The connection between genes, proteins and metabolism CAMPBELL BIOLOGY

Size: px
Start display at page:

Download "The connection between genes, proteins and metabolism CAMPBELL BIOLOGY"

Transcription

1 Lecture 6 The connection between genes, proteins and metabolism CAMPBELL BIOLOGY 1

2 What do genes do? What cellular processes do they affect? Garrod described: inherited disorders of metabolism also called: Inborn Errors of Metabolism He was studying the disorder called alkaptonuria - affected individuals produce urine that turns black - the disorder runs in families inherited as a recessive trait - affected individuals have a metabolic block preventing: homogentistic acid maleyl aceto acetic acid - homogentistic acid accumulates and is excreted in urine - is not a life-threatening condition Phenylketonuria (PKU) - a more serious inherited defect - a defect in the metabolism of the amino acid: phenylalanine phenylalanine tyrosine - leads to accumulation of a toxic metabolite = phenylpyruvic acid - if untreated, can cause severe mental retardation - all newborns are routinely tested for PKU and other inherited metabolic disorders = the Guthrie heel prick test a single drop of blood is assayed - PKU is a recessive genetic disorder - frequency of occurrence = 1/ 11,000 births 2

3 The discovery of Inborn Errors of Metabolism indicated that genes control metabolism How? Beadle and Tatum (1940 s) proposed: - genes control the production of (or code for) enzymes that function in metabolic pathways But what is the nature of the relationship between genes and enzymes? Does one gene code for one enzyme? Does one gene code for several enzymes? Do several genes code for one enzyme? (Nobel Prize 1958 for their work) Beadle and Tatum proposed: that ONE GENE codes for ONE ENZYME Neurospora crassa This is known as the ONE GENE : ONE ENZYME hypothesis - they studied nutritional mutants = auxotrophs of the red bread mould Neurospora crassa - the wild-type fungus can grow on minimal medium - auxotrophs can t grow on minimal medium they require extra nutritional supplements 3

4 The WILD-TYPE fungus can make all the complex biochemicals necessary for life (amino acids, vitamins, etc) from Minimal Medium (MM): (a) inorganic salts: nitrate, phosphate, potassium, etc (b) Carbon source: sugar AUXOTROPHS are unable to make certain biochemicals and therefore require MM + supplements: (c) amino acids (20) (d) vitamins (e) purines (f) pyrimidines required for protein synthesis required as enzyme cofactors precursors for DNA/RNA precursors for DNA/RNA Beadle and Tatum s experiments: 1. Create mutants by exposing fungal spores to radiation X-rays 2. Pick up individual spores and grow them in test-tubes containing complete medium Result: Both mutant and wild-type spores grow well 3. Transfer fungus to minimal medium Result: The wild-type grows well but the mutant can t grow 4

5 Why can t the mutant grow on minimal medium? - because it can t make an essential biochemical Which essential biochemical can t it make? i.e. What nutritional supplement when added to minimal medium will allow it to grow? Experiment 1 Complete MM MM MM MM Medium + vitamins + purines + amino acids NO GROWTH GROWTH Conclusion: the mutant can t make one or more amino acids Beadle & Tatum 5

6 Experiment 2 Which one of 20 amino acids can the mutant not make? Inoculate mutant onto MM + each amino acid MM MM MM MM MM + glycine + alanine + serine + tyrosine + arginine NO GROWTH GROWTH Conclusion: supplying arginine allows the mutant to grow therefore the mutant can t make arginine itself Beadle & Tatum 6

7 Can these studies tell us anything about the metabolic pathway responsible for biosynthesis of arginine? YES Beadle and Tatum went on to identify 3 different classes of mutants that could not synthesize arginine Each mutant class had a metabolic block at a different step in the metabolic pathway that produces arginine Because they isolated 3 classes of mutants that couldn t synthesize arginine, this suggested that 3 genes were involved in arginine biosynthesis i.e. that the metabolic pathway contained 3 enzymatic steps Metabolic pathways usually involve multiple enzymatic steps Each unique enzyme is encoded by a unique gene??? arginine 7

8 Class C mutants - can t grow if supplied with ornithine nor citrulline - can only grow if they are supplied with arginine - therefore the metabolic block must be in the last enzymatic step that converts citrulline arginine MM Orn Cit Arg Class B mutants - can t grow if supplied with the ornithine - but can grow if they are supplied with citrulline or arginine - therefore the enzymatic block must be in the enzymatic step that converts ornithine citrulline MM Orn Cit Arg 8

9 Class A mutants - Will grow if supplied with either ornithine or citrulline or arginine - Therefore the metabolic block must lie upstream of ornithine MM Orn Cit Arg 9

10 Beadle and Tatum s experiments showed: 1. It is possible to work out the order in which the enzymatic steps occur in a metabolic pathway using a genetic approach 2. That one gene codes for one enzyme 3. This definition was modified when it was discovered that many genes code for proteins that are not enzymes e.g. hemoglobin one gene codes for one protein 4. It was modified again when it was discovered that some proteins contain more than one polypeptide chain each of which is encoded by a separate gene e.g. hemoglobin one gene codes for one polypeptide Beadle and Tatum won the Nobel Prize in

11 geneticsofmd.webnode.com/ dwe00212g01 Duchenne muscular dystrophy.gif 11

12 12

13 Quick lesson on Introns & Exons Example DMD gene: a typical eukaryotic gene is made up of two types of DNA sequence (a) coding sequences called exons and (b) non-coding sequences called introns. After transcription, introns are removed from the mrna (this is called RNA splicing). (We ll be learning about promoters early next week) Transcription (DNA transcribed into RNA) Promoter Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 RNA processing intron removal Mature mrna + addition of a polya tail AAAAAAA Diffential splicing of RNA can lead to generation of multiple proteins 13

14 Immunocytochemisty of muscle biopsies from untreated patient (DMD), healthy control (HC) and the 4 treated patients. New Eng J Med 357:2679 Dec 2007 Review - Foster et al Hum Gene Therapy July

15 15

16 Stamer and Stuber

17 17

6.1 Transfer of Information from DNA. SBI4U Ms. Ho-Lau

6.1 Transfer of Information from DNA. SBI4U Ms. Ho-Lau 6.1 Transfer of Information from DNA SBI4U Ms. Ho-Lau Link between Genes and Proteins Early 1900s, scientists suggested proteins were involved in inheritance Gregor Mendel: Certain factors were responsible

More information

From Gene to Protein. Lesson 3

From Gene to Protein. Lesson 3 From Gene to Protein Lesson 3 Gregor Mendel Mendel hypothesized that certain factors were responsible for the traits that were inherited by pea plants Today, these factors are known as genes A sequence

More information

Chapter 17. From Gene to Protein. AP Biology

Chapter 17. From Gene to Protein. AP Biology Chapter 17. From Gene to Protein Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)

More information

From Genes to Protein

From Genes to Protein From Genes to Protein Transcription and Translation Metabolism Teaches Us About Genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from

More information

AP Biology

AP Biology Chapter 17. From Gene to Protein Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)

More information

The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work

The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work Genes and How They Work Chapter 15 Early ideas to explain how genes work came from studying human diseases. Archibald Garrod studied alkaptonuria, 1902 Garrod recognized that the disease is inherited via

More information

GENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

GENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. GENE EXPRESSION AT THE MOLECULAR LEVEL Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene expression Gene function at the level of traits Gene function

More information

Human Molecular Genetics Prof. S. Ganesh Department of Biological Sciences and Bioengineering Indian Institute of Technology, Kanpur

Human Molecular Genetics Prof. S. Ganesh Department of Biological Sciences and Bioengineering Indian Institute of Technology, Kanpur Human Molecular Genetics Prof. S. Ganesh Department of Biological Sciences and Bioengineering Indian Institute of Technology, Kanpur Module - 01 Lecture - 01 Fundamentals of Central Dogma Part 1 (DNA,

More information

AS91159 Demonstrate understanding of gene expression

AS91159 Demonstrate understanding of gene expression AS91159 Demonstrate understanding of gene expression Mutations and Metabolic Pathways (2015,2) In 1941 biologists George Beadle and Edward Tatum exposed the bread mould Neurospora crassa to radiation.

More information

From Genes to Protein

From Genes to Protein From Genes to Protein Transcription and Translation Metabolism Teaches Us About Genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from

More information

Analyzed Fungi Neurospora crassa mutants. Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated:

Analyzed Fungi Neurospora crassa mutants. Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated: From Gene to Protein Beadle and Tatum Analyzed Fungi Neurospora crassa mutants Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated: Precursor Ornithine

More information

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Ch 17 Practice Questions MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) Garrod hypothesized that "inborn errors of metabolism" such as alkaptonuria

More information

BEADLE & TATUM EXPERIMENT

BEADLE & TATUM EXPERIMENT FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in

More information

Chapter 17. From Gene to Protein

Chapter 17. From Gene to Protein Chapter 17 From Gene to Protein One Gene One Enzyme Hypothesis Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria Beadle

More information

8/21/2014. From Gene to Protein

8/21/2014. From Gene to Protein From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information

More information

FROM GENE TO PROTEIN. One Gene One Enzyme Hypothesis 3/12/2013. Basic Principles of Transcription & Translation

FROM GENE TO PROTEIN. One Gene One Enzyme Hypothesis 3/12/2013. Basic Principles of Transcription & Translation One Gene One Enzyme Hypothesis FROM GENE TO PROTEIN C H A P T E R 1 7 Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria

More information

Bio 102 Practice Problems Genetic Code and Mutation

Bio 102 Practice Problems Genetic Code and Mutation Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine

More information

Chapter 17 From Gene to Protein

Chapter 17 From Gene to Protein Chapter 17 From Gene to Protein The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific traits

More information

F 11/23 Happy Thanksgiving! 8 M 11/26 Gene identification in the genomic era Bamshad et al. Nature Reviews Genetics 12: , 2011

F 11/23 Happy Thanksgiving! 8 M 11/26 Gene identification in the genomic era Bamshad et al. Nature Reviews Genetics 12: , 2011 3 rd Edition 4 th Edition Lecture Day Date Topic Reading Problems Reading Problems 1 M 11/5 Complementation testing reveals that genes are distinct entities Ch. 7 224-232 2 W 11/7 One gene makes one protein

More information

Biology. DNA & the Language of Life

Biology. DNA & the Language of Life Biology DNA & the Language of Life Genes are Made of DNA Fredrick Griffith (1928) studied pneumonia strains (one was harmless while the other was pathogenic, or disease-causing) Made non-harmful strains

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by

More information

From Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

From Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp

More information

Chapter 17 From Gene to Protein

Chapter 17 From Gene to Protein Chapter 17 From Gene to Protein Describe the structure of DNA. What is its elemental makeup? Name the subunit that makes up DNA. What components make up the DNA molecule? How are the two strands related

More information

PROTEIN SYNTHESIS. copyright cmassengale

PROTEIN SYNTHESIS. copyright cmassengale PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other

More information

Chapter 17 From Gene to Protein

Chapter 17 From Gene to Protein Chapter 17 From Gene to Protein Question? How does DNA control a cell? By controlling Protein Synthesis. Proteins are the link between genotype and phenotype. For tests: Name(s) of experimenters Outline

More information

BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION.

BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION. !! www.clutchprep.com CONCEPT: GENES Beadle and Tatum develop the one gene one enzyme hypothesis through their work with Neurospora (bread mold). This idea was later revised as the one gene one polypeptide

More information

From Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

From Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp

More information

AP Biology Review Chapters Review Questions Chapter 11: Mendelian Patterns of Inheritance Chapter 12: Molecular Biology of the Gene

AP Biology Review Chapters Review Questions Chapter 11: Mendelian Patterns of Inheritance Chapter 12: Molecular Biology of the Gene AP Biology Review Chapters 11-12 Review Questions Chapter 11: Mendelian Patterns of Inheritance a) Know genotypes and phenotypes of a monohybrid cross in the P, F1, and F2 generations. Be familiar with

More information

Honors Biology Reading Guide Chapter 10 v Fredrick Griffith Ø When he killed bacteria and then mixed the bacteria remains with living harmless

Honors Biology Reading Guide Chapter 10 v Fredrick Griffith Ø When he killed bacteria and then mixed the bacteria remains with living harmless Honors Biology Reading Guide Chapter 10 v Fredrick Griffith Ø When he killed bacteria and then mixed the bacteria remains with living harmless bacteria some living bacteria cells converted to disease causing

More information

AP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review

AP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review AP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review Enzyme that adds nucleotide subunits to an RNA primer during replication DNA polymerase III Another name for protein synthesis translation Sugar

More information

Genetics: Analysis of Genes and Genomes, Ninth Edition. Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION

Genetics: Analysis of Genes and Genomes, Ninth Edition. Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION CHAPTER 1 STUDENT NOT STUDY FOR SALE GUIDE OR DISTRIBUTION TEST BANK Daniel Jones L. Hartl & Bartlett and Bruce Learning, J. Cochrane LLC Multiple Choice 1. NOT What FOR happens SALE if organisms OR DISTRIBUTION

More information

Lecture 2: Biology Basics Continued

Lecture 2: Biology Basics Continued Lecture 2: Biology Basics Continued Central Dogma DNA: The Code of Life The structure and the four genomic letters code for all living organisms Adenine, Guanine, Thymine, and Cytosine which pair A-T and

More information

Scientific Method. Name: NetID: Exam 1 Version 1 September 12, 2017 Dr. A. Pimentel

Scientific Method. Name: NetID: Exam 1 Version 1 September 12, 2017 Dr. A. Pimentel Name: NetID: Exam 1 Version 1 September 12, 2017 Dr. A. Pimentel Each question has a value of 4 points and there is a total of 156 points in the exam. However, the maximum score of this exam will be capped

More information

DNA: STRUCTURE AND REPLICATION

DNA: STRUCTURE AND REPLICATION DNA: STRUCTURE AND REPLICATION DNA was known to be a chemical in cells by the end of the nineteenth century, has the capacity to store genetic information, and can be copied and passed from generation

More information

The gist of Benzer s work: Intragenic recombination can restore wild-type function to a gene.

The gist of Benzer s work: Intragenic recombination can restore wild-type function to a gene. The gist of Benzer s work: Intragenic recombination can restore wild-type function to a gene. This implies that genes are linear strings of mutable elements. 1 Beadle and Ephrussi carrying out an eye disk

More information

Chapter 12: Molecular Biology of the Gene

Chapter 12: Molecular Biology of the Gene Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,

More information

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation. Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions

More information

Chapter 14 Active Reading Guide From Gene to Protein

Chapter 14 Active Reading Guide From Gene to Protein Name: AP Biology Mr. Croft Chapter 14 Active Reading Guide From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single

More information

Chapter 14: Gene Expression: From Gene to Protein

Chapter 14: Gene Expression: From Gene to Protein Chapter 14: Gene Expression: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect

More information

AP Biology Review Chapters Review Questions Chapter 11: Mendelian Patterns of Inheritance Chapter 12: Molecular Biology of the Gene

AP Biology Review Chapters Review Questions Chapter 11: Mendelian Patterns of Inheritance Chapter 12: Molecular Biology of the Gene AP Biology Review Chapters 11-12 Review Questions Chapter 11: Mendelian Patterns of Inheritance a) Know genotypes and phenotypes of a monohybrid cross in the P, F1, and F2 generations. Be familiar with

More information

Chapter 17. From Gene to Protein

Chapter 17. From Gene to Protein Chapter 17 From Gene to Protein Overview: The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific

More information

Name Campbell Chapter 17 From Gene To Protein

Name Campbell Chapter 17 From Gene To Protein A.P. Biology Name Campbell Chapter 17 From Gene To Protein 325-331 The information in DNA is coded in a particular sequence of (nucleic acid monomers). This chapter is about how this sequence is expressed

More information

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Exam Chapter 17 Genes to Proteins Name MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. The following questions refer to Figure 17.1, a simple metabolic

More information

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes? Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology

More information

Molecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.

Molecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA. Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions

More information

Chapter 17: From Gene to Protein

Chapter 17: From Gene to Protein Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master

More information

Genetics IV: Biochemical Genetics

Genetics IV: Biochemical Genetics Genetics IV: Biochemical Genetics 1. Population Genetics This field was advanced by laws proposed by two people Hardy and Weinberg (1908) Suppose in a population there are 2 alleles for a given gene, A

More information

Lecture for Wednesday. Dr. Prince BIOL 1408

Lecture for Wednesday. Dr. Prince BIOL 1408 Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that

More information

BIOLOGY. Chapter 15 Genes & Proteins

BIOLOGY. Chapter 15 Genes & Proteins BIOLOGY Chapter 15 Genes & Proteins CMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 17 Protein Synthesis 2014 Pearson Education, Inc. Fig. 17-1 Figure 17.1a n albino racoon Condition

More information

Gene Expression DNA to Protein - 1

Gene Expression DNA to Protein - 1 Gene Expression DNA to Protein - 1 As we have just discussed, the structure of DNA provides a mechanism for selfreplication. The structure of DNA also reveals the mechanism for storing the genetic information

More information

From Gene to Protein. How Genes Work (Ch. 17)

From Gene to Protein. How Genes Work (Ch. 17) From Gene to Protein How Genes Work (Ch. 17) What do genes code for? How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA DNA proteins cells bodies The Central

More information

Videos. Lesson Overview. Fermentation

Videos. Lesson Overview. Fermentation Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast

More information

Proofreading and Correction

Proofreading and Correction How about a mistake? Just as we make mistakes, so can the replication process Wrong bases may be inserted into the new DNA Nucleotide bases may be damaged (ie. By radiation) When this happens, mutations

More information

From Gene to Protein

From Gene to Protein Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp

More information

9. What proteins will be affected by mutations in the trans-acting elements? Cis-acting elements?

9. What proteins will be affected by mutations in the trans-acting elements? Cis-acting elements? 6. What regulates the expression of a gene? 7. What are the cis- and trans-acting elements? 8. Can a deficiency in a trans-acting element be overcome by the addition of another copy of the gene to a cell?

More information

Exam 2 Key - Spring 2008 A#: Please see us if you have any questions!

Exam 2 Key - Spring 2008 A#: Please see us if you have any questions! Page 1 of 5 Exam 2 Key - Spring 2008 A#: Please see us if you have any questions! 1. A mutation in which parts of two nonhomologous chromosomes change places is called a(n) A. translocation. B. transition.

More information

A. Incorrect! This feature does help with it suitability as genetic material.

A. Incorrect! This feature does help with it suitability as genetic material. College Biology - Problem Drill 08: Gene Structures and Functions No. 1 of 10 1. Which of the statements below is NOT true in explaining why DNA is a suitable genetic material? #01 (A) Its double helix

More information

GENE REGULATION. Gene regulation occurs at the level of transcription or production of mrna

GENE REGULATION. Gene regulation occurs at the level of transcription or production of mrna GENE REGULATION Virtually every cell in your body contains a complete set of genes But they are not all turned on in every tissue Each cell in your body expresses only a small subset of genes at any time

More information

BS 50 Genetics and Genomics Week of Oct 24

BS 50 Genetics and Genomics Week of Oct 24 BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.

More information

Fermentation. Lesson Overview. Lesson Overview 13.1 RNA

Fermentation. Lesson Overview. Lesson Overview 13.1 RNA 13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to

More information

Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein)

Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein) Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein) I. Review A. Cells copy their DNA (in S phase of Interphase)-Why? Prepare for Cell Division (Mitosis & Cytokinesis) Genes

More information

EUKARYOTIC REGULATION C H A P T E R 1 3

EUKARYOTIC REGULATION C H A P T E R 1 3 EUKARYOTIC REGULATION C H A P T E R 1 3 EUKARYOTIC REGULATION Every cell in an organism contains a complete set of DNA. But it doesn t use all of the DNA it receives Each cell chooses different DNA sequences

More information

Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype)

Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype) Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype) Question#1: One-Gene, One-Polypeptide The figure below shows the results of feeding trials with one auxotroph strain of Neurospora

More information

DNA Function: Information Transmission

DNA Function: Information Transmission DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living

More information

Molecular Genetics. Before You Read. Read to Learn

Molecular Genetics. Before You Read. Read to Learn 12 Molecular Genetics section 3 DNA,, and Protein DNA codes for, which guides protein synthesis. What You ll Learn the different types of involved in transcription and translation the role of polymerase

More information

PROTEIN SYNTHESIS. copyright cmassengale

PROTEIN SYNTHESIS. copyright cmassengale PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other

More information

Introduction. Why is your hair the color that it is??? Copyright 2002 Pearson Education, Inc., publishing as Benjamin Cummings

Introduction. Why is your hair the color that it is??? Copyright 2002 Pearson Education, Inc., publishing as Benjamin Cummings Introduction Why is your hair the color that it is??? George Beadle and Edward Tatum made Neurospora crassa famous. You know it as?? Here s what they did Fig. 17.1 They came up with this saying: one gene

More information

GENETICS. Chapter 1: Cell cycle. Thème 1 : La Terre dans l Univers A. Expression, stabilité et variation du patrimoine génétique.

GENETICS. Chapter 1: Cell cycle. Thème 1 : La Terre dans l Univers A. Expression, stabilité et variation du patrimoine génétique. Introduction: GENETICS 3M = first look at genetics (study of inheritance, discovery of chromosomes, genes, dominant and recessive alleles and the DNA molecule within chromosomes) 2D = not much in fact,

More information

Biology 3201 Genetics Unit #5

Biology 3201 Genetics Unit #5 Biology 3201 Genetics Unit #5 Protein Synthesis Protein Synthesis Protein synthesis: this is the process whereby instructions from DNA are used to create polypeptides that make up a protein. This process

More information

Lesson Overview. Fermentation 13.1 RNA

Lesson Overview. Fermentation 13.1 RNA 13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA

More information

GRU5 LECTURE POST-TRANSCRIPTIONAL MODIFICATION AND TRANSCRIPTION

GRU5 LECTURE POST-TRANSCRIPTIONAL MODIFICATION AND TRANSCRIPTION GRU5 LECTURE POST-TRANSCRIPTIONAL MODIFICATION AND TRANSCRIPTION Do Now 1. What was the DNA template for this mrna: 5 -A-A-C-G-U-3? (Write it 5 to 3 ) 2. State the Central Dogma of biology. 3. Name 3 differences

More information

Key Area 1.3: Gene Expression

Key Area 1.3: Gene Expression Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?

More information

Name: Period: Date: BIOLOGY HONORS DNA REVIEW GUIDE (extremely in detail) by Trung Pham. 5. What two bases are classified as purines? pyrimidine?

Name: Period: Date: BIOLOGY HONORS DNA REVIEW GUIDE (extremely in detail) by Trung Pham. 5. What two bases are classified as purines? pyrimidine? BIOLOGY HONORS DNA REVIEW GUIDE (extremely in detail) by Trung Pham 1. What is the base pair rule for DNA? RNA? 2. What is the sugar found in RNA called? 3. is replaced by the base uracil in RNA? 4. What

More information

Chapter 17: From Gene to Protein

Chapter 17: From Gene to Protein Name Period Chapter 17: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to

More information

QUESTIONS 16 THROUGH 30 FROM EXAM 3 OF FALL, 2010

QUESTIONS 16 THROUGH 30 FROM EXAM 3 OF FALL, 2010 BISC403 Genetic and Evolutionary Biology Spring, 2011 April 19, 2011 Summary of requirements for Exam 3 (to be given on April 26 plus third exam from fall, 2010) The primary responsibility is for any topic

More information

Introduction. Why is your hair the color that it is??? Copyright 2002 Pearson Education, Inc., publishing as Benjamin Cummings

Introduction. Why is your hair the color that it is??? Copyright 2002 Pearson Education, Inc., publishing as Benjamin Cummings Introduction Why is your hair the color that it is??? George Beadle and Edward Tatum made Neurospora crassa famous. You know it as?? Here s what they did Fig. 17.1 They came up with this saying: one gene

More information

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16 Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes

More information

Do you think DNA is important? T.V shows Movies Biotech Films News Cloning Genetic Engineering

Do you think DNA is important? T.V shows Movies Biotech Films News Cloning Genetic Engineering DNA Introduction Do you think DNA is important? T.V shows Movies Biotech Films News Cloning Genetic Engineering At the most basic level DNA is a set of instructions for protein construction. Structural

More information

Transcription Eukaryotic Cells

Transcription Eukaryotic Cells Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes

More information

13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription.

13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription. 13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription. The Role of RNA 1. Complete the table to contrast the structures of DNA and RNA. DNA Sugar Number of Strands Bases

More information

DNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA

DNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA 21 DNA and Biotechnology DNA and Biotechnology OUTLINE: Replication of DNA Gene Expression Mutations Regulating Gene Activity Genetic Engineering Genomics DNA (deoxyribonucleic acid) Double-stranded molecule

More information

Chapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why?

Chapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why? Slide 1 Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from

More information

6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA

6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA 6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA DNA mrna Protein DNA is found in the nucleus, but making a protein occurs at the ribosome

More information

Saccharomyces cerevisiae. haploid =

Saccharomyces cerevisiae. haploid = In this lecture we are going to consider experiments on yeast, a very useful organism for genetic study. Yeast is more properly known as Saccharomyces cerevisiae, which is the single-celled microbe used

More information

Review of Protein (one or more polypeptide) A polypeptide is a long chain of..

Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic

More information

Gene Expression: Transcription

Gene Expression: Transcription Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make

More information

From Gene to Protein

From Gene to Protein 8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are

More information

Solutions to Quiz II

Solutions to Quiz II MIT Department of Biology 7.014 Introductory Biology, Spring 2005 Solutions to 7.014 Quiz II Class Average = 79 Median = 82 Grade Range % A 90-100 27 B 75-89 37 C 59 74 25 D 41 58 7 F 0 40 2 Question 1

More information

Algorithms in Bioinformatics ONE Transcription Translation

Algorithms in Bioinformatics ONE Transcription Translation Algorithms in Bioinformatics ONE Transcription Translation Sami Khuri Department of Computer Science San José State University sami.khuri@sjsu.edu Biology Review DNA RNA Proteins Central Dogma Transcription

More information

Transcription in Eukaryotes

Transcription in Eukaryotes Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the

More information

Ch 10 Molecular Biology of the Gene

Ch 10 Molecular Biology of the Gene Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read

More information

Bioinformatics. ONE Introduction to Biology. Sami Khuri Department of Computer Science San José State University Biology/CS 123A Fall 2012

Bioinformatics. ONE Introduction to Biology. Sami Khuri Department of Computer Science San José State University Biology/CS 123A Fall 2012 Bioinformatics ONE Introduction to Biology Sami Khuri Department of Computer Science San José State University Biology/CS 123A Fall 2012 Biology Review DNA RNA Proteins Central Dogma Transcription Translation

More information

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made

More information

Matters arising Minitest Pick up from your TA after class Answer key posted next week Re-grade requests in writing to Anne Paul by next Friday, please

Matters arising Minitest Pick up from your TA after class Answer key posted next week Re-grade requests in writing to Anne Paul by next Friday, please Matters arising Minitest Pick up from your TA after class Answer key posted next week Re-grade requests in writing to Anne Paul by next Friday, please Mini-survey just before break 25 20 Minitest 1 - Winter

More information

From Gene to Protein. Chapter 17

From Gene to Protein. Chapter 17 From Gene to Protein Chapter 17 What you need to know: The key terms: gene expression, transcription, and translation. The major events of transcription. How eukaryotic cells modify RNA after transcription.

More information

I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics

I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics Ch 12 Lecture Notes - DNA I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics 1 II. Griffith and Transformation

More information

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested

More information

Chapter 13: RNA and Protein Synthesis. Dr. Bertolotti

Chapter 13: RNA and Protein Synthesis. Dr. Bertolotti Chapter 13: RNA and Protein Synthesis Dr. Bertolotti Essential Question How does information flow from DNA to RNA to direct the synthesis of proteins? How does RNA differ from DNA? RNA and protein synthesis

More information