Network System Inference

Size: px
Start display at page:

Download "Network System Inference"

Transcription

1 Network System Inference Francis J. Doyle III University of California, Santa Barbara Douglas Lauffenburger Massachusetts Institute of Technology WTEC Systems Biology Final Workshop March 11, 2005 What is Systems Inference? Estimation of interactions of elements in a network given time series data of activities of different nodes (e.g., gene interactions from expression data) Goals Hypothesis generation Design of experiment Understanding cellular function Unravel design principles Data sources Large scale deletion projects DNA microarray ChiP Assay 1

2 Spectrum of Network Modeling [Stelling, 2005] Complexity Gene-Protein Sequence Protein biochemistry Cell dynamics Coverage Genomics Systems analysis of networks 2

3 Network Model Identification Problem Basic transcription model ( ) log Y eg = α fg X ef + n eg f F( g) e = experiment, f = factor, g = gene X = TF level, Y = expression, α = connection strength F = connection knowledge (i.e., localization constraint) not considering details of clustering methods, etc. Basic signal transduction model Rate of generation x& =Ω + Sr µ x gen (, ) r = f x p Rate of degradation Rate of inter-conversion Applications of Network Inference Metabolic networks Signaling networks Development models Gene regulatory networks Physical interaction networks 3

4 Tools and Mathematical Approaches Many Approaches Boolean networks + optimization [Ideker et al., 2000] Signed directed graphs + graph theory (SDGs) [Kyoda et al., 2000] Bayesian networks + machine learning [Pe er et al., 2001] Acyclic graphs + graph theory [Wagner, 2001] S-functions + decomposition [Kimura et al., 2004] Technical refinements that are promising innovations Exploit sparsity Exploit modularity Refined design of experiment Representations S-functions, Bayesian nets, SDGs, etc. Motifs and Modules Interconnection of function, dynamics & network topology Role in robustness compensation [Stelling et al., 2004] Recurring regulatory motifs Switches, oscillators, filters, memory, amplifiers [Wolf & Arkin, 2000] Technical approaches Pattern matching Constrained optimization Others Modules Larger size, inter-connectivity, autonomy Confers: robustness evolvability [Lee et al., 2002; Shen-Orr et al., 2002] 4

5 Modules in Yeast Molecular Network [Tanay et al., 2004] Issue of Dynamics Largely static interactions maps are constructed Explosion of parameters for dynamic network models Limited dynamic data available Isolated exceptions circadian rhythm work of Ueda (RIKEN, Kobe) [Ueda et al., Nature Genetics, 2005] 5

6 Iterations Between Models and Experiments Very few groups report studies with multiple modelexperiment iterations e.g., Klingmüller (Germany), Nobel (UK) Convergence is an issue Reporting modeling failures is an issue Multiple groups are at an early stage Important issues Model validation/invalidation Identifiability Design of experiment [Kitano, 2002] Validation, Verification, Consistency, etc. Validation or verification is critical step in any model identification problem [Ljung, 1999] Matching of data (to date): consistency In practice, only invalidation is possible [Poolla et al., 1994] Contradiction w/ data is often the most valuable role of a model Model discrimination can suggest new experiments Competing hypotheses can be resolved Data sets can be invalidated Various statistical tools for model invalidation Measure of error Confidence intervals Likelihood ratios 6

7 Identifiability Issues General questions [Ljung, 1999] Will identification procedure yield unique parameter set? Is resulting model equal to true system? Can experimental conditions lead to model discrimination? Design of experiment issues inputs (ligand, environmental, knockouts, etc.) measurements (localization information, expression, etc.) perturbation richness ; duration of experiment; sampling protocol Few applications in biological network inference Statistical mechanics approaches [Brown & Sethna, 2003] Formal identifiability of gene networks [Zak et al., 2003] Design of experiment [Faller, et al., 2003] Measurement selection [Stelling & Gilles, 2005] Role of Perturbations vs. Data [Stelling & Gilles, MPI, Magdeburg, Germany] 7

8 Regional Highlights - Japan Kitano Lab Systems Biology Markup Language [SBML] Difference-based regulation finding-minimum equivalent gene network RIKEN Cooperativity coevolutionary inference algorithm Receptor Tyrosine Kinase Regulatory Networks Consortium Ueda lab profiling of circadian regulation Miyano Lab (U. Tokyo) Bayesian networks and non-parametric regression for yeast gene networks Collaboration with pharma company for drug studies Computational Biology Research Center Gene regulatory network inference (lung cancer studies) KEGG (U. Kyoto) Portability of network data SBML, GON, etc. Reconstruction of networks via kernel methods (incl. dynamics) Ito Lab (U. Tokyo) Heterogeneous measurements for network inference (MS proteomics, FRET metabolomics, ChiP & GATC-PCR TF-binding, MS phosphorylation, MS protein complex) Regional Highlights - Europe MPI Dynamics of Complex Systems Design of experiment, model iterations, identifiability, perturbations Collaborative Research Center for Theoretical Biology (Humboldt U.) Dynamic modeling, driving new microarray data applied to Ras pathway German Cancer Research Center Klingmueller: design of experiment, novel hypothesis testing, model discrimination application to Jak/STAT pathway to predict unobservable behaviors Reuss: Bioinformatics studies of cytochrome p450 Oxford University Center for Mathematical Biology (Armitage): bottom-up approach to pathway analysis in histidine sensing Dept. of Physiology (Noble): challenging the bottom-up approach, advocating a combination that starts in the middle 8

9 General Observations Problems Many people using limited data to regress lots of coefficients Little true validation out there Limited success with dynamic network inference Promise Many, many approaches to fit models to data ( regression ) Motifs and modules (structure) are being factored into inference methods Nicer interplay possible between network modelers (static) and dynamic modelers with portability of tools and data Lots of curricular development in this area (bioinformatics) 9

Experimental / Data Technology

Experimental / Data Technology Experimental / Data Technology Fumiaki Katagiri Univ. of Minnesota Dept. of Plant Biology Center for Microbial and Plant Genomics Adam Arkin Howard Hughes Medical Institue Department of Bioengineering

More information

CS 5984: Topics and Schedule

CS 5984: Topics and Schedule CS 5984: and Schedule T. M. Murali January 19, 2006 T. M. Murali January 19, 2006 CS 5984: and Schedule Continuum of Models in Systems Biology From Building with a scaffold: emerging strategies for high-

More information

BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM)

BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM) BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM) PROGRAM TITLE DEGREE TITLE Master of Science Program in Bioinformatics and System Biology (International Program) Master of Science (Bioinformatics

More information

ECS 234: Genomic Data Integration ECS 234

ECS 234: Genomic Data Integration ECS 234 : Genomic Data Integration Heterogeneous Data Integration DNA Sequence Microarray Proteomics >gi 12004594 gb AF217406.1 Saccharomyces cerevisiae uridine nucleosidase (URH1) gene, complete cds ATGGAATCTGCTGATTTTTTTACCTCACGAAACTTATTAAAACAGATAATTTCCCTCATCTGCAAGGTTG

More information

Uncovering differentially expressed pathways with protein interaction and gene expression data

Uncovering differentially expressed pathways with protein interaction and gene expression data The Second International Symposium on Optimization and Systems Biology (OSB 08) Lijiang, China, October 31 November 3, 2008 Copyright 2008 ORSC & APORC, pp. 74 82 Uncovering differentially expressed pathways

More information

BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology. Lecture 2: Microarray analysis

BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology. Lecture 2: Microarray analysis BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology Lecture 2: Microarray analysis Genome wide measurement of gene transcription using DNA microarray Bruce Alberts, et al., Molecular Biology

More information

Bayesian Variable Selection and Data Integration for Biological Regulatory Networks

Bayesian Variable Selection and Data Integration for Biological Regulatory Networks Bayesian Variable Selection and Data Integration for Biological Regulatory Networks Shane T. Jensen Department of Statistics The Wharton School, University of Pennsylvania stjensen@wharton.upenn.edu Gary

More information

Engineering Genetic Circuits

Engineering Genetic Circuits Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art

More information

From Proteomics to Systems Biology. Integration of omics - information

From Proteomics to Systems Biology. Integration of omics - information From Proteomics to Systems Biology Integration of omics - information Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - data What

More information

Towards Gene Network Estimation with Structure Learning

Towards Gene Network Estimation with Structure Learning Proceedings of the Postgraduate Annual Research Seminar 2006 69 Towards Gene Network Estimation with Structure Learning Suhaila Zainudin 1 and Prof Dr Safaai Deris 2 1 Fakulti Teknologi dan Sains Maklumat

More information

Research proposal. Title: Development and Implementation of a Data Model for Pathway Mapping. Student: Linghao Yi

Research proposal. Title: Development and Implementation of a Data Model for Pathway Mapping. Student: Linghao Yi Research proposal Title: Development and Implementation of a Data Model for Pathway Mapping Student: Linghao Yi Supervisors: Kevin Robertson Muriel Mewissen Peter Ghazal Douglas Armstrong (GTI), (GTI),

More information

Protein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger

Protein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger Protein-Protein-Interaction Networks Ulf Leser, Samira Jaeger This Lecture Protein-protein interactions Characteristics Experimental detection methods Databases Protein-protein interaction networks Ulf

More information

Inferring Gene Networks from Microarray Data using a Hybrid GA p.1

Inferring Gene Networks from Microarray Data using a Hybrid GA p.1 Inferring Gene Networks from Microarray Data using a Hybrid GA Mark Cumiskey, John Levine and Douglas Armstrong johnl@inf.ed.ac.uk http://www.aiai.ed.ac.uk/ johnl Institute for Adaptive and Neural Computation

More information

Protein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger

Protein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger Protein-Protein-Interaction Networks Ulf Leser, Samira Jaeger This Lecture Protein-protein interactions Characteristics Experimental detection methods Databases Biological networks Ulf Leser: Introduction

More information

Microarrays & Gene Expression Analysis

Microarrays & Gene Expression Analysis Microarrays & Gene Expression Analysis Contents DNA microarray technique Why measure gene expression Clustering algorithms Relation to Cancer SAGE SBH Sequencing By Hybridization DNA Microarrays 1. Developed

More information

Technical University of Denmark

Technical University of Denmark 1 of 13 Technical University of Denmark Written exam, 15 December 2007 Course name: Introduction to Systems Biology Course no. 27041 Aids allowed: Open Book Exam Provide your answers and calculations on

More information

Random matrix analysis for gene co-expression experiments in cancer cells

Random matrix analysis for gene co-expression experiments in cancer cells Random matrix analysis for gene co-expression experiments in cancer cells OIST-iTHES-CTSR 2016 July 9 th, 2016 Ayumi KIKKAWA (MTPU, OIST) Introduction : What is co-expression of genes? There are 20~30k

More information

ECS 234: Introduction to Computational Functional Genomics ECS 234

ECS 234: Introduction to Computational Functional Genomics ECS 234 : Introduction to Computational Functional Genomics Administrativia Prof. Vladimir Filkov 3023 Kemper filkov@cs.ucdavis.edu Appts: Office Hours: M,W, 3-4pm, and by appt. , 4 credits, CRN: 54135 http://www.cs.ucdavis.edu~/filkov/234/

More information

Outline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information

Outline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information From to Systems Biology Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - What can we learn Limitations Integration of omics - In-class

More information

Data representation for clinical data and metadata

Data representation for clinical data and metadata Data representation for clinical data and metadata WP1: Data representation for clinical data and metadata Inconsistent terminology creates barriers to identifying common clinical entities in disparate

More information

Computational Biology

Computational Biology 3.3.3.2 Computational Biology Today, the field of Computational Biology is a well-recognised and fast-emerging discipline in scientific research, with the potential of producing breakthroughs likely to

More information

Inferring Cellular Networks Using Probabilis6c Graphical Models. Jianlin Cheng, PhD University of Missouri 2010

Inferring Cellular Networks Using Probabilis6c Graphical Models. Jianlin Cheng, PhD University of Missouri 2010 Inferring Cellular Networks Using Probabilis6c Graphical Models Jianlin Cheng, PhD University of Missouri 2010 Bayesian Network So@ware hap://www.cs.ubc.ca/~murphyk/so@ware/ BNT/bnso@.html Demo References

More information

Learning theory: SLT what is it? Parametric statistics small number of parameters appropriate to small amounts of data

Learning theory: SLT what is it? Parametric statistics small number of parameters appropriate to small amounts of data Predictive Genomics, Biology, Medicine Learning theory: SLT what is it? Parametric statistics small number of parameters appropriate to small amounts of data Ex. Find mean m and standard deviation s for

More information

Design Principles in Synthetic Biology

Design Principles in Synthetic Biology Design Principles in Synthetic Biology Chris Myers 1, Nathan Barker 2, Hiroyuki Kuwahara 3, Curtis Madsen 1, Nam Nguyen 1, Michael Samoilov 4, and Adam Arkin 4 1 University of Utah 2 Southern Utah University

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru

More information

PREDICTION AND SIMULATION OF MULTI-TARGET THERAPIES FOR TRIPLE NEGATIVE BREAST CANCER THROUGH A NETWORK-BASED DATA INTEGRATION APPROACH

PREDICTION AND SIMULATION OF MULTI-TARGET THERAPIES FOR TRIPLE NEGATIVE BREAST CANCER THROUGH A NETWORK-BASED DATA INTEGRATION APPROACH University of Pavia Dep. of Electrical, Computer and Biomedical Engineering PREDICTION AND SIMULATION OF MULTI-TARGET THERAPIES FOR TRIPLE NEGATIVE BREAST CANCER THROUGH A NETWORK-BASED DATA INTEGRATION

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/

More information

Proteomics. Manickam Sugumaran. Department of Biology University of Massachusetts Boston, MA 02125

Proteomics. Manickam Sugumaran. Department of Biology University of Massachusetts Boston, MA 02125 Proteomics Manickam Sugumaran Department of Biology University of Massachusetts Boston, MA 02125 Genomic studies produced more than 75,000 potential gene sequence targets. (The number may be even higher

More information

ROAD TO STATISTICAL BIOINFORMATICS CHALLENGE 1: MULTIPLE-COMPARISONS ISSUE

ROAD TO STATISTICAL BIOINFORMATICS CHALLENGE 1: MULTIPLE-COMPARISONS ISSUE CHAPTER1 ROAD TO STATISTICAL BIOINFORMATICS Jae K. Lee Department of Public Health Science, University of Virginia, Charlottesville, Virginia, USA There has been a great explosion of biological data and

More information

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods

More information

Computational Genomics. Reconstructing signaling and dynamic regulatory networks

Computational Genomics. Reconstructing signaling and dynamic regulatory networks 02-710 Computational Genomics Reconstructing signaling and dynamic regulatory networks Input Output Hidden Markov Model Input (Static transcription factorgene interactions) Bengio and Frasconi, NIPS 1995

More information

ECS 234: Introduction to Computational Functional Genomics ECS 234

ECS 234: Introduction to Computational Functional Genomics ECS 234 : Introduction to Computational Functional Genomics Administrativia Prof. Vladimir Filkov 3023 Kemper filkov@cs.ucdavis.edu Appts: Office Hours: Wednesday, 1:30-3p Ask me or email me any time for appt

More information

Including prior knowledge in shrinkage classifiers for genomic data

Including prior knowledge in shrinkage classifiers for genomic data Including prior knowledge in shrinkage classifiers for genomic data Jean-Philippe Vert Jean-Philippe.Vert@mines-paristech.fr Mines ParisTech / Curie Institute / Inserm Statistical Genomics in Biomedical

More information

Microarray Informatics

Microarray Informatics Microarray Informatics Donald Dunbar MSc Seminar 31 st January 2007 Aims To give a biologist s view of microarray experiments To explain the technologies involved To describe typical microarray experiments

More information

Capabilities & Services

Capabilities & Services Capabilities & Services Accelerating Research & Development Table of Contents Introduction to DHMRI 3 Services and Capabilites: Genomics 4 Proteomics & Protein Characterization 5 Metabolomics 6 In Vitro

More information

CMSE 520 BIOMOLECULAR STRUCTURE, FUNCTION AND DYNAMICS

CMSE 520 BIOMOLECULAR STRUCTURE, FUNCTION AND DYNAMICS CMSE 520 BIOMOLECULAR STRUCTURE, FUNCTION AND DYNAMICS (Computational Structural Biology) OUTLINE Review: Molecular biology Proteins: structure, conformation and function(5 lectures) Generalized coordinates,

More information

Bayesian Networks as framework for data integration

Bayesian Networks as framework for data integration Bayesian Networks as framework for data integration Jun Zhu, Ph. D. Department of Genomics and Genetic Sciences Icahn Institute of Genomics and Multiscale Biology Icahn Medical School at Mount Sinai New

More information

The application of hidden markov model in building genetic regulatory network

The application of hidden markov model in building genetic regulatory network J. Biomedical Science and Engineering, 2010, 3, 633-637 doi:10.4236/bise.2010.36086 Published Online June 2010 (http://www.scirp.org/ournal/bise/). The application of hidden markov model in building genetic

More information

Inference of Gene Relations from Microarray Data by Abduction

Inference of Gene Relations from Microarray Data by Abduction Inference of Gene Relations from Microarray Data by Abduction Irene Papatheodorou, Antonis Kakas, and Marek Sergot Department of Computing, Imperial College London, SW7 2AZ, UK Abstract. We describe an

More information

CS 5854: Predictive Models of Transcriptional Regulatory Networks

CS 5854: Predictive Models of Transcriptional Regulatory Networks CS 5854: Predictive Models of Transcriptional Regulatory Networks T. M. Murali February 28, Mar 5, 7, 2013 Predicting Transcriptional Control Networks 1. Integrated biclustering of heterogeneous genome-wide

More information

Computational Genomics. Regulatory Machinery of Gene Expression

Computational Genomics. Regulatory Machinery of Gene Expression Computational Genomics 10-810/02 810/02-710, Spring 2009 Biology Background II Molecular Biology, Development, and Genetics Eric Xing Lecture 2, January 14, 2009 Reading: Chap. 1, DTM book Eric Xing @

More information

Machine learning applications in genomics: practical issues & challenges. Yuzhen Ye School of Informatics and Computing, Indiana University

Machine learning applications in genomics: practical issues & challenges. Yuzhen Ye School of Informatics and Computing, Indiana University Machine learning applications in genomics: practical issues & challenges Yuzhen Ye School of Informatics and Computing, Indiana University Reference Machine learning applications in genetics and genomics

More information

Bioinformatics : Gene Expression Data Analysis

Bioinformatics : Gene Expression Data Analysis 05.12.03 Bioinformatics : Gene Expression Data Analysis Aidong Zhang Professor Computer Science and Engineering What is Bioinformatics Broad Definition The study of how information technologies are used

More information

Embeddable Sensor/Actuator Networks for Biological Systems

Embeddable Sensor/Actuator Networks for Biological Systems Embeddable Sensor/Actuator Networks for Biological Systems Networks of sensors and actuators that can be interfaced with biological systems at the cellular and molecular scales. Real-time, label-free sensing

More information

Examination Assignments

Examination Assignments Bioinformatics Institute of India H-109, Ground Floor, Sector-63, Noida-201307, UP. INDIA Tel.: 0120-4320801 / 02, M. 09818473366, 09810535368 Email: info@bii.in, Website: www.bii.in INDUSTRY PROGRAM IN

More information

Machine Learning. HMM applications in computational biology

Machine Learning. HMM applications in computational biology 10-601 Machine Learning HMM applications in computational biology Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Biological data is rapidly

More information

Identifying Signaling Pathways. BMI/CS 776 Spring 2016 Anthony Gitter

Identifying Signaling Pathways. BMI/CS 776  Spring 2016 Anthony Gitter Identifying Signaling Pathways BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2016 Anthony Gitter gitter@biostat.wisc.edu Goals for lecture Challenges of integrating high-throughput assays Connecting relevant

More information

The Two-Hybrid System

The Two-Hybrid System Encyclopedic Reference of Genomics and Proteomics in Molecular Medicine The Two-Hybrid System Carolina Vollert & Peter Uetz Institut für Genetik Forschungszentrum Karlsruhe PO Box 3640 D-76021 Karlsruhe

More information

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology. G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic

More information

Loosely Coupled Architecture for Bio-Network Reverse Engineering

Loosely Coupled Architecture for Bio-Network Reverse Engineering The First International Symposium on Optimization and Systems Biology (OSB 07) Beijing, China, August 8 10, 2007 Copyright 2007 ORSC & APORC pp. 13 20 Loosely Coupled Architecture for Bio-Network Reverse

More information

Experimental Techniques 2

Experimental Techniques 2 Experimental Techniques 2 High-throughput interaction detection Yeast two-hybrid - pairwise organisms as machines to learn about organisms yeast, worm, fly, human,... low intersection between repeated

More information

Biology 644: Bioinformatics

Biology 644: Bioinformatics Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....

More information

Biomedical Sciences Graduate Program

Biomedical Sciences Graduate Program 1 of 6 Graduate School 250 University Hall 230 North Oval Mall Columbus, OH 43210-1366 January 11, 2013 Phone (614) 292-6031 Fax (614) 292-3656 Jeff Parvin, Joanna Groden Co-Graduate Studies Chairs Biomedical

More information

Protein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger

Protein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger Protein-Protein-Interaction Networks Ulf Leser, Samira Jaeger SHK Stelle frei Ab 1.9.2015, 2 Jahre, 41h/Monat Verbundprojekt MaptTorNet: Pankreatische endokrine Tumore Insb. statistische Aufbereitung und

More information

Our view on cdna chip analysis from engineering informatics standpoint

Our view on cdna chip analysis from engineering informatics standpoint Our view on cdna chip analysis from engineering informatics standpoint Chonghun Han, Sungwoo Kwon Intelligent Process System Lab Department of Chemical Engineering Pohang University of Science and Technology

More information

MANIFESTO OF STUDIES 2012

MANIFESTO OF STUDIES 2012 MANIFESTO OF STUDIES 2012 1st YEAR Course Teacher Hours Synopsis Evaluation procedure Laboratory Safety Course (Mandatory) Prof. Mancini I. Dr. Provenzani A. 12 General Laboratory Procedures, Equipment

More information

From Bench to Bedside: Role of Informatics. Nagasuma Chandra Indian Institute of Science Bangalore

From Bench to Bedside: Role of Informatics. Nagasuma Chandra Indian Institute of Science Bangalore From Bench to Bedside: Role of Informatics Nagasuma Chandra Indian Institute of Science Bangalore Electrocardiogram Apparent disconnect among DATA pieces STUDYING THE SAME SYSTEM Echocardiogram Chest sounds

More information

VALLIAMMAI ENGINEERING COLLEGE

VALLIAMMAI ENGINEERING COLLEGE VALLIAMMAI ENGINEERING COLLEGE SRM Nagar, Kattankulathur 603 203 DEPARTMENT OF COMPUTER SCIENCE AND ENGINEERING QUESTION BANK VII SEMESTER BM6005 BIO INFORMATICS Regulation 2013 Academic Year 2018-19 Prepared

More information

Research Powered by Agilent s GeneSpring

Research Powered by Agilent s GeneSpring Research Powered by Agilent s GeneSpring Agilent Technologies, Inc. Carolina Livi, Bioinformatics Segment Manager Research Powered by GeneSpring Topics GeneSpring (GS) platform New features in GS 13 What

More information

Learning Bayesian Network Models of Gene Regulation

Learning Bayesian Network Models of Gene Regulation Learning Bayesian Network Models of Gene Regulation CIBM Retreat October 3, 2003 Keith Noto Mark Craven s Group University of Wisconsin-Madison CIBM Retreat 2003 Poster Session p.1/18 Abstract Our knowledge

More information

CS 6824: New Directions in Computational Systems Biology

CS 6824: New Directions in Computational Systems Biology CS 6824: New Directions in Computational Systems Biology T. M. Murali January 19, 2011 Course Structure Discuss state-of-the-art research papers. Course Structure Lectures Discuss state-of-the-art research

More information

IPA Advanced Training Course

IPA Advanced Training Course IPA Advanced Training Course Academia Sinica 2015 Oct Gene( 陳冠文 ) Supervisor and IPA certified analyst 1 Review for Introductory Training course Searching Building a Pathway Editing a Pathway for Publication

More information

SIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology.

SIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology. SIMS2003 Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School Introduction to Microarray Technology. Lecture 1 I. EXPERIMENTAL DETAILS II. ARRAY CONSTRUCTION III. IMAGE ANALYSIS Lecture

More information

/ Computational Genomics. Time series analysis

/ Computational Genomics. Time series analysis 10-810 /02-710 Computational Genomics Time series analysis Expression Experiments Static: Snapshot of the activity in the cell Time series: Multiple arrays at various temporal intervals Time Series Examples:

More information

China National Grid --- BioNode. Jun Wang Beijing Genomics Institute

China National Grid --- BioNode. Jun Wang Beijing Genomics Institute China National Grid --- BioNode Jun Wang Beijing Genomics Institute Core of life science and bio-tech: Getting, Mining, Applying the basic life information Old China meets New China? Sequencing, sequencing,

More information

MANIFESTO OF STUDIES 2013

MANIFESTO OF STUDIES 2013 MANIFESTO OF STUDIES 2013 1st YEAR - MANDATORY COURSES - Course Teacher Hours Synopsis Evaluation procedure Laboratory Safety Course (Mandatory) Prof. Mancini I. Dr. Provenzani A. 12 General Laboratory

More information

Short Course Instructors

Short Course Instructors Short Course Instructors Andrew Allen, Ph.D., Professor of Biostatistics and Bioinformatics and Director of the new Duke Center of Statistical Genetics and Genomics, Duke University, has expertise in statistical

More information

Statistical Methods for Network Analysis of Biological Data

Statistical Methods for Network Analysis of Biological Data The Protein Interaction Workshop, 8 12 June 2015, IMS Statistical Methods for Network Analysis of Biological Data Minghua Deng, dengmh@pku.edu.cn School of Mathematical Sciences Center for Quantitative

More information

Péter Antal Ádám Arany Bence Bolgár András Gézsi Gergely Hajós Gábor Hullám Péter Marx András Millinghoffer László Poppe Péter Sárközy BIOINFORMATICS

Péter Antal Ádám Arany Bence Bolgár András Gézsi Gergely Hajós Gábor Hullám Péter Marx András Millinghoffer László Poppe Péter Sárközy BIOINFORMATICS Péter Antal Ádám Arany Bence Bolgár András Gézsi Gergely Hajós Gábor Hullám Péter Marx András Millinghoffer László Poppe Péter Sárközy BIOINFORMATICS The Bioinformatics book covers new topics in the rapidly

More information

Pathways from the Genome to Risk Factors and Diseases via a Metabolomics Causal Network. Azam M. Yazdani, PhD

Pathways from the Genome to Risk Factors and Diseases via a Metabolomics Causal Network. Azam M. Yazdani, PhD Pathways from the Genome to Risk Factors and Diseases via a Metabolomics Causal Network Azam M. Yazdani, PhD 1 Causal Inference in Observational Studies Example Question What is the effect of Aspirin on

More information

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005 Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of

More information

27041, Week 02. Review of Week 01

27041, Week 02. Review of Week 01 27041, Week 02 Review of Week 01 The human genome sequencing project (HGP) 2 CBS, Department of Systems Biology Systems Biology and emergent properties 3 CBS, Department of Systems Biology Different model

More information

6.047 / Computational Biology: Genomes, Networks, Evolution Fall 2008

6.047 / Computational Biology: Genomes, Networks, Evolution Fall 2008 MIT OpenCourseWare http://ocw.mit.edu 6.047 / 6.878 Computational Biology: Genomes, Networks, Evolution Fall 2008 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information

Gene function prediction. Computational analysis of biological networks. Olga Troyanskaya, PhD

Gene function prediction. Computational analysis of biological networks. Olga Troyanskaya, PhD Gene function prediction Computational analysis of biological networks. Olga Troyanskaya, PhD Available Data Coexpression - Microarrays Cells of Interest Known DNA sequences Isolate mrna Glass slide Resulting

More information

CENTER FOR BIOTECHNOLOGY

CENTER FOR BIOTECHNOLOGY CENTER FOR BIOTECHNOLOGY Keith A. McGee, Ph.D., Program Director Math and Science Building, 3 rd Floor 1000 ASU Drive #870 Phone: 601-877-6198 FAX: 601-877-2328 Degree Offered Required Admission Test M.

More information

Bioinformatics and Life Sciences Standards and Programming for Heterogeneous Architectures

Bioinformatics and Life Sciences Standards and Programming for Heterogeneous Architectures Bioinformatics and Life Sciences Standards and Programming for Heterogeneous Architectures Eric Stahlberg Ph.D. (SAIC-Frederick contractor) stahlbergea@mail.nih.gov SIAM Conference on Parallel Processing

More information

Networks of Signal Transduction and Regulation in Cellular Systems

Networks of Signal Transduction and Regulation in Cellular Systems Max Planck Institute for Dynamics of Complex Technical Systems Magdeburg Networks of Signal Transduction and Regulation in Cellular Systems E.D. Gilles 1 Magdeburg Capital of Saxony-Anhalt 2 3 MAX PLANCK

More information

Era with Computational Biology/Toxicology

Era with Computational Biology/Toxicology USM Seminar 1/22/2010 Embracing the Post-Omics Era with Computational Biology/Toxicology Ping Gong Environmental Genomics and Genetics (EGG) Team @ Environmental Laboratory Outline Introduction Bioinformatics

More information

Microarray Informatics

Microarray Informatics Microarray Informatics Donald Dunbar MSc Seminar 4 th February 2009 Aims To give a biologistʼs view of microarray experiments To explain the technologies involved To describe typical microarray experiments

More information

Judy Wieber. Department of Computational Biology. May 28, 2008

Judy Wieber. Department of Computational Biology. May 28, 2008 Review III: Cellular Processes Judy Wieber BBSI @ Pitt 2008 Department of Computational Biology University it of Pittsburgh School of Medicine i May 28, 2008 Outline Metabolism Cell cycle Transcription

More information

Syllabus for BIOS 101, SPRING 2013

Syllabus for BIOS 101, SPRING 2013 Page 1 Syllabus for BIOS 101, SPRING 2013 Name: BIOSTATISTICS 101 for Cancer Researchers Time: March 20 -- May 29 4-5pm in Wednesdays, [except 4/15 (Mon) and 5/7 (Tue)] Location: SRB Auditorium Background

More information

Stefano Monti. Workshop Format

Stefano Monti. Workshop Format Gad Getz Stefano Monti Michael Reich {gadgetz,smonti,mreich}@broad.mit.edu http://www.broad.mit.edu/~smonti/aws Broad Institute of MIT & Harvard October 18-20, 2006 Cambridge, MA Workshop Format Morning

More information

Grand Challenges in Computational Biology

Grand Challenges in Computational Biology Grand Challenges in Computational Biology Kimmen Sjölander UC Berkeley Reconstructing the Tree of Life CITRIS-INRIA workshop 24 May, 2011 Prediction of biological pathways and networks Human microbiome

More information

Cory Brouwer, Ph.D. Xiuxia Du, Ph.D. Anthony Fodor, Ph.D.

Cory Brouwer, Ph.D. Xiuxia Du, Ph.D. Anthony Fodor, Ph.D. Cory Brouwer, Ph.D. Dr. Cory R. Brouwer is Director of the Bioinformatics Services Division and Associate Professor of Bioinformatics and Genomics at UNC Charlotte. He and his team provide a wide range

More information

Accuracy of the Bayesian Network Algorithms for Inferring Gene Regulatory Networks

Accuracy of the Bayesian Network Algorithms for Inferring Gene Regulatory Networks HELSINKI UNIVERSITY OF TECHNOLOGY Engineering Physics and Mathematics Systems Analysis Laboratory Mat-2.108 Independent research projects in applied mathematics Accuracy of the Bayesian Network Algorithms

More information

Neural Networks and Applications in Bioinformatics. Yuzhen Ye School of Informatics and Computing, Indiana University

Neural Networks and Applications in Bioinformatics. Yuzhen Ye School of Informatics and Computing, Indiana University Neural Networks and Applications in Bioinformatics Yuzhen Ye School of Informatics and Computing, Indiana University Contents Biological problem: promoter modeling Basics of neural networks Perceptrons

More information

Introduction to Microarray Analysis

Introduction to Microarray Analysis Introduction to Microarray Analysis Methods Course: Gene Expression Data Analysis -Day One Rainer Spang Microarrays Highly parallel measurement devices for gene expression levels 1. How does the microarray

More information

How to deal with the microarray results.

How to deal with the microarray results. How to deal with the microarray results. Britt Gabrielsson PhD RCEM, Div of metabolism and cardiovascular research Department of Medicine The Sahlgrenska Academy at Göteborg University and then we will

More information

Progress and Future Directions in Integrated Systems Toxicology. Mary McBride Agilent Technologies

Progress and Future Directions in Integrated Systems Toxicology. Mary McBride Agilent Technologies Progress and Future Directions in Integrated Systems Toxicology Mary McBride Agilent Technologies 1 Toxicity testing tools of the late 20 th century Patchwork approach to testing dates back to the 1930

More information

Bioinformatics. Dick de Ridder. Tuinbouw Digitaal, 12/11/15

Bioinformatics. Dick de Ridder. Tuinbouw Digitaal, 12/11/15 Bioinformatics Dick de Ridder Tuinbouw Digitaal, 12/11/15 Bioinformatics is not Bioinformatics is also not Bioinformatics Bioinformatics (2) Bioinformatics (3) US National Institutes of Health (NIH): Bioinformatics:

More information

Neural Networks and Applications in Bioinformatics

Neural Networks and Applications in Bioinformatics Contents Neural Networks and Applications in Bioinformatics Yuzhen Ye School of Informatics and Computing, Indiana University Biological problem: promoter modeling Basics of neural networks Perceptrons

More information

Computational Genomics

Computational Genomics Computational Genomics Introduction to cell biology, genomics, development, and probability Eric Xing Lecture 1a, January 18, 2007 Reading: Chap. 1, DTM book Introduction to cell biology, functional genomics,

More information

and Promoter Sequence Data

and Promoter Sequence Data : Combining Gene Expression and Promoter Sequence Data Outline 1. Motivation Functionally related genes cluster together genes sharing cis-elements cluster together transcriptional regulation is modular

More information

Impact of Retinoic acid induced-1 (Rai1) on Regulators of Metabolism and Adipogenesis

Impact of Retinoic acid induced-1 (Rai1) on Regulators of Metabolism and Adipogenesis Impact of Retinoic acid induced-1 (Rai1) on Regulators of Metabolism and Adipogenesis The mammalian system undergoes ~24 hour cycles known as circadian rhythms that temporally orchestrate metabolism, behavior,

More information

2017 Qualifying Examination

2017 Qualifying Examination B1 1 Basic Molecular Genetics Mechanisms Dr. Ueng-Cheng Yang Molecular Genetics Techniques Cellular Energetics 24 2 Dr. Dar-Yi Wang Transcriptional Control of Gene Expression 8 3 Dr. Chuan-Hsiung Chang

More information

BIOINFORMATICS Introduction

BIOINFORMATICS Introduction BIOINFORMATICS Introduction Mark Gerstein, Yale University bioinfo.mbb.yale.edu/mbb452a 1 (c) Mark Gerstein, 1999, Yale, bioinfo.mbb.yale.edu What is Bioinformatics? (Molecular) Bio -informatics One idea

More information

Integrating Biological Databases in the Context of Transcriptional Regulatory Networks

Integrating Biological Databases in the Context of Transcriptional Regulatory Networks Integrating Biological Databases in the Context of Transcriptional Regulatory Networks Rafael Pereira and Rui Mendes Abstract Several studies show that biological knowledge is growing at a continuous rate

More information

Computational Methods for Systems Biology: Analysis of High-Throughput Measurements and Modeling of Genetic Regulatory Networks

Computational Methods for Systems Biology: Analysis of High-Throughput Measurements and Modeling of Genetic Regulatory Networks Tampereen teknillinen yliopisto. Julkaisu 548 Tampere University of Technology. Publication 548 Harri Lähdesmäki Computational Methods for Systems Biology: Analysis of High-Throughput Measurements and

More information

Welcome! Introduction to High Throughput Genomics December Norwegian Microarray Consortium FUGE Bioinformatics platform

Welcome! Introduction to High Throughput Genomics December Norwegian Microarray Consortium FUGE Bioinformatics platform Introduction to High Throughput Genomics December 2011 Norwegian Microarray Consortium FUGE Bioinformatics platform Rita Holdhus Kjell Petersen Welcome! Course program Day 1 Thursday 1st December 2011

More information