Basic Steps of the DNA process

Size: px
Start display at page:

Download "Basic Steps of the DNA process"

Transcription

1 As time pasted technology has improve the methods of analyzing DNA. One of the first methods for the analysis of DNA is known as Restriction Fragment Length Polymorphism (RFLP). This technique analyzed variable number of tandem repeats which are highly polymorphic within certain regions of each individual. This technique had a very high power of discrimination per loci however it required a large amount of high quality DNA sample. As the polymerase chain reaction (PCR) was developed a new technique known as Short Tandem Repeat (STR) became the new standard for DNA analysis. PCR/STR has allowed the use or small and degraded DNA samples which has been a major breakthrough especially within the field of Forensics. Even though PCR/STR is the most common technique used today Y STR and mitochondrial DNA typing are new technologies that can often prove to be very valuable when dealing with certain type of cases. The multiplexing and automation of today s systems have a reduced the time, cost and invariably cemented its application in forensic science. Basic Steps of the DNA process

2 Restriction Fragment Length Polymorphism (RFLP): RFLP requires a restriction enzyme which cuts the DNA at a specific location. These fragments are then separated into their different sizes using an electrophoresis agarose gel. The smaller fragments travel much faster through the gel and hence appear further along the gel strip. The fragments are then fixed to a nylon membrane which is then labeled typically with a P 32 probe. This probe binds to only specific regions on the fragments. It must then be washed and exposed to X ray and photographic film. The result is a barcode like image which could be compared to known and size standards. Summary of the steps involve in RFLP Reference:

3 Polymerase Chain Reaction (PCR): PCR or Polymerase Chain Reaction was discovered by Kary Mullis in 1985 and is a way to copy a DNA molecule. This process is an enzyme type reaction which revolves around the conditions of the enzyme. Three stages to PCR 1. Denaturation this occurs with an increase of temperature where the weak hydrogen bonds are broken and the double strand DNA separates into two single strands. Temperature may vary according to enzyme and desired result (usually above 90 degrees) 2. Annealing Here the primers bind to the separated complement strands due to lowering of temperature to allow the DNA to recombine. The primers are added in excess to ensure that the primer binds and not the original DNA( 54 degrees) 3. Extension The polymerase add dntp s in the 5 to 3 direction. The primers are extended by addition of complementary bases (A,T, C, G) read from the 3 to 5 direction.(72 degrees). This process is repeated about 30 times which produce billions of copies of DNA which can then be used for STR analysis. For this reaction to take place you must have the right master mix which include; template DNA,dNTP s, primers and DNA polymerase(taq). There are six different components that are required for a PCR; 1. DNA Template this must be clean DNA that is no inhibitors. This may be cleaned with a gene clean silica matrix. Microcon 100 can also be used to help clean. May want to dilute sample if too concentrated to dilute inhibitors however may lose rare copy genes. 2. Primers usually bp should be universal so that it binds to the same sites on the DNA. They should also have a similar %G C as the target DNA. The concentration should be optimized for best results. 3. DNA polymerase this is the enzyme that drives the reaction. Must be chosen carefully depending on what you want to achieve. Beware of inhibitors which might degrade the proteases, denature them and block the active sites. 4. Magnesium This is required to activate the polymerase and must be optimized to the specific reaction. It is often affected by the template concentration, chelating agents(edta), dntp s, proteins and heavy metals. The magnesium should not be added in excess as it would reduce the fidelity of the enzyme. 5. Buffer mix & dntp s The buffer is specific to the enzyme that is being used and is optimized by adding magnesium. The dntp s are required for the base addition and are often present in equal amounts. It may be varied to reduce base stacking interactions, hydrogen bonding and the strand separation temperature

4 6. PCR Enhancing Reagents these compounds are added to the reaction to help increase the stability, lower temperatures and help make the process more selective. Common additives are DMSO, BSA, T4 gene protein32, Glycerol and Acetamide. Diagram Showing the steps involve in a PCR reaction Reference: Link to CRVirtualLab.html

5 Short Tandem Repeat (STR): Short Tandem Repeat is the term used to describe when a sequence of DNA within a specific region is repeated numerous times. These are often referred to as microsatellites. These repeat units are typically a few base pairs long and directly follow each other. In field of forensics the use of tetra nucleotide repeats are mostly used as it has significant advantages. Most of these repeat units are part of the noncoding or junk DNA and is very highly polymorphic. STR works by counting the number of times each repeat occurs within that specific area on the chromosome or loci. Example TTCCATTTGGAATGAATGAATGAATGAATGAATGATGAGTTTCAA We can see that the sequence ATGA is repeated six times within this particular location. These are what we refer to as short tandem repeats. Today with the ability to perform PCR reactions coupled with STR s forensic scientist are able to use very small or degraded DNA samples to obtain a full DNA or STR profile. Technology has also allowed for the use of different STR loci to be tested in the same reaction. This is known as multiplex STR analysis and can look up to 19 different loci at the same time. This provides a very high power of discrimination when looking at the probably of two same DNA profiles. The instruments today are mostly automated and most forensic laboratories couple the PCR STR to a capillary electrophoresis device to obtain an electropherogram or DNA picture. This is an electropherogram or PCR STR profile for an unknown sample. It could then be compared to known sample for a possible match.

6 Y STR : This technique looks at short tandem repeats located on only the Y chromosome which means that it can only be detected in males. It is inherited from your father which means that it is not as individual as normal STR analysis. Different members of your paternal family may have the same profile. So why use such analysis? This type of analysis can be most beneficial in cases of multiple male donors and mixtures (for example gang rapes) where normal STR analysis have difficulty in separating the multiple male in the sample mixture. Mitochondrial DNA (mtdna) Mitochondrial DNA is the female version of Y STR however mtdna occurs in a much higher concentration which means that the possibility of obtaining a profile is much higher. However this is not nucleic DNA and is inherited maternally. This type of analysis is often done on samples of hair and highly degraded samples, however is not very discriminative and may only give the maternal side of a profile. Example of how mtdna is inherited within a family tree

Genetic Fingerprinting

Genetic Fingerprinting Genetic Fingerprinting Introduction DA fingerprinting In the R & D sector: -involved mostly in helping to identify inherited disorders. In forensics: -identification of possible suspects involved in offences.

More information

Application of Biotechnology in DNA Fingerprinting and Forensic Analysis. Copyright 2009 Pearson Education, Inc.

Application of Biotechnology in DNA Fingerprinting and Forensic Analysis. Copyright 2009 Pearson Education, Inc. Application of Biotechnology in DNA Fingerprinting and Forensic Analysis Introduction to DNA Fingerprinting and Forensics Forensic science intersection of law and science Historic examples Early 1900s

More information

DNA Analysis Students will learn:

DNA Analysis Students will learn: DNA Analysis Students will learn: That DNA is a long-chain polymer found in nucleated cells, which contain genetic information. That DNA can be used to identify or clear potential suspects in crimes. How

More information

Polymerase Chain Reaction PCR

Polymerase Chain Reaction PCR Polymerase Chain Reaction PCR What is PCR? An in vitro process that detects, identifies, and copies (amplifies) a specific piece of DNA in a biological sample. Discovered by Dr. Kary Mullis in 1983. A

More information

Manipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.

Manipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules

More information

Genetic Identity. Steve Harris SPASH - Biotechnology

Genetic Identity. Steve Harris SPASH - Biotechnology Genetic Identity Steve Harris SPASH - Biotechnology Comparison of Organisms ORGANISM GENES BASE PAIRS Lambda Phage 40 50,000 E.coli 400 5,000,000 Yeast 13,000 15,000,000 Human 20,000 3,000,000,000 (3 billion)

More information

DNA. Shape = Double Helix (twisted ladder) The purpose of each cell having DNA is to have directions for the cell to make proteins

DNA. Shape = Double Helix (twisted ladder) The purpose of each cell having DNA is to have directions for the cell to make proteins DNA DNA Deoxyribo- Nucleic Acid Shape = Double Helix (twisted ladder) The purpose of each cell having DNA is to have directions for the cell to make proteins Parts = nucleotide 1. Sugar (deoxyribose) 2.

More information

Genetic Fingerprinting

Genetic Fingerprinting Genetic Fingerprinting Introduction DA fingerprinting In the R & D sector: -involved mostly in helping to identify inherited disorders. In forensics: -identification of possible suspects involved in offences.

More information

DNA FINGERPRINTING.

DNA FINGERPRINTING. DNA FINGERPRINTING http://news.bbc.co.uk/media/images/38250000/gif/_38250230_dna_generic300.gif DNA: Deoxyribonucleic Acid - biological equivalent of fingerprints - < 1% of nonviolent crimes yield DNA

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

Southern hybridization technique

Southern hybridization technique Southern hybridization technique DNA fingerprint analysis is based on the "Southern" hybridization technique. In this method: DNA fingerprinting, also termed DNA profile analysis is based on the use of

More information

Chapter 7 DNA Fingerprinting By the end of this chapter you will be able to:

Chapter 7 DNA Fingerprinting By the end of this chapter you will be able to: Chapter 7 DNA Fingerprinting By the end of this chapter you will be able to: explain how crime scene evidence is collected and processed to obtain DNA describe how radioactive probes are used in DNA fingerprinting

More information

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau 7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial

More information

DNA: THE INDISPENSIBLE FORENSIC SCIENCE TOOL

DNA: THE INDISPENSIBLE FORENSIC SCIENCE TOOL Chapter 9 DNA: THE INDISPENSIBLE TOOL By Richard Saferstein Upper Saddle River, NJ 07458 1 Chapter 9 DNA Fingerprinting By the end of this chapter you will be able to: explain how crime scene evidence

More information

January 07, (adenine, guanine, cytosine, thymine)

January 07, (adenine, guanine, cytosine, thymine) (adenine, guanine, cytosine, thymine) DNA at Work - DNA is used to make proteins - proteins are made by linking amino acids (there are 20 possible amino acids) - sequence of amino acids determines shape/function

More information

The Polymerase Chain Reaction. Chapter 6: Background

The Polymerase Chain Reaction. Chapter 6: Background The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for

More information

Restriction Enzymes (endonucleases)

Restriction Enzymes (endonucleases) In order to understand and eventually manipulate DNA (human or otherwise) an array of DNA technologies have been developed. Here are some of the tools: Restriction Enzymes (endonucleases) In order to manipulate

More information

DNA, or Deoxyribonucleic Acid, is the genetic material in our cells. No two people (except identical twins) have the

DNA, or Deoxyribonucleic Acid, is the genetic material in our cells. No two people (except identical twins) have the DNA, or Deoxyribonucleic Acid, is the genetic material in our cells. No two people (except identical twins) have the exact same DNA. DNA patterns from four sets of twins which are identical? DNA fingerprinting

More information

Recombinant DNA recombinant DNA DNA cloning gene cloning

Recombinant DNA recombinant DNA DNA cloning gene cloning DNA Technology Recombinant DNA In recombinant DNA, DNA from two different sources, often two species, are combined into the same DNA molecule. DNA cloning permits production of multiple copies of a specific

More information

Unit 4-DNA Analysis Review Guide

Unit 4-DNA Analysis Review Guide Name: KEY Match the term on the right with the definition on the left. Unit 4-DNA Analysis Review Guide 1. A procedure used to determine the order of the base pairs that make up a DNA molecule E 2. These

More information

Experiment (5): Polymerase Chain Reaction (PCR)

Experiment (5): Polymerase Chain Reaction (PCR) BCH361 [Practical] Experiment (5): Polymerase Chain Reaction (PCR) Aim: Amplification of a specific region on DNA. Primer design. Determine the parameters that may affect he specificity, fidelity and efficiency

More information

13-2 Manipulating DNA Slide 1 of 32

13-2 Manipulating DNA Slide 1 of 32 1 of 32 The Tools of Molecular Biology The Tools of Molecular Biology How do scientists make changes to DNA? Scientists use their knowledge of the structure of DNA and its chemical properties to study

More information

HOW MANY CATs? A DNA Profiling Simulation

HOW MANY CATs? A DNA Profiling Simulation HOW MANY CATs? A DNA Profiling Simulation Background Information 1. Structure of DNA Double helix Anti-parallel strands 4 Bases (A, C, G, and T) Complementary bases Template Strand 5 3 A T T G A C 3 T

More information

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY. !! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which

More information

RFLP s with VNTR analysis

RFLP s with VNTR analysis RFLP s with VNTR analysis The most powerful and awesome tool acquired by humans since the splitting of atoms The Time Magazine (U.S.A) INTRODUCTION DNA profiling (also called DNA testing, DNA typing, or

More information

PCR OPTIMIZATION AND TROUBLESHOOTING

PCR OPTIMIZATION AND TROUBLESHOOTING PCR OPTIMIZATION AND TROUBLESHOOTING Amplification of each DNA fragment can occur only under the defined conditions which are provided by a reaction mixture. If no positive PCR result can be obtained,

More information

Analysis in Forensic Science

Analysis in Forensic Science Chapter 16 Gene Cloning & DNA Analysis in Forensic Science 1. DNA analysis in identification of crime suspects 2. Studying kinship by DNA profiling 3. Sex identification by DNA analysis Forensic science

More information

Exploring Genetic Variation in a Caffeine Metabolism gene LAB TWO: POLYMERASE CHAIN REACTION

Exploring Genetic Variation in a Caffeine Metabolism gene LAB TWO: POLYMERASE CHAIN REACTION Exploring Genetic Variation in a Caffeine Metabolism gene LAB TWO: POLYMERASE CHAIN REACTION Purpose: In this laboratory, we will set up a polymerase chain reaction to amplify the region of the caffeine

More information

Introduction to some aspects of molecular genetics

Introduction to some aspects of molecular genetics Introduction to some aspects of molecular genetics Julius van der Werf (partly based on notes from Margaret Katz) University of New England, Armidale, Australia Genetic and Physical maps of the genome...

More information

The Polymerase Chain Reaction. Chapter 6: Background

The Polymerase Chain Reaction. Chapter 6: Background The Polymerase Chain Reaction Chapter 6: Background PCR Amplify= Polymerase Chain Reaction (PCR) Invented in 1984 Applications Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off

More information

Genomic Sequencing. Genomic Sequencing. Maj Gen (R) Suhaib Ahmed, HI (M)

Genomic Sequencing. Genomic Sequencing. Maj Gen (R) Suhaib Ahmed, HI (M) Maj Gen (R) Suhaib Ahmed, HI (M) The process of determining the sequence of an unknown DNA is called sequencing. There are many approaches for DNA sequencing. In the last couple of decades automated Sanger

More information

Generating Forensic DNA Profiles

Generating Forensic DNA Profiles Wright State University CORE Scholar Biological Sciences Faculty Publications Biological Sciences 12-2012 Generating Forensic DNA Profiles Dan E. Krane Wright State University - Main Campus, dan.krane@wright.edu

More information

..C C C T C A T T C A T T C A T T C A T T C A..

..C C C T C A T T C A T T C A T T C A T T C A.. Polymerase Chain Reaction Lab: a Forensic Application INTRODUCTION PCR (polymerase chain reaction) is a technique that scientists use to amplify particular segments of DNA. This process can produce large

More information

Report of Analyzing Short Tandem Repeats for Parentage Testing

Report of Analyzing Short Tandem Repeats for Parentage Testing 1 Alex Michael Tseng Department of Forensic Medicine, College of Medicine, National Taiwan University Report of Analyzing Short Tandem Repeats for Parentage Testing Introduction In the three billion letter

More information

Overview. Introduction

Overview. Introduction Genetics 101: Introduction Overview Important terminology DNA extraction, gel electrophoresis, PCR Allozymes (Protein electrophoresis) RFLP AFLP Sequencing Microsatellites SNPs Costs, Sample Collection

More information

What is DNA? Deoxyribonucleic Acid The inherited genetic material that makes us what we are

What is DNA? Deoxyribonucleic Acid The inherited genetic material that makes us what we are DNA Basic Genetics What is DNA? DNA is Deoxyribonucleic Acid The inherited genetic material that makes us what we are DNA in the Cell Human Genome ~3 billion base pairs of DNA 30,000-35,000 genes Population-each

More information

Biology Chapter 9 & Honors Biology Chapter 13. Frontiers Of Biotechnology

Biology Chapter 9 & Honors Biology Chapter 13. Frontiers Of Biotechnology Biology Chapter 9 & Honors Biology Chapter 13 Frontiers Of Biotechnology DNA TECHNOLOGY IS ABOUT: Manipulating DNA for man s purposes. It includes: cutting DNA, Gel Electrophoresis and Polymerase Chain

More information

Mutations during meiosis and germ line division lead to genetic variation between individuals

Mutations during meiosis and germ line division lead to genetic variation between individuals Mutations during meiosis and germ line division lead to genetic variation between individuals Types of mutations: point mutations indels (insertion/deletion) copy number variation structural rearrangements

More information

I. Gene Cloning & Recombinant DNA. Biotechnology: Figure 1: Restriction Enzyme Activity. Restriction Enzyme:

I. Gene Cloning & Recombinant DNA. Biotechnology: Figure 1: Restriction Enzyme Activity. Restriction Enzyme: I. Gene Cloning & Recombinant DNA Biotechnology: Figure 1: Restriction Enzyme Activity Restriction Enzyme: Most restriction enzymes recognize a single short base sequence, or Restriction Site. Restriction

More information

Polymerase Chain Reaction

Polymerase Chain Reaction Polymerase Chain Reaction Problem Suppose you have a patient with an infection or a heritable disease. You want to know which infection or disease it is and.. you want to know it fast and... from as little

More information

Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design

Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design The Polymerase Chain Reaction (PCR) is a powerful technique used for the amplification of a specific segment of a nucleic acid

More information

The Real CSI: Using DNA to Identify Criminals and Missing Persons

The Real CSI: Using DNA to Identify Criminals and Missing Persons The Real CSI: Using DNA to Identify Criminals and Missing Persons San Jose State University May 2, 2012 Overview Forensic DNA in the media perceptions and reality The power and limitations of nuclear (STR)

More information

FORENSIC GENETICS. DNA in the cell FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS. Sources of biological evidence

FORENSIC GENETICS. DNA in the cell FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS. Sources of biological evidence FORENSIC GENETICS FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS Establishing human corpse identity Crime cases matching suspect with evidence Paternity testing, even after

More information

DNA is contained in the nucleus of every cell in your body. Cell Nucleus

DNA is contained in the nucleus of every cell in your body. Cell Nucleus DNA is contained in the nucleus of every cell in your body Cell Nucleus 1 DNA has a spiral staircase-like structure. The steps are formed by the nitrogen bases of the nucleotides where adenine pairs with

More information

Overview. Background ~30 min. Lab activity ~50 min. DNA profiling Polymerase Chain Reaction (PCR) Gel Electrophoresis PCR

Overview. Background ~30 min. Lab activity ~50 min. DNA profiling Polymerase Chain Reaction (PCR) Gel Electrophoresis PCR Overview Day 1: Tuesday Introduction to DNA profiling How do we use DNA to solve crimes? Background Polymerase Chain Reaction (PCR) Gel Electrophoresis Set up PCR Day 2: Wednesday Make and Run Agarose

More information

BIOTECHNOLOGY. Sticky & blunt ends. Restriction endonucleases. Gene cloning an overview. DNA isolation & restriction

BIOTECHNOLOGY. Sticky & blunt ends. Restriction endonucleases. Gene cloning an overview. DNA isolation & restriction BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY Recombinant DNA technology involves sticking together bits of DNA from different sources. Made possible because DNA & the genetic code are universal. 2004 Biology

More information

DNA DNA Profiling 18. Discuss the stages involved in DNA profiling 19. Define the process of DNA profiling 20. Give two uses of DNA profiling

DNA DNA Profiling 18. Discuss the stages involved in DNA profiling 19. Define the process of DNA profiling 20. Give two uses of DNA profiling Name: 2.5 Genetics Objectives At the end of this sub section students should be able to: 2.5.1 Heredity and Variation 1. Discuss the diversity of organisms 2. Define the term species 3. Distinguish between

More information

_ DNA absorbs light at 260 wave length and it s a UV range so we cant see DNA, we can see DNA only by staining it.

_ DNA absorbs light at 260 wave length and it s a UV range so we cant see DNA, we can see DNA only by staining it. * GEL ELECTROPHORESIS : its a technique aim to separate DNA in agel based on size, in this technique we add a sample of DNA in a wells in the gel, then we turn on the electricity, the DNA will travel in

More information

BIOTECHNOLOGY. Biotechnology is the process by which living organisms are used to create new products THE ORGANISMS

BIOTECHNOLOGY. Biotechnology is the process by which living organisms are used to create new products THE ORGANISMS BIOTECHNOLOGY Biotechnology is the process by which living organisms are used to create new products THE ORGANISMS Bacteria: are prokaryotic organisms that contain circular DNA and no organelles. They

More information

DNA. Evidence. How is DNA be used to solve crimes?

DNA. Evidence. How is DNA be used to solve crimes? DNA Evidence How is DNA be used to solve crimes? How is DNA used as evidence? Each person s DNA is different from other people (except identical twins). DNA collected from a crime scene can either link

More information

4/26/2015. Cut DNA either: Cut DNA either:

4/26/2015. Cut DNA either: Cut DNA either: Ch.20 Enzymes that cut DNA at specific sequences (restriction sites) resulting in segments of DNA (restriction fragments) Typically 4-8 bp in length & often palindromic Isolated from bacteria (Hundreds

More information

CSI TEST. Ref. PCR detectives (4 practices) 1. EXPERIMENT OBJETIVE 2. BACKGROUND INFORMATION

CSI TEST. Ref. PCR detectives (4 practices) 1. EXPERIMENT OBJETIVE 2. BACKGROUND INFORMATION CSI TEST Ref. PCR detectives (4 practices) 1. EXPERIMENT OBJETIVE This practice introduces students to using DNA and PCR to simulate how DNA obtained from a hair or saliva sample from a crime scene can

More information

Molecular studies (SSR) for screening of genetic variability among direct regenerants of sugarcane clone NIA-98

Molecular studies (SSR) for screening of genetic variability among direct regenerants of sugarcane clone NIA-98 Molecular studies (R) for screening of genetic variability among direct regenerants of sugarcane clone NIA-98 Dr. Imtiaz A. Khan Pr. cientist / PI sugarcane and molecular marker group NIA-2012 NIA-2010

More information

Further Reading - DNA

Further Reading - DNA Further Reading - DNA DNA BACKGROUND What is DNA? DNA (short for deoxyribonucleic acid ) is a complex molecule found in the cells of all living things. The blueprint for life, DNA contains all the information

More information

Ah, Lou! There really are differences between us!

Ah, Lou! There really are differences between us! Name Per Ah, Lou! There really are differences between us! Introduction The human genome (the total sum of our genetic makeup) is made up of approximately 6 billion base pairs distributed on 46 chromosomes.

More information

Restriction Fragment Length Polymorphism (RFLP)

Restriction Fragment Length Polymorphism (RFLP) Restriction Fragment Length Polymorphism (RFLP) Polymorphism is any difference in the DNA sequence between individuals. Since we are all genetically different from each other, we are all polymorphic. This

More information

POLYMERASE CHAIN REACTION PCR. (Biotechnology and Genetic Engineering) Edemhanria, Lawrence

POLYMERASE CHAIN REACTION PCR. (Biotechnology and Genetic Engineering) Edemhanria, Lawrence POLYMERASE CHAIN REACTION PCR. (Biotechnology and Genetic Engineering) Edemhanria, Lawrence Biochemistry Unit Chemical Sciences Department Samuel Adegboyega University Ogwa, Edo State, Nigeria. Outline

More information

Polymerase Chain Reaction-361 BCH

Polymerase Chain Reaction-361 BCH Polymerase Chain Reaction-361 BCH 1-Polymerase Chain Reaction Nucleic acid amplification is an important process in biotechnology and molecular biology and has been widely used in research, medicine, agriculture

More information

DNA Profiling with PCR

DNA Profiling with PCR Name: DNA Profiling with PCR OBJECTIVES To review the structure and function of DNA. Understand and perform the polymerase chain reaction (PCR) To gain experience using the micropipettes, thermocycler,

More information

Human Genomics. 1 P a g e

Human Genomics. 1 P a g e Human Genomics What were the aims of the human genome project? To identify all the approximately 20,000-25,000 genes in Human DNA. To find where each gene is located To determine the sequences of the 3

More information

Laboratory Exercise 4. Multiplex PCR of Short Tandem Repeats and Vertical Polyacrylamide Gel Electrophoresis.

Laboratory Exercise 4. Multiplex PCR of Short Tandem Repeats and Vertical Polyacrylamide Gel Electrophoresis. Laboratory Exercise 4 4 Multiplex PCR of Short Tandem Repeats and Vertical Polyacrylamide Gel Electrophoresis B A C K G R O U N D The human genome contains over 3000 million base pairs, which are distributed

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

DNA FINGERPRINTING MADE EASY FOR FORENSICS

DNA FINGERPRINTING MADE EASY FOR FORENSICS DNA FINGERPRINTING MADE EASY FOR FORENSICS Presented by Eilene Lyons The St. Louis Community College Florissant Valley Biotechnology Program Some slides are from a downloaded PPT presentation from The

More information

Chapter 15 Gene Technologies and Human Applications

Chapter 15 Gene Technologies and Human Applications Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect

More information

PCR in the Classroom. UC Davis - PCR Workshop Friday, September 26, 2003

PCR in the Classroom. UC Davis - PCR Workshop Friday, September 26, 2003 PCR in the Classroom UC Davis - PCR Workshop Friday, September 26, 2003 A little history In 1983, Kary B. Mullis conceived the procedure. He went on to Cetus Corp in Emeryville, CA where it was developed

More information

DNA Profiling. (DNA fingerprinting)

DNA Profiling. (DNA fingerprinting) DNA Profiling (DNA fingerprinting) Background Information: Restriction Enzymes Restriction Enzymes Evolved by bacteria to protect against viral DNA infection. Also called Endonucleases. They cleave DNA

More information

Basic lab techniques

Basic lab techniques Basic lab techniques Sandrine Dudoit Bioconductor short course Summer 2002 Copyright 2002, all rights reserved Lab techniques Basic lab techniques for nucleic acids Hybridization. Cut: restriction enzymes.

More information

Using Genetics for Species Identification

Using Genetics for Species Identification Using Genetics for Species Identification John Hyde NOAA Southwest Fisheries Science Center La Jolla, California USA December 6, 2013 2 Important Point to Consider Not all specimens need to be genetically

More information

DETERMINATION OF THE Rh FACTOR BY PCR

DETERMINATION OF THE Rh FACTOR BY PCR DETERMINATION OF THE Rh FACTOR BY PCR Ref.: PCR2 1. EXPERIMENT OBJECTIVE The aim of this experiment is to introduce students to the principles and practice of the Polymerase Chain Reaction (PCR) by studying

More information

Site directed mutagenesis, Insertional and Deletion Mutagenesis. Mitesh Shrestha

Site directed mutagenesis, Insertional and Deletion Mutagenesis. Mitesh Shrestha Site directed mutagenesis, Insertional and Deletion Mutagenesis Mitesh Shrestha Mutagenesis Mutagenesis (the creation or formation of a mutation) can be used as a powerful genetic tool. By inducing mutations

More information

Bootcamp: Molecular Biology Techniques and Interpretation

Bootcamp: Molecular Biology Techniques and Interpretation Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing

More information

Amplifying the ALU intron for Hardy- Weinberg Analysis Part 1

Amplifying the ALU intron for Hardy- Weinberg Analysis Part 1 Bio 212 Lab Name: Amplifying the ALU intron for Hardy- Weinberg Analysis Part 1 OBJECTIVES: Review the following terms and concepts presented in Biology 211: enzymes, DNA structure and replication, role

More information

B. Incorrect! Ligation is also a necessary step for cloning.

B. Incorrect! Ligation is also a necessary step for cloning. Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease

More information

Lesson Overview. Studying the Human Genome. Lesson Overview Studying the Human Genome

Lesson Overview. Studying the Human Genome. Lesson Overview Studying the Human Genome Lesson Overview 14.3 Studying the Human Genome THINK ABOUT IT Just a few decades ago, computers were gigantic machines found only in laboratories and universities. Today, many of us carry small, powerful

More information

Family Secrets Genetic Testing PowerPoint Script

Family Secrets Genetic Testing PowerPoint Script Family Secrets Genetic Testing PowerPoint Script *Notes on use: Each bulleted portion goes with a mouse click advance on the PowerPoint. Sometimes, the mouse click advances a slide, and sometimes the mouse

More information

DNA Technology Outline

DNA Technology Outline I) Tools of DNA technology A. PCR (Polymerase Chain Reaction): method of copying DNA sequences 1. DNA is copied in a similar way to natural replication in our cells, but much faster. 2.PCR consists of

More information

Polymerase Chain Reaction (PCR) and Its Applications

Polymerase Chain Reaction (PCR) and Its Applications Polymerase Chain Reaction (PCR) and Its Applications What is PCR? PCR is an exponentially progressing synthesis of the defined target DNA sequences in vitro. It was invented in 1983 by Dr. Kary Mullis,

More information

Recombinant DNA Technology

Recombinant DNA Technology History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists

More information

Biotechnology. Explorer Program. Serious About Science Education 5/17/09 1

Biotechnology. Explorer Program. Serious About Science Education 5/17/09 1 Biotechnology Explorer Program Serious About Science Education 5/17/09 1 Chromosome 8: PCR TM PCR Workshop Kirk Brown,, Tracy High School; Tracy, Ca Stan Hitomi,, Monte Vista High School; Danville, CA

More information

2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology

2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes

More information

Genetics and Genomics in Medicine Chapter 3. Questions & Answers

Genetics and Genomics in Medicine Chapter 3. Questions & Answers Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical

More information

DNA Fingerprinting. The DNA fingerprinting technique is summarized as follows:

DNA Fingerprinting. The DNA fingerprinting technique is summarized as follows: DNA Fingerprinting Introduction Laboratory techniques called DNA fingerprinting have been developed to identify or type an individual's DNA. One application of these techniques has been in solving crimes.

More information

Practical 4: PCR in Molecular Diagnosis

Practical 4: PCR in Molecular Diagnosis PRINCIPLES What is PCR Practical 4: PCR in Molecular Diagnosis Instructors: Dr. Valerie C.L. Lin and Dr. Sze Chun Chau PCR stands for polymerase chain reaction. The PCR method was devised and named by

More information

Name Date Class CHAPTER 13. DNA Fingerprinting

Name Date Class CHAPTER 13. DNA Fingerprinting Real-World Biology: Analysis DNA Fingerprinting Genetic Prints Help Solve Mystery of Girls Switched at Birth. Murder Conviction Overturned by DNA Testing: Prisoner Released. Headlines such as these have

More information

Introduction to Mitochondrial DNA Analysis

Introduction to Mitochondrial DNA Analysis Introduction to Mitochondrial DNA Analysis Leslie D. McCurdy, Ph.D. Federal Bureau of Investigation DNA Analysis Unit II Deoxyribonucleic Acid Nuclear DNA (nucdna) Biparental inheritance Can achieve unique

More information

SELECTED TECHNIQUES AND APPLICATIONS IN MOLECULAR GENETICS

SELECTED TECHNIQUES AND APPLICATIONS IN MOLECULAR GENETICS SELECTED TECHNIQUES APPLICATIONS IN MOLECULAR GENETICS Restriction Enzymes 15.1.1 The Discovery of Restriction Endonucleases p. 420 2 2, 3, 4, 6, 7, 8 Assigned Reading in Snustad 6th ed. 14.1.1 The Discovery

More information

More Basic Biotechnology Tools. Sorting & Copying DNA

More Basic Biotechnology Tools. Sorting & Copying DNA More Basic Biotechnology Tools Sorting & Copying DNA 2007-2008 Many uses of restriction enzymes Now that we can cut DNA with restriction enzymes we can cut up DNA from different people or different organisms

More information

CH 8: Recombinant DNA Technology

CH 8: Recombinant DNA Technology CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes

More information

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing

More information

The Biotechnology Toolbox

The Biotechnology Toolbox Chapter 15 The Biotechnology Toolbox Cutting and Pasting DNA Cutting DNA Restriction endonuclease or restriction enzymes Cellular protection mechanism for infected foreign DNA Recognition and cutting specific

More information

Studying the Human Genome. Lesson Overview. Lesson Overview Studying the Human Genome

Studying the Human Genome. Lesson Overview. Lesson Overview Studying the Human Genome Lesson Overview 14.3 Studying the Human Genome THINK ABOUT IT Just a few decades ago, computers were gigantic machines found only in laboratories and universities. Today, many of us carry small, powerful

More information

Lab 5: Shark Attacks, Again! DNA Fingerprinting to the Rescue

Lab 5: Shark Attacks, Again! DNA Fingerprinting to the Rescue Lab 5: Shark Attacks, Again! DNA Fingerprinting to the Rescue Notebook Lab Objectives Develop an understanding of the basic techniques used to study genetic polymorphisms encoded in DNA Gain familiarity

More information

Polymerase Chain Reaction (PCR) May 23, 2017

Polymerase Chain Reaction (PCR) May 23, 2017 Polymerase Chain Reaction (PCR) May 23, 2017 Outline History of PCR Uses of PCR How PCR works How to set up and run PCR The structure of DNA PCR Polymerase chain reaction Selective amplification of target

More information

Microsatellite markers

Microsatellite markers Microsatellite markers Review of repetitive sequences 25% 45% 8% 21% 13% 3% Mobile genetic elements: = dispersed repeat included: transposition: moving in the form of DNA by element coding for transposases.

More information

! Polymerase Chain. AP Biology. ! The primers are critical! "

! Polymerase Chain. AP Biology. ! The primers are critical! Let s return to the idea of making lots of copies of DNA Copy DNA without plasmids? PCR Polymerase Chain Reaction Yes, we can use bacteria method for making many, many copies of a specific segment of DNA

More information

DNA Replication. DNA Replication. Meselson & Stahl Experiment. Contents

DNA Replication. DNA Replication. Meselson & Stahl Experiment. Contents DNA Replication Contents 1 DNA Replication 1.1 Meselson & Stahl Experiment 1.2 Replication Machinery 2 Polymerase Chain Reaction (PCR) 3 External Resources: DNA Replication Meselson & Stahl Experiment

More information

DNA stands for deoxyribose nucleic acid DNA is a very large molecule made up of a long chain of sub-units The sub-units are called nucleotides Each

DNA stands for deoxyribose nucleic acid DNA is a very large molecule made up of a long chain of sub-units The sub-units are called nucleotides Each 1 DNA stands for deoxyribose nucleic acid DNA is a very large molecule made up of a long chain of sub-units The sub-units are called nucleotides Each nucleotide is made up of a sugar called deoxyribose

More information

1

1 1 2 3 4 5 Cosmids are plasmid vectors that contain cos sites. The cos site is the only requirement for DNA to be packaged into a phage particle 6 7 8 9 10 11 12 13 14 15 16 For de novo sequencing using

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Genetics and Biotechnology. Section 1. Applied Genetics

Genetics and Biotechnology. Section 1. Applied Genetics Section 1 Applied Genetics Selective Breeding! The process by which desired traits of certain plants and animals are selected and passed on to their future generations is called selective breeding. Section

More information