TRANSCRIPTION AND PROCESSING OF RNA
|
|
- Naomi Wilcox
- 6 years ago
- Views:
Transcription
1 TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural genes. 4. Processing of eukaryotic mrnas. 5. Particularities of transcription of trna and rrna genes in eukaryotes. 6. Transcription of mitochondrial genome. 7. Particularities of transcription in prokaryotes. All of information about organisms is stored in DNA. Realization of information is made by gene expression. Gene expression represents the conversion of genetic information encoded in a gene into RNA and protein, by transcription of a gene into RNA and (in the case of protein-coding genes) the subsequent translation of mrna to produce a protein. In both eukaryotes and prokaryotes there are some steps of gene expression. DNA replication DNA repair Genetic recombination Codons DNA transcription RNA synthesis Protein synthesis DNA RNA Protein The steps of gene expression in prokaryotic cells: - Activation and transcription of genes - Translation of mrna synthesis of proteins - Conformation post-translational modification of proteins. The steps of gene expression in eukaryotic cells: - Activation and transcription of genes - Processing of RNAs - Export of RNAs from nucleus to cytoplasm - Translation of mrna synthesis of proteins - Conformation post-translational modification of proteins. Amino acids Transcription is the first step in gene expression. Transcription represents the process of complimentary synthesis of RNA from a DNA template. Stretch of DNA that is transcribed as a single continuous RNA strand, a transcript, is called a transcription unit. A unit of transcription may contain one or more sequences encoding polypeptides (translational open reading frames (ORF) or cistrons). In prokaryotes polycistronic mrnas are common. In eukaryotes, monocistronic mrnas are the general rule, but some transcription units encode more than one polypeptide as a consequence of alternative transcriptional start sites and/or alternative pathways of RNA splicing or other types of post- transcriptional RNA processing. Components required for transcription: - DNA molecule containing regulatory (promoter, terminator) and coding sequences - RNA-polymerazes - Specific transcription factors - General transcription factors - NTP (ATP, GTP, CTP, UTP). Transcription is the principal point at which gene expression is controlled in both prokaryotes and eukaryotes. There are three steps in the process of transcription:
2 - Initiation (the most important) - Elongation - Termination Transcription and processing RNA-polymerases RNA-polymerases are enzymes which catalyze the synthesis of RNA using DNA as template. Direction of synthesis of RNA is 5' 3' and DNA is reading in direction 3' 5'. The strand of DNA which serves as template is named sense chain, and the other strand, identical with RNA, is named coding strand (Fig. 1). Fig. 1. Transcription of RNA The prokaryotic cells have only one type of RNA-polymerase, which synthesis all kinds of RNAs. The eukaryotic cells have three distinct classes of RNA-polymerases: - RNA-polymerase I the most active polymerase (50-70% of all cellular RNAs). It works in nucleolus and synthesis rrna 5,8S, 18S, 28S. - RNA-polymerase II works in nucleoplasme, synthesis mrnas and snrnas (10-40%). - RNA-polymerase III works in nucleoplasme, synthesis trnas and rrna 5S (10%). Transcription factors There are molecules (usually proteins) that mediate transcription by interaction with DNA or other proteins implicated in transcription. There are two types of transcription factors: General transcription factors are the same for all cell. Their functions: - Facilitate the interaction between promoter and RNA-polymerase - Participate in choosing of template strand and indicate direction of transcription - Unwind and rewind double helix of DNA - Prevent premature removing of RNA-polymerase from template - Assure termination of transcription. 2
3 Leading sequence Transcription and processing Specific transcription factors are specific for each kind of cells. They participate in decondensation of chromatin and bind specific to promoter, indicating Transcribed region Promoter Coding region Terminator Point of initiation of transcription Site of initiation of translation Site of termination of translation Site of polyadenilation the active one. Fig. 2. Structure of gene coding mrna in eukaryotes Particularities of transcription of mrna in eukaryotic cell Initiation Fig. 3. Initiation of transcription Fig. 2 represents the structure of gene coding for mrna. For initiation of transcription there are some events, which consist in activation of gene and beginning of transcription: - Decondesation of chromatin. Demethylation of DNA. - Interaction of specific factor of transcription with promoter. - Binding of TFIID (TBP) to TATA-box (TF Transcription Factor, II polymerase II; TBP TATA Binding Protein); - TFIIA binds upstream from the TBP. It stabilizes the complex TBP-TATA-box.; - In front of TBP binds TFIIB, which unwind DNA using ATP; - RNA-polymerase II, activated by TFIIF binds to promoter. TFIIF is a helicase, which unwind locally DNA; - After binding of factors TFIIE and TFIIH RNA-polymerase can move along the template strand of DNA; - Reading of first nucleotide from 3
4 Transcription and processing template (+1) end incorporation of first ribonucleotide, usually ATP; - Initiation is finished by formation of first phosphodiester bond in newly synthesized RNA (Fig. 3). Some distant sequences can also participate in the process of transcription. They may facilitate the recognition of promoter by RNA-polymerase (enhancer) or interfere in this process (silencer) (Fig. 4) Regulatory protein attached to enhancer Regulatory protein attached to promoter Enhancer Promoter Enhancer Promoter RNA polymeraze II Fig. 4. Interaction of enhancer (via regulatory proteins) with promoter and RNA-polymerase Elongation - From RNA-polymerase are released TFIIB and TFIIE. TFIIF and FTIIH remain attached to enzyme. - RNA polymerase II reads DNA in direction 3' 5' and polymerizes RNA in direction 5' 3' (30 bases/sec) - TFIIS prevents premature removing of RNA-polymerase - At the promoter remain attached: FTIID, FTIIA that can interact with other RNApolymerase. Fig. 5. Structure of terminator Termination In Fig. 5 is shown the structure of terminator. It contains a palindromic sequence a region in which the sequence on both strands is identical when read in an antiparallel direction. After RNA-polymerase transcripts the sequence corresponding to the terminator RNA forms a hairpin loop. RNApolymerase stops and a factor of termination rho (ρ) interact with enzyme and dissociate the complex DNA-enzyme-RNA (Fig. 6). 4
5 Transcription and processing RNA-polymerase transcribes DNA rho attaches to recognition site on RNA rho moves along RNA, following RNApolymerase RNA-polymerase pauses at terminator and rho catches up; rho unwinds DNA-RNA hybrid Termination: RNA-polymerase, rho and RNA are released Fig. 6. Termination of transcription Processing of RNA The primary transcript represents an immature RNA. Processing of RNA represents the events when the ends of RNA are modified and the non-coding sequences are removed from the pre RNA (Fig. 7). Fig. 7. The steps of processing of RNA 5
6 CAPing Transcription and processing The 5'-end of primary transcript is modified during transcription. After 30 bases were synthesized, guanilat-trasferase adds a methylated GTP by unusual bond 5'-5' to the first nucleotide of RNA (usually an Adenine). This structure ( 7 MeG 5 ppp 5 N) is named CAP. Also can be methylated the next riboses in position 2' (Fig. 8). CAP has the next functions: Stabilizes RNA due to unusual bond 5' - 5'; Represents a site of recognition for ribosome during initiation of translation. Polyadenylation After transcription the 3'-end of RNA contain a palindromic loop, which is removed by excision in the site AAUAAA. The enzyme poly(a)- Fig. 8. The structure of CAP polymerase adds residues of adenilic acid. mrna which cods for histones are not polyadenylated. Poly(A)-tail has some functions: Assures the stability of 3'-end of RNA. Molecules that contain more long tails are more stabile. Participates in passing of mrna thru nuclear envelope. Splicing Splicing represents the process of removing of introns from pre mrna and sealing of exons. This process takes place with participation of an enzymatic complex splicesome. Enzymes (U 1 -U 6 ) represent ribonucleoproteins and contain snrna. Introns are recognized by sequences GU at 5'-end and AG at 3'-end. There are some steps in the process of splicing (Fig. 9): Site GU is recognized by U 1 ; U 2 binds to an Adenine from the interior of intron (branch site); U 4,U 5,U 6 associate to U 1 and U 2 forming a loop by binding of 5'-end of intron to Adenine via an unusual bond 5' 2'; After removing of U 4 3'-end of intron is cleaved. The intron forms a lasso and is removed together with proteins U 2, U 5, U 6 ; The 3' and 5'-end of exons are sealed. Fig. 9. Splicing pre-mrnas and assembly of spliceosomes Resulting mrna is transported to the cytoplasm, where will be used as template for protein synthesis. There are some types of splicing: Constitutive splicing all introns are removed from pre mrna and exons are sealed in the same consecution as in gene. Alternative splicing in mrna remain only some of exons, and only some of introns are removed. From one gene can be synthesized more types of proteins. 6
7 Transcription and processing Exon shuffling change of consecution of exons in mrna from the position in gene. Trans-splicing exons from different pre mrna participate to make one molecule of mrna. RNA editing RNA editing is defined as a process responsible for any differences between the final sequence of a messenger RNA (mrna) and its genetically determined template. This process takes place in cytoplasm and involves adding, removing or conversion of some nucleotides. Particularities of I -st and II -nd class genes transcription Eukaryotic ribosomes contain four RNA molecules: 5S, 5,8S, 18S and 28S. In the nucleolus there are several hundred copies of transcription units which encod for 5,8S, 18S and 28S. The mammalian primary transcript of I-st class genes is a 45S RNA containing the sequences of 5,8S, 18S and 28S rrnas. During maturation, the primary transcript is cleft in 5 places, spacers are Fig 10. Transcription and processing of rrna removed and 3 types of rrna are made (Fig 10). The genes for the 5S rrna is contained in a separate transcription unit. These genes are also arranged in tandem: there are several repeating units separated by untranscribed segments (Fig. 11). This type of rrna is transcribed by RNA-polymerase III. Note that in higher eukaryotes the rrna sequences do not contain introns. Fig. 11. Organization of genes for the 5S rrna Eukaryotic trna molecules are also excised from large transcripts (called pre-trna), which may contain one or more trna sequences. During processing the introns and spacer sequences are removed, at the 3 end a specific CCA sequence is added. Transcription in mitochondria In mammalian mitochondrial genomes are very compact; they are no introns. The 13 mrna, 2 rrna and 22 trna genes are under control of two promoters: HSP and LSP. Most genes are expressed in the same direction and trna genes lie between the genes coding for rrna or protein. 12 mrna-coding, 2 rrna-coding and 14 trna-coding regions are transcribed in clockwise direction; 1 mrna-coding and 8 trna-coding regions are read counter clockwise. Beginning with 7
8 the promoter DNA is transcribed into a single transcript, from which RNAs are cleaved to release the mrnas, rrnas and trnas. Transcription and processing Transcription in prokaryotes In bacteria and other prokaryotes, several genes may be grouped together to form a single transcription unit under the control of a promoter an operon. In an operon, genes encoding, for example, the different enzymes of a metabolic pathway or the subunits of an enzyme complex, are clustered and are transcribed together into a polycistronic transcript, under the control of a single promoter. This transcript is then translated to give the individual proteins. Operons enable the rapid and efficient coordinate expression of a set of genes required to respond to a change in the external or internal environment (See Fig. 6 THE GENE). 8
30 Gene expression: Transcription
30 Gene expression: Transcription Gene structure. o Exons coding region of DNA. o Introns non-coding region of DNA. o Introns are interspersed between exons of a single gene. o Promoter region helps enzymes
More informationTranscription is the first stage of gene expression
Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the
More informationTranscription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
More informationMolecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code
Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)
More informationDNA Transcription. Dr Aliwaini
DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger
More informationTranscription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.
Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally
More informationThemes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
More informationLecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points?
BCH 401G Lecture 37 Andres Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? RNA processing: Capping, polyadenylation, splicing. Why process mammalian
More informationThe Flow of Genetic Information
Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationGENETICS - CLUTCH CH.10 TRANSCRIPTION.
!! www.clutchprep.com CONCEPT: OVERVIEW OF TRANSCRIPTION Transcription is the process of using DNA as a template to RNA RNA polymerase is the enzyme that transcribes DNA - There are many different types
More informationTranscription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
More informationTranscription. By : Lucia Dhiantika Witasari M.Biotech., Apt
Transcription By : Lucia Dhiantika Witasari M.Biotech., Apt REGULATION OF GENE EXPRESSION 11/26/2010 2 RNA Messenger RNAs (mrnas) encode the amino acid sequence of one or more polypeptides specified by
More informationGene Expression: Transcription, Translation, RNAs and the Genetic Code
Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationTranscription steps. Transcription steps. Eukaryote RNA processing
Transcription steps Initiation at 5 end of gene binding of RNA polymerase to promoter unwinding of DNA Elongation addition of nucleotides to 3 end rules of base pairing requires Mg 2+ energy from NTP substrates
More informationThere are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal.
1 2 Continuous genes - Intron: Many eukaryotic genes contain coding regions called exons and noncoding regions called intervening sequences or introns. The average human gene contains from eight to nine
More informationBiochemistry Eukaryotic Transcription
1 Description of Module Subject Name Paper Name Module Name/Title Dr. Vijaya Khader Dr. MC Varadaraj 2 1. Objectives 1. Understand and have an overview of eucaryotic transcriptional regulation. 2. Explain
More informationTRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long
Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double
More informationSIBC504: TRANSCRIPTION & RNA PROCESSING Assistant Professor Dr. Chatchawan Srisawat
SIBC504: TRANSCRIPTION & RNA PROCESSING Assistant Professor Dr. Chatchawan Srisawat TRANSCRIPTION: AN OVERVIEW Transcription: the synthesis of a single-stranded RNA from a doublestranded DNA template.
More informationComputational Biology I LSM5191 (2003/4)
Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression I Flow of information: DNA to polypeptide DNA Start Exon1 Intron Exon2 Termination
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationChapter 2. An Introduction to Genes and Genomes
PowerPoint Lectures for Introduction to Biotechnology, Second Edition William J.Thieman and Michael A.Palladino Chapter 2 An Introduction to Genes and Genomes Lectures by Lara Dowland Chapter Contents
More informationCH 17 :From Gene to Protein
CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there
More informationI. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
More informationTranscription and Post Transcript Modification
Transcription and Post Transcript Modification You Should Be Able To 1. Describe transcription. 2. Compare and contrast eukaryotic + prokaryotic transcription. 3. Explain mrna processing in eukaryotes.
More informationChapter 3. DNA, RNA, and Protein Synthesis
Chapter 3. DNA, RNA, and Protein Synthesis 4. Transcription Gene Expression Regulatory region (promoter) 5 flanking region Upstream region Coding region 3 flanking region Downstream region Transcription
More informationNucleic Acids and the Encoding of Biological Information. Chapter 3
Nucleic Acids and the Encoding of Biological Information Chapter 3 GRIFFITH S EXPERIMENT ON THE NATURE OF THE GENETIC MATERIAL In 1928, Frederick Griffith demonstrated that molecules can transfer genetic
More informationChapter 12: Molecular Biology of the Gene
Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,
More informationFrom Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,
From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationChapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why?
Slide 1 Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationProtein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
More informationBiotechnology Unit 3: DNA to Proteins. From DNA to RNA
From DNA to RNA Biotechnology Unit 3: DNA to Proteins I. After the discovery of the structure of DNA, the major question remaining was how does the stored in the 4 letter code of DNA direct the and of
More informationThe discovery of the role of RNA RNA structure, synthesis and function
Central Dogma The discovery of the role of RNA RNA structure, synthesis and function! Fundamental observations in genetics!! Genes are located in nuclei (in eukaryotes)!! Polypeptides are synthesised in
More informationGene Expression: Transcription
Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make
More informationChapter 14: From DNA to Protein
Chapter 14: From DNA to Protein Steps from DNA to Proteins Same two steps produce all proteins: 1) DNA is transcribed to form RNA Occurs in the nucleus RNA moves into cytoplasm 2) RNA is translated in
More informationRegulation of bacterial gene expression
Regulation of bacterial gene expression Gene Expression Gene Expression: RNA and protein synthesis DNA ----------> RNA ----------> Protein transcription translation! DNA replication only occurs in cells
More informationM1 - Biochemistry. Nucleic Acid Structure II/Transcription I
M1 - Biochemistry Nucleic Acid Structure II/Transcription I PH Ratz, PhD (Resources: Lehninger et al., 5th ed., Chapters 8, 24 & 26) 1 Nucleic Acid Structure II/Transcription I Learning Objectives: 1.
More informationThe gene. Fig. 1. The general structure of gene
The gene is the basic unit of heredity and carries the genetic information for a given protein and/or RNA molecule. In biochemical terms a gene represents a fragment of deoxyribonucleic acid (DNA), which
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by
More informationBIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 12 Transcription
BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 12 Transcription 2 3 4 5 Are You Getting It?? Which are general characteristics of transcription? (multiple answers) a) An entire DNA molecule is transcribed
More informationGene function at the level of traits Gene function at the molecular level
Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines
More informationBIO 311C Spring Lecture 36 Wednesday 28 Apr.
BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through
More informationTranscription & RNA Processing
Chapter 10. Transcription & RNA Processing 1. Transfer of Genetic Information: the Central Dogma 2. The Process of Gene Expression 3. Transcription & RNA Processing in Eukaryotes 4. Interrupted Genes in
More informationAnalyzed Fungi Neurospora crassa mutants. Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated:
From Gene to Protein Beadle and Tatum Analyzed Fungi Neurospora crassa mutants Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated: Precursor Ornithine
More informationProofreading, post-replication modification of DNA. Mitesh Shrestha
Proofreading, post-replication modification of DNA Mitesh Shrestha Proofreading During DNA replication (copying), most DNA polymerases can check their work with each base that they add. This process is
More informationGenes and How They Work. Chapter 15
Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central
More informationResources. This lecture Campbell and Farrell's Biochemistry, Chapter 11
Transcription Resources This lecture Campbell and Farrell's Biochemistry, Chapter 11 2 Definition of a gene The entire nucleic acid sequence that is necessary for the synthesis of a functional polypeptide
More informationDNA Replication and Repair
DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands
More informationA. Incorrect! This feature does help with it suitability as genetic material.
College Biology - Problem Drill 08: Gene Structures and Functions No. 1 of 10 1. Which of the statements below is NOT true in explaining why DNA is a suitable genetic material? #01 (A) Its double helix
More informationChapter 11. Transcription. The biochemistry and molecular biology department of CMU
Chapter 11 Transcription The biochemistry and molecular biology department of CMU Transcription The synthesis of RNA molecules using DNA strands as the templates so that the genetic information can be
More informationDNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
More informationFrom Gene to Protein. Chapter 17
From Gene to Protein Chapter 17 What you need to know: The key terms: gene expression, transcription, and translation. The major events of transcription. How eukaryotic cells modify RNA after transcription.
More informationDNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks.
DNA REPLICATION 5 4 Phosphate 3 DNA structure Nitrogenous base 1 Deoxyribose 2 Nucleotide DNA strand = DNA polynucleotide 2004 Biology Olympiad Preparation Program 2 2004 Biology Olympiad Preparation Program
More informationRNA Expression of the information in a gene generally involves production of an RNA molecule transcribed from a DNA template. RNA differs from DNA
RNA Expression of the information in a gene generally involves production of an RNA molecule transcribed from a DNA template. RNA differs from DNA that it has a hydroxyl group at the 2 position of the
More informationTranscription & post transcriptional modification
Transcription & post transcriptional modification Transcription The synthesis of RNA molecules using DNA strands as the templates so that the genetic information can be transferred from DNA to RNA Similarity
More information9/3/2009. DNA RNA Proteins. DNA Genetic program RNAs Ensure synthesis of proteins Proteins Ensure all cellular functions Carbohydrates (sugars) Energy
Structure Properties Functions of the cell Chemical organization of the cell Based on molecular substrate : DNA contains information RNA ensures protein synthesis Proteins ensure vitality Relations between
More informationChapter 17. From Gene to Protein
Chapter 17 From Gene to Protein One Gene One Enzyme Hypothesis Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria Beadle
More informationFROM GENE TO PROTEIN. One Gene One Enzyme Hypothesis 3/12/2013. Basic Principles of Transcription & Translation
One Gene One Enzyme Hypothesis FROM GENE TO PROTEIN C H A P T E R 1 7 Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria
More informationThe Structure of RNA. The Central Dogma
12-3 12-3 RNA and Protein Synthesis The Structure of RNA The Central Dogma Phenotype A gene is a SEQUENCE of DNA that codes for a protein (or functional RNA). Phenotype is the individual s observable trait
More informationDNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses.
Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Genetic information is encoded as a sequence of nucleotides (guanine,
More informationFermentation. Lesson Overview. Lesson Overview 13.1 RNA
13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to
More informationCh. 10 From DNA to Protein. AP Biology
Ch. 10 From DNA to Protein Protein Synthesis Metabolism and Gene Expression n Inheritance of metabolic diseases suggests that genes coded for enzymes n Diseases (phenotypes) caused by non-functional gene
More informationUnit IX Problem 3 Genetics: Basic Concepts in Molecular Biology
Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated to synthesize
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationWe can now identify three major pathways of information flow in the cell (in replication, information passes from one DNA molecule to other DNA
1 We can now identify three major pathways of information flow in the cell (in replication, information passes from one DNA molecule to other DNA molecules; in transcription, information passes from DNA
More informationMolecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.
Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions
More informationTranscription. DNA to RNA
Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationLesson 8. DNA: The Molecule of Heredity. Gene Expression and Regulation. Introduction to Life Processes - SCI 102 1
Lesson 8 DNA: The Molecule of Heredity Gene Expression and Regulation Introduction to Life Processes - SCI 102 1 Genes and DNA Hereditary information is found in discrete units called genes Genes are segments
More informationChapter 17. From Gene to Protein
Chapter 17 From Gene to Protein Overview: The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific
More informationChapter 6: Transcription and RNA Processing in Eukaryotes
3. Basic Genetics Plant Molecular Biology Chapter 6: Transcription and RNA Processing in Eukaryotes - Genetic organization in eukaryote - Transcription in eukaryote - - RNA processing in eukaryote - Translation
More informationFrom Gene to Protein
Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp
More informationDelve AP Biology Lecture 7: 10/30/11 Melissa Ko and Anne Huang
Today s Agenda: I. DNA Structure II. DNA Replication III. DNA Proofreading and Repair IV. The Central Dogma V. Transcription VI. Post-transcriptional Modifications Delve AP Biology Lecture 7: 10/30/11
More informationDNA Evolution of knowledge about gene. Contains information about RNAs and proteins. Polynucleotide chains; Double stranded molecule;
Evolution of knowledge about gene G. Mendel Hereditary factors W.Johannsen, 1909 G.W.Beadle, E.L.Tatum, 1945 Ingram, 1957 Actual concepts The gene hereditary unit located in chromosomes Hypotheses One
More informationCHapter 14. From DNA to Protein
CHapter 14 From DNA to Protein How? DNA to RNA to Protein to Trait Types of RNA 1. Messenger RNA: carries protein code or transcript 2. Ribosomal RNA: part of ribosomes 3. Transfer RNA: delivers amino
More informationVideos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
More informationThe Structure of Proteins The Structure of Proteins. How Proteins are Made: Genetic Transcription, Translation, and Regulation
How Proteins are Made: Genetic, Translation, and Regulation PLAY The Structure of Proteins 14.1 The Structure of Proteins Proteins - polymer amino acids - monomers Linked together with peptide bonds A
More informationBig Idea 3C Basic Review
Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end
More informationRNA : functional role
RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying
More informationInformation Readout: Transcription and Post-transcriptional Processing Translation
Information Readout: Transcription and Post-transcriptional Processing Translation Copyright 2013 Pearson Canada Inc. 27-1 DNA as the Template for RNA Synthesis Enzymology of RNA Synthesis: RNA Polymerase
More informationCh 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
More informationUnit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression
Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationChapters 31-32: Ribonucleic Acid (RNA)
Chapters 31-32: Ribonucleic Acid (RNA) Short segments from the transcription, processing and translation sections of each chapter Slide 1 RNA In comparison with DNA RNA utilizes uracil in place of thymine
More informationPrinciple 2. Overview of Central. 3. Nucleic Acid Structure 4. The Organization of
Central dogma I and II the flow of genetic information 1. The Transforming Principle 2. Overview of Central Dogma 3. Nucleic Acid Structure 4. The Organization of DNA in Cells 5. DNA Replication 6. Gene
More informationThe Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot
The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino
More informationBEADLE & TATUM EXPERIMENT
FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in
More informationClasses of eukaryotic cellular RNAs
Classes of eukaryotic cellular RNAs ribosomal RNA (rrna) 18S (small subunit) 28S (large subunit) 5.8S (large subunit) 5S (large subunit) transfer RNA (trna) messenger RNA (mrna) heterogeneous nuclear RNA
More informationVideos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
More informationLesson Overview. Fermentation 13.1 RNA
13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA
More informationEukaryotic & Prokaryotic Transcription. RNA polymerases
Eukaryotic & Prokaryotic Transcription RNA polymerases RNA Polymerases A. E. coli RNA polymerase 1. core enzyme = ββ'(α)2 has catalytic activity but cannot recognize start site of transcription ~500,000
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationFigure A summary of spontaneous alterations likely to require DNA repair.
DNA Damage Figure 5-46. A summary of spontaneous alterations likely to require DNA repair. The sites on each nucleotide that are known to be modified by spontaneous oxidative damage (red arrows), hydrolytic
More informationBis2A 12.0 Transcription *
OpenStax-CNX module: m56068 1 Bis2A 12.0 Transcription * Mitch Singer Based on Transcription by OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License
More informationFeedback D. Incorrect! No, although this is a correct characteristic of RNA, this is not the best response to the questions.
Biochemistry - Problem Drill 23: RNA No. 1 of 10 1. Which of the following statements best describes the structural highlights of RNA? (A) RNA can be single or double stranded. (B) G-C pairs have 3 hydrogen
More information