Breeding and Genetics Forage and Range Research Laboratory Joseph G. Robins B. Shaun Bushman Kevin B. Jensen Orchardgrass Grazing Mechanical harvest Seed production FRRL orchardgrass improvement

More information

Section. Test Name: Cell Reproduction and Genetics Test Id: Date: 02/08/2018

Section. Test Name: Cell Reproduction and Genetics Test Id: Date: 02/08/2018 Test Name: Cell Reproduction and Genetics Test Id: 308393 Date: 02/08/2018 Section 1. Gregor Mendel was an Austrian monk that observed the different colors of pea plants in his monestary. He discovered

More information

Chapter 9. Objectives. Table of Contents. Gregor Mendel. Gregor Mendel, continued. Section 1 Mendel s Legacy. Section 2 Genetic Crosses

Chapter 9. Objectives. Table of Contents. Gregor Mendel. Gregor Mendel, continued. Section 1 Mendel s Legacy. Section 2 Genetic Crosses Fundamentals of Genetics Table of Contents Objectives Describe how Mendel was able to control how his pea plants were pollinated. Describe the steps in Mendel s experiments on true-breeding garden peas.

More information

Use of Biochemical and Molecular Techniques in the DUS Examination and Cooperation between Relevant International Organizations

Use of Biochemical and Molecular Techniques in the DUS Examination and Cooperation between Relevant International Organizations ISTA Congress 2013 / Discussion Forum Discussion on the use and International standardization of DNA technologies in the area of seeds Use of Biochemical and Molecular Techniques in the DUS Examination

More information

First printing 2M, January 2000

First printing 2M, January 2000 14prlr First printing 2M, January 2000 Information contained herein is available to all persons regardless of race, color sex, or national origin. Kuell: A New Soybean Variety for Alabama D. B. WEAVER,

More information

Ch. 14 Mendel and the Gene Idea

Ch. 14 Mendel and the Gene Idea Ch. 14 Mendel and the Gene Idea 2006-2007 Gregor Mendel Modern genetics began in the mid-1800s in an abbey garden, where a monk named Gregor Mendel documented inheritance in peas used experimental method

More information

Fundamentals of Genetics. 4. Name the 7 characteristics, giving both dominant and recessive forms of the pea plants, in Mendel s experiments.

Fundamentals of Genetics. 4. Name the 7 characteristics, giving both dominant and recessive forms of the pea plants, in Mendel s experiments. Fundamentals of Genetics 1. What scientist is responsible for our study of heredity? 2. Define heredity. 3. What plant did Mendel use for his hereditary experiments? 4. Name the 7 characteristics, giving

More information

Outer. Last. Possible gamete combinations for parent 1: RY RY ry ry F (first) O (outer) I (inner) L (last)

Outer. Last. Possible gamete combinations for parent 1: RY RY ry ry F (first) O (outer) I (inner) L (last) Dihybrid Crosses Explained: Mendel s Law of Independent Assortment says that genes for different traits can segregate independently during the formation of gametes. What does that mean? It means that the

More information

DO NOT OPEN UNTIL TOLD TO START

DO NOT OPEN UNTIL TOLD TO START DO NOT OPEN UNTIL TOLD TO START BIO 312, Section 1, Spring 2011 February 21, 2011 Exam 1 Name (print neatly) Instructor 7 digit student ID INSTRUCTIONS: 1. There are 11 pages to the exam. Make sure you

More information

2005 North Central American Society of Agronomy

2005 North Central American Society of Agronomy 2005 North Central American Society of Agronomy Climbing Above the Yield Plateau March 16, 2005 Leon G. Streit, Ph.D. Senior Research Scientist Pioneer Hi-Bred International, Inc. Outline Soybean Yield

More information

Development of SNP markers linked to the Downy Mildew Resistance Gene Pl 8 in Sunflower

Development of SNP markers linked to the Downy Mildew Resistance Gene Pl 8 in Sunflower Development of SNP markers linked to the Downy Mildew Resistance Gene Pl 8 in Sunflower Lili Qi 1, Zahirul Talukder 2 Brent Hulke 1, Michael Foley 1 1 USDA-ARS, Northern Crop Science Laboratory 2 NDSU,

More information

Introduction to Genetics. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences

Introduction to Genetics. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences Introduction to Genetics DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences GENETICS Introduction to Genetics and heredity Gregor Mendel a brief bio Genetic terminology (glossary) Monohybrid

More information

GENETICS AND MENDEL 2/4/2018. Mendel s Experiment. Genetic Terms. Genetic Terms. Mendel: Experiment 1 HISTORY OF DISCOVERERY OF HEREDITY

GENETICS AND MENDEL 2/4/2018. Mendel s Experiment. Genetic Terms. Genetic Terms. Mendel: Experiment 1 HISTORY OF DISCOVERERY OF HEREDITY HISTORY OF DISCOVERERY OF HEREDITY 1851: Gregor Mendel, father of heredity studied pea plants GENETICS AND MENDEL prevented self pollination used cross pollination brought experimental and quantitative

More information

ABSTRACT : 162 IQUIRA E & BELZILE F*

ABSTRACT : 162 IQUIRA E & BELZILE F* ABSTRACT : 162 CHARACTERIZATION OF SOYBEAN ACCESSIONS FOR SCLEROTINIA STEM ROT RESISTANCE AND ASSOCIATION MAPPING OF QTLS USING A GENOTYPING BY SEQUENCING (GBS) APPROACH IQUIRA E & BELZILE F* Département

More information

Updated sesame genome assembly and fine mapping of plant height and seed coat color QTLs using a new high-density genetic map

Updated sesame genome assembly and fine mapping of plant height and seed coat color QTLs using a new high-density genetic map Wang et al. BMC Genomics (26) 7:3 DOI.86/s2864-5-236-4 RESEARCH ARTICLE Open Access Updated sesame genome assembly and fine mapping of plant height and seed coat color QTLs using a new high-density genetic

More information

Written as per the revised syllabus prescribed by the Maharashtra State Board of Secondary and Higher Secondary Education, Pune.

Written as per the revised syllabus prescribed by the Maharashtra State Board of Secondary and Higher Secondary Education, Pune. Written as per the revised syllabus prescribed by the Maharashtra State Board of Secondary and Higher Secondary Education, Pune. Precise Biology I STD. XII Sci. Salient Features Concise coverage of syllabus

More information

Maize breeders decide which combination of traits and environments is needed to breed for both inbreds and hybrids. A trait controlled by genes that

Maize breeders decide which combination of traits and environments is needed to breed for both inbreds and hybrids. A trait controlled by genes that Preface Plant breeding is a science of evolution. The scientific basis of plant breeding started in the 1900s. The rediscovery of Mendelian genetics and the development of the statistical concepts of randomization

More information

BTRY 7210: Topics in Quantitative Genomics and Genetics

BTRY 7210: Topics in Quantitative Genomics and Genetics BTRY 7210: Topics in Quantitative Genomics and Genetics Jason Mezey Biological Statistics and Computational Biology (BSCB) Department of Genetic Medicine jgm45@cornell.edu Spring 2015, Thurs.,12:20-1:10

More information

Lab Mendelian Genetics-Exploring Genetic Probability -Revisiting Mendel s Observations

Lab Mendelian Genetics-Exploring Genetic Probability -Revisiting Mendel s Observations NAMES: (one packet per partner pair to be turned in) DATE: Lab Mendelian Genetics-Exploring Genetic -Revisiting Mendel s Observations Purpose: Students will 1. Learn that probability is strongly related

More information

USDA-ARS/ U.S. Wheat and Barley Scab Initiative FY16 Final Performance Report Due date: July 28, USWBSI Individual Project(s)

USDA-ARS/ U.S. Wheat and Barley Scab Initiative FY16 Final Performance Report Due date: July 28, USWBSI Individual Project(s) USDA-ARS/ U.S. Wheat and Barley Scab Initiative Due date: July 28, 2017 Cover Page Principle Investigator (PI): Brian Steffenson Institution: University of Minnesota E-mail: bsteffen@umn.edu Phone: 612-325-4735

More information

Breeding Climate-Smart Cowpeas for West Africa

Breeding Climate-Smart Cowpeas for West Africa Breeding Climate-Smart Cowpeas for West Africa Phil Roberts University of California Riverside, USA Tim Close, Bao-Lam Huynh, Stefano Lonardi Maria Munoz-Amatriain, Steve Wanamaker UC Riverside Issa Drabo

More information

Keystone Biology Remediation B2: Genetics

Keystone Biology Remediation B2: Genetics Keystone Biology Remediation B2: Genetics Assessment Anchors: to describe and/or predict observed patterns of inheritance (i.e. dominant, recessive, codominance, incomplete dominance, sex-linked, polygenic,

More information

Selection and breeding process of the crops. Breeding of stacked GM products and unintended effects

Selection and breeding process of the crops. Breeding of stacked GM products and unintended effects Selection and breeding process of the crops. Breeding of stacked GM products and unintended effects Critical steps in plant transformation Getting the gene into the plant genome Getting the plant cell

More information

Part I: Predicting Genetic Outcomes

Part I: Predicting Genetic Outcomes Part I: Predicting Genetic Outcomes Deoxyribonucleic acid (DNA) is found in every cell of living organisms, and all of the cells in each organism contain the exact same copy of that organism s DNA. Because

More information

Introgression of shoot fly resistance QTLs into elite postrainy season sorghum varieties using Marker Assisted Backcrossing (MAB)

Introgression of shoot fly resistance QTLs into elite postrainy season sorghum varieties using Marker Assisted Backcrossing (MAB) Introgression of shoot fly resistance QTLs into elite postrainy season sorghum varieties using Marker Assisted Backcrossing (MAB) Sunita Gorthy Research Scholar Sorghum breeding International Crops Research

More information

A Fresh Look at Field Pea Breeding. Dr Garry Rosewarne Senior Research Scientist

A Fresh Look at Field Pea Breeding. Dr Garry Rosewarne Senior Research Scientist A Fresh Look at Field Pea Breeding Dr Garry Rosewarne Senior Research Scientist Outline Field Pea Breeding in Australia Breeding approach Yield progression Modern statistical analysis Alternative Breeding

More information

Enhancing Water Use Efficiency in Corn. Michael Luethy Jacqueline Heard March 5, 2007

Enhancing Water Use Efficiency in Corn. Michael Luethy Jacqueline Heard March 5, 2007 Enhancing Water Use Efficiency in Corn Michael Luethy Jacqueline Heard March 5, 2007 Impact of drought on maize yield Blister Dough Early vegetative Late vegetative Pollination Grain fill 5-10 % 10-25%

More information

VEGETATIVE WEED ID. 1. This weed is

VEGETATIVE WEED ID. 1. This weed is VEGETATIVE WEED ID 1. This weed is NUTRIENT DEFICIENCY 2. The interveinal chlorosis on the upper leaves is typical of the following nutrient deficiency: A) Nitrogen B) Potassium C) Phosphorus D) Iron E)

More information

I.1 The Principle: Identification and Application of Molecular Markers

I.1 The Principle: Identification and Application of Molecular Markers I.1 The Principle: Identification and Application of Molecular Markers P. Langridge and K. Chalmers 1 1 Introduction Plant breeding is based around the identification and utilisation of genetic variation.

More information