Age-Adjusted Death Rates for Coronary Heart Disease, U.S.,
|
|
- Blake Moody
- 6 years ago
- Views:
Transcription
1 Age-Adjusted Death Rates for Coronary Heart Disease, U.S., Deaths/100,000 Population Risk Factors U.S. Actual U.S. "Could Be" (Based on Japan Actual) Year
2 Framingham Heart Study Downtown Framingham, MA Risk Factors for Heart Attack and Stroke High blood pressure High cholesterol Cigarette smoking Diabetes mellitus Parental or sibling history Obesity
3 Framingham Heart Study: Population-Based Family Study Original cohort: n=5209 men and women (ages 28-62) 1644 spouse pairs, 596 extended families Offspring study: n=5124 men and women (ages 5-70) 1576 spouse pairs, 3514 biological offspring Third Generation study: n=3500 men and women 2002
4 Contributions to Change in Life Expectancy, U.S., Cardiovascular Disease Perinatal Disease Injuries Cancer COPD Increase Due to CVD = 3.9 Years CHD Stroke Other CVD Net Increase = 6.0 Years HIV/AIDS Other causes Change in Life Expectancy (Years)
5 Age-Adjusted Death Rates for Coronary Heart Disease, U.S., Deaths/100,000 Population Risk Factors defined 1961 NHBPEP 1972 BHAT 1981 HDFP 1979 Risk Factors Primary and Secondary Prevention CASS Physical Intervention 1983 TIMI 1985 CPPT 1984 NCEP 1985 ALLHAT Year
6 Survival from age 35 for continuing cigarette smokers and lifelong non-smokers among UK male doctors born , with percentages alive at each decade of age Doll, R. et al. BMJ 2004;328:1519 Copyright 2004 BMJ Publishing Group Ltd.
7 Effects on survival of stopping smoking cigarettes at age (effect from age 35), age (effect from age 40), age (effect from age 50), and age (effect from age 60) Doll, R. et al. BMJ 2004;328:1519 Copyright 2004 BMJ Publishing Group Ltd.
8 Relationship: LDL-Cholesterol & CHD Risk 50 CHD Deaths (per 1000/10y) China USA LDL (mg/dl) Source: Helen H. Hobbs, UT Southwestern Med Center
9 Genes and Environment Initiative
10 Combinatorial Complexity of CHD
11 Principles of whole-genome association mapping and finding complex disease genes
12 Characteristics of complex diseases Multiple genes Common variants Low penetrance Genetic interactions Epigenetic effects :
13 Complex inheritance: An Hypothesis Complex (non-mendelian) inheritance arises from the accumulation of common polymorphisms with small-to-modest allelic effects at multiple genes Common variants underlying disease can be identified a priori!
14 Whenever a mutation has a single origin it can be identified individually or through its association with nearby markers surrogates by virtue of being associated in the population through shared genetic history linkage disequilibrium (LD) mapping
15 Haplotype Map of the Human Genome Goals: provide genotyping information to support efficient and well-powered genetic association studies of human disease Define patterns of genetic variation across human genome Guide selection of SNPs efficiently to tag common variants Public release of all data (assays, genotypes): Phase I: 1.3 M markers in 269 people (1SNP/5kb at 5% +) Phase II: +3.1 M markers in 270 people(1snp/1kb at 5% +) The remarkable feature learnt is the pervasive nature of
16
17
18 Framingham SNP Health Association Resource (SHARe) Genotypes: ~10,000 Caucasians from 3 generations - Affymetrix 500,000 SNP chip Phenotypes: >1,000 risk factor, subclinical and clinical CV phenotypes, from 60 years of exams Genotypes and phenotypes placed in a webbased dataset, called dbgap, maintained at the NIH Framingham SHARe dataset contains 5.5 billion genotypes, >5.5 trillion association tests Available to biomedical researchers October 1, 2007
19 database Genotype and Phenotype (dbgap)
20 ~
21
22
23 ~ March 2008
24 QuickTimeª and a decompressor are needed to see this picture. * Take full advantage of new next-generation sequencing technologies. * Target only customer defined genetic elements. * Eliminate the time, cost, and performance limitations of multiplexed PCR.
25
26 ~
27 QuickTimeª and a decompressor are needed to see this picture.
28
Introduction to Add Health GWAS Data Part I. Christy Avery Department of Epidemiology University of North Carolina at Chapel Hill
Introduction to Add Health GWAS Data Part I Christy Avery Department of Epidemiology University of North Carolina at Chapel Hill Outline Introduction to genome-wide association studies (GWAS) Research
More informationEPIB 668 Genetic association studies. Aurélie LABBE - Winter 2011
EPIB 668 Genetic association studies Aurélie LABBE - Winter 2011 1 / 71 OUTLINE Linkage vs association Linkage disequilibrium Case control studies Family-based association 2 / 71 RECAP ON GENETIC VARIANTS
More informationAppendix 5: Details of statistical methods in the CRP CHD Genetics Collaboration (CCGC) [posted as supplied by
Appendix 5: Details of statistical methods in the CRP CHD Genetics Collaboration (CCGC) [posted as supplied by author] Statistical methods: All hypothesis tests were conducted using two-sided P-values
More informationComputational Workflows for Genome-Wide Association Study: I
Computational Workflows for Genome-Wide Association Study: I Department of Computer Science Brown University, Providence sorin@cs.brown.edu October 16, 2014 Outline 1 Outline 2 3 Monogenic Mendelian Diseases
More informationCS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016
CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 Topics Genetic variation Population structure Linkage disequilibrium Natural disease variants Genome Wide Association Studies Gene
More informationGenomics Resources in WHI. WHI ( ) Extension Study Steering Committee Meeting Seattle, WA May 05-06, 2011
Genomics Resources in WHI WHI (2010-2015) Extension Study Steering Committee Meeting Seattle, WA May 05-06, 2011 WHI Genomic Resources in dbgap Outcomes and traits in AA and Hispanics GWAS-SHARe Sequencing-ESP
More informationExome Sequencing Exome sequencing is a technique that is used to examine all of the protein-coding regions of the genome.
Glossary of Terms Genetics is a term that refers to the study of genes and their role in inheritance the way certain traits are passed down from one generation to another. Genomics is the study of all
More informationAssociation studies (Linkage disequilibrium)
Positional cloning: statistical approaches to gene mapping, i.e. locating genes on the genome Linkage analysis Association studies (Linkage disequilibrium) Linkage analysis Uses a genetic marker map (a
More informationGenetic meta-analysis and Mendelian randomisation
Genetic meta-analysis and Mendelian randomisation Investigating the association of fibrinogen with cardiovascular disease Jonathan Sterne, Roger Harbord, Julie Milton, Shah Ebrahim, George Davey Smith
More informationBioinformatic Analysis of SNP Data for Genetic Association Studies EPI573
Bioinformatic Analysis of SNP Data for Genetic Association Studies EPI573 Mark J. Rieder Department of Genome Sciences mrieder@u.washington washington.edu Epidemiology Studies Cohort Outcome Model to fit/explain
More informationCore Resources Working Group Report. Opportunities for Investigator Engagement
Core Resources Working Group Report Opportunities for Investigator Engagement Goals of Core Resource Working Group Initial purpose was to explore intervention effects in the 4 clinical trials Extend definition
More informationS G. Design and Analysis of Genetic Association Studies. ection. tatistical. enetics
S G ection ON tatistical enetics Design and Analysis of Genetic Association Studies Hemant K Tiwari, Ph.D. Professor & Head Section on Statistical Genetics Department of Biostatistics School of Public
More informationHuman linkage analysis. fundamental concepts
Human linkage analysis fundamental concepts Genes and chromosomes Alelles of genes located on different chromosomes show independent assortment (Mendel s 2nd law) For 2 genes: 4 gamete classes with equal
More informationPUBH 8445: Lecture 1. Saonli Basu, Ph.D. Division of Biostatistics School of Public Health University of Minnesota
PUBH 8445: Lecture 1 Saonli Basu, Ph.D. Division of Biostatistics School of Public Health University of Minnesota saonli@umn.edu Statistical Genetics It can broadly be classified into three sub categories:
More informationLinking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls
Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls BMI/CS 776 www.biostat.wisc.edu/bmi776/ Colin Dewey cdewey@biostat.wisc.edu Spring 2012 1. Understanding Human Genetic Variation
More informationAnalysis of genome-wide genotype data
Analysis of genome-wide genotype data Acknowledgement: Several slides based on a lecture course given by Jonathan Marchini & Chris Spencer, Cape Town 2007 Introduction & definitions - Allele: A version
More informationb. (3 points) The expected frequencies of each blood type in the deme if mating is random with respect to variation at this locus.
NAME EXAM# 1 1. (15 points) Next to each unnumbered item in the left column place the number from the right column/bottom that best corresponds: 10 additive genetic variance 1) a hermaphroditic adult develops
More informationFamilial Breast Cancer
Familial Breast Cancer SEARCHING THE GENES Samuel J. Haryono 1 Issues in HSBOC Spectrum of mutation testing in familial breast cancer Variant of BRCA vs mutation of BRCA Clinical guideline and management
More informationHuman Genetic Variation. Ricardo Lebrón Dpto. Genética UGR
Human Genetic Variation Ricardo Lebrón rlebron@ugr.es Dpto. Genética UGR What is Genetic Variation? Origins of Genetic Variation Genetic Variation is the difference in DNA sequences between individuals.
More informationApplied Bioinformatics
Applied Bioinformatics In silico and In clinico characterization of genetic variations Assistant Professor Department of Biomedical Informatics Center for Human Genetics Research ATCAAAATTATGGAAGAA ATCAAAATCATGGAAGAA
More informationSupplementary Information. Werner Koch, Petra Hoppmann, Jakob C. Mueller, Albert Schömig & Adnan Kastrati
Supplementary Information Werner Koch, Petra Hoppmann, Jakob C. Mueller, Albert Schömig & Adnan Kastrati The Supplementary Information has the following sections in order: 1. Supplementary Methods 2. Supplementary
More informationUnderstanding genetic association studies. Peter Kamerman
Understanding genetic association studies Peter Kamerman Outline CONCEPTS UNDERLYING GENETIC ASSOCIATION STUDIES Genetic concepts: - Underlying principals - Genetic variants - Linkage disequilibrium -
More informationHuman linkage analysis. fundamental concepts
Human linkage analysis fundamental concepts Genes and chromosomes Alelles of genes located on different chromosomes show independent assortment (Mendel s 2nd law) For 2 genes: 4 gamete classes with equal
More informationIntegrating approaches to Privacy across the Research Lifestyle
Integrating approaches to Privacy across the Research Lifestyle Fall 2013 Workshop Tracking Consent Options at the Framingham Study Greta Lee Splansky Other Sources Of FHS Data (Each with policies, applications,
More informationGenetic Variation and Genome- Wide Association Studies. Keyan Salari, MD/PhD Candidate Department of Genetics
Genetic Variation and Genome- Wide Association Studies Keyan Salari, MD/PhD Candidate Department of Genetics How many of you did the readings before class? A. Yes, of course! B. Started, but didn t get
More informationUnderstanding the Genetic Architecture of Complex Human Diseases: Biomedicine, Statistics, and Large Genomic Data Sets Josée Dupuis
Understanding the Genetic Architecture of Complex Human Diseases: Biomedicine, Statistics, and Large Genomic Data Sets Josée Dupuis Professor and Interim Chair Department of Biostatistics Boston University
More informationPerformance of the Newly Developed Non-Invasive Prenatal Multi- Gene Sequencing Screen
1 // Performance of the Newly Developed Non-Invasive Prenatal Multi- Gene Sequencing Screen ABSTRACT Here we describe the analytical performance of the newly developed non-invasive prenatal multi-gene
More informationGene Mapping in Natural Plant Populations Guilt by Association
Gene Mapping in Natural Plant Populations Guilt by Association Leif Skøt What is linkage disequilibrium? 12 Natural populations as a tool for gene mapping 13 Conclusion 15 POPULATIONS GUILT BY ASSOCIATION
More informationGenetics Effective Use of New and Existing Methods
Genetics Effective Use of New and Existing Methods Making Genetic Improvement Phenotype = Genetics + Environment = + To make genetic improvement, we want to know the Genetic value or Breeding value for
More informationPersonalized Human Genome Sequencing
Personalized Human Genome Sequencing Dr. Stefan Platz DABT, Global Head Drug Safety & Metabolism Biomedical research: strengths & limitations of non-animal alternatives 06 December 2016 The Human Genome
More informationExploring the Genetic Basis of Congenital Heart Defects
Exploring the Genetic Basis of Congenital Heart Defects Sanjay Siddhanti Jordan Hannel Vineeth Gangaram szsiddh@stanford.edu jfhannel@stanford.edu vineethg@stanford.edu 1 Introduction The Human Genome
More informationFactors affecting statistical power in the detection of genetic association
Review series Factors affecting statistical power in the detection of genetic association Derek Gordon 1 and Stephen J. Finch 2 1 Laboratory of Statistical Genetics, Rockefeller University, New York, New
More informationMidterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score
Midterm 1 Results 10 Midterm 1 Akey/ Fields Median - 69 8 Number of Students 6 4 2 0 21 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 101 Exam Score Quick review of where we left off Parental type: the
More informationLecture 23: Causes and Consequences of Linkage Disequilibrium. November 16, 2012
Lecture 23: Causes and Consequences of Linkage Disequilibrium November 16, 2012 Last Time Signatures of selection based on synonymous and nonsynonymous substitutions Multiple loci and independent segregation
More informationBTRY 7210: Topics in Quantitative Genomics and Genetics
BTRY 7210: Topics in Quantitative Genomics and Genetics Jason Mezey Biological Statistics and Computational Biology (BSCB) Department of Genetic Medicine jgm45@cornell.edu Spring 2015, Thurs.,12:20-1:10
More informationGenome-Wide Association Studies. Ryan Collins, Gerissa Fowler, Sean Gamberg, Josselyn Hudasek & Victoria Mackey
Genome-Wide Association Studies Ryan Collins, Gerissa Fowler, Sean Gamberg, Josselyn Hudasek & Victoria Mackey Introduction The next big advancement in the field of genetics after the Human Genome Project
More informationActivity 4.3.2: Hypercholesterolemia
Activity 4.3.2: Hypercholesterolemia Introduction In the previous activity, you learned that Anna Garcia has abnormally high cholesterol levels. Because of this result, Anna was sent back to the lab for
More informationTHE HEALTH AND RETIREMENT STUDY: GENETIC DATA UPDATE
: GENETIC DATA UPDATE April 30, 2014 Biomarker Network Meeting PAA Jessica Faul, Ph.D., M.P.H. Health and Retirement Study Survey Research Center Institute for Social Research University of Michigan HRS
More informationProstate Cancer Genetics: Today and tomorrow
Prostate Cancer Genetics: Today and tomorrow Henrik Grönberg Professor Cancer Epidemiology, Deputy Chair Department of Medical Epidemiology and Biostatistics ( MEB) Karolinska Institutet, Stockholm IMPACT-Atanta
More informationPOLYGENIC RISK SCORES FOR RISK ASSESSMENT
POLYGENIC RISK SCORES FOR RISK ASSESSMENT RICHARD KARLSSON LINNÉR EXPERT FORUM ON GENOMIC MEDICINE OCTOBER 23, 2018 # Het begint met een idee INTRODUCTION # Het begint met een idee GENETIC HEALTH RISKS
More informationPotential of human genome sequencing. Paul Pharoah Reader in Cancer Epidemiology University of Cambridge
Potential of human genome sequencing Paul Pharoah Reader in Cancer Epidemiology University of Cambridge Key considerations Strength of association Exposure Genetic model Outcome Quantitative trait Binary
More informationAssociation Mapping. Mendelian versus Complex Phenotypes. How to Perform an Association Study. Why Association Studies (Can) Work
Genome 371, 1 March 2010, Lecture 13 Association Mapping Mendelian versus Complex Phenotypes How to Perform an Association Study Why Association Studies (Can) Work Introduction to LOD score analysis Common
More informationAlgorithms for Genetics: Introduction, and sources of variation
Algorithms for Genetics: Introduction, and sources of variation Scribe: David Dean Instructor: Vineet Bafna 1 Terms Genotype: the genetic makeup of an individual. For example, we may refer to an individual
More informationGenome-Wide Association Studies (GWAS): Computational Them
Genome-Wide Association Studies (GWAS): Computational Themes and Caveats October 14, 2014 Many issues in Genomewide Association Studies We show that even for the simplest analysis, there is little consensus
More informationRedefine what s possible with the Axiom Genotyping Solution
Redefine what s possible with the Axiom Genotyping Solution From discovery to translation on a single platform The Axiom Genotyping Solution enables enhanced genotyping studies to accelerate your research
More informationGenetics of Stroke. Daniel Woo, M.D., M.S. University of Cincinnati
Genetics of Stroke Daniel Woo, M.D., M.S. University of Cincinnati Objectives To understand the basic terms and concepts of genetics To understand how they have been applied to genetic discovery To understand
More informationCrash-course in genomics
Crash-course in genomics Molecular biology : How does the genome code for function? Genetics: How is the genome passed on from parent to child? Genetic variation: How does the genome change when it is
More informationBlood Pressure and Hypertension Genetics
Blood Pressure and Hypertension Genetics Yong Huo, M.D. Wei Gao, M.D. Yan Zhang, M.D. Santhi K. Ganesh, M.D. Outline Blood pressure and hypertension in China Update on genetics of blood pressure BP/HTN
More informationTestimony of Christopher Newton-Cheh, MD, MPH Volunteer for the American Heart Association
Testimony of Christopher Newton-Cheh, MD, MPH Volunteer for the American Heart Association Before the House Energy and Commerce Subcommittee on Health 21st Century Cures: Examining the Regulation of Laboratory
More informationModule 1 Principles of plant breeding
Covered topics, Distance Learning course Plant Breeding M1-M5 V2.0 Dr. Jan-Kees Goud, Wageningen University & Research The five main modules consist of the following content: Module 1 Principles of plant
More informationLD Mapping and the Coalescent
Zhaojun Zhang zzj@cs.unc.edu April 2, 2009 Outline 1 Linkage Mapping 2 Linkage Disequilibrium Mapping 3 A role for coalescent 4 Prove existance of LD on simulated data Qualitiative measure Quantitiave
More informationMONTE CARLO PEDIGREE DISEQUILIBRIUM TEST WITH MISSING DATA AND POPULATION STRUCTURE
MONTE CARLO PEDIGREE DISEQUILIBRIUM TEST WITH MISSING DATA AND POPULATION STRUCTURE DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate
More informationGenomic Research: Issues to Consider. IRB Brown Bag August 28, 2014 Sharon Aufox, MS, LGC
Genomic Research: Issues to Consider IRB Brown Bag August 28, 2014 Sharon Aufox, MS, LGC Outline Key genomic terms and concepts Issues in genomic research Consent models Types of findings Returning results
More informationSNP Selection. Outline of Tutorial. Why Do We Need tagsnps? Concepts of tagsnps. LD and haplotype definitions. Haplotype blocks and definitions
SNP Selection Outline of Tutorial Concepts of tagsnps University of Louisville Center for Genetics and Molecular Medicine January 10, 2008 Dana Crawford, PhD Vanderbilt University Center for Human Genetics
More informationIntroduction to Animal Breeding & Genomics
Introduction to Animal Breeding & Genomics Sinead McParland Teagasc, Moorepark, Ireland Sinead.McParland@teagasc.ie Overview Changes to traditional animal breeding Using DNA in animal breeding What is
More informationA pathogenic mutation was identified in the LDLR gene.
Hereditary High Cholesterol Test ORDERING PHYSICIAN Dr. Jenny Jones Sample Medical Group 123 Main St. Sample, CA SPECIMEN Type: Saliva Barcode: 333 234234 2343 Collected: Jul 15, 2017 Received: Jul 17,
More informationGenetics and Heredity Power Point Questions
Name period date assigned date due date returned Genetics and Heredity Power Point Questions 1. Heredity is the process in which pass from parent to offspring. 2. is the study of heredity. 3. A trait is
More informationResources Available through the Albert Einstein College of Medicine Nathan Shock Center
Resources Available through the Albert Einstein College of Medicine Nathan Shock Center http://www.einstein.yu.edu/centers/aging/ Available Proteostasis-related plasmids Sent as filter spotted DNA - shrna
More informationPersonal Genomics Platform White Paper Last Updated November 15, Executive Summary
Executive Summary Helix is a personal genomics platform company with a simple but powerful mission: to empower every person to improve their life through DNA. Our platform includes saliva sample collection,
More informationModified Mendelian Ratios Ch. 13
Modified Mendelian Ratios Ch. 13 1. Multiple alleles (more than 2 alleles for gene in population) Example: Blood Groups Karl Landsteiner 1900 s Chromosome 9 I gene ABO blood system = polymorphic I gene
More informationGenetics and Psychiatric Disorders Lecture 1: Introduction
Genetics and Psychiatric Disorders Lecture 1: Introduction Amanda J. Myers LABORATORY OF FUNCTIONAL NEUROGENOMICS All slides available @: http://labs.med.miami.edu/myers Click on courses First two links
More informationHuman Genetics and Gene Mapping of Complex Traits
Human Genetics and Gene Mapping of Complex Traits Advanced Genetics, Spring 2015 Human Genetics Series Thursday 4/02/15 Nancy L. Saccone, nlims@genetics.wustl.edu ancestral chromosome present day chromosomes:
More informationGenes & Medicine: How DNA is Improving Your Health
Genes & Medicine: How DNA is Improving Your Health U3A Mountford, June 2004 Dr Martin Kennedy Department of Pathology Christchurch School of Medicine & Health Sciences University of Otago What this talk
More informationHuman SNP haplotypes. Statistics 246, Spring 2002 Week 15, Lecture 1
Human SNP haplotypes Statistics 246, Spring 2002 Week 15, Lecture 1 Human single nucleotide polymorphisms The majority of human sequence variation is due to substitutions that have occurred once in the
More informationLinking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls
Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls BMI/CS 776 www.biostat.wisc.edu/bmi776/ Mark Craven craven@biostat.wisc.edu Spring 2011 1. Understanding Human Genetic Variation!
More informationGenome-wide association studies (GWAS) Part 1
Genome-wide association studies (GWAS) Part 1 Matti Pirinen FIMM, University of Helsinki 03.12.2013, Kumpula Campus FIMM - Institiute for Molecular Medicine Finland www.fimm.fi Published Genome-Wide Associations
More informationVariation Chapter 9 10/6/2014. Some terms. Variation in phenotype can be due to genes AND environment: Is variation genetic, environmental, or both?
Frequency 10/6/2014 Variation Chapter 9 Some terms Genotype Allele form of a gene, distinguished by effect on phenotype Haplotype form of a gene, distinguished by DNA sequence Gene copy number of copies
More informationCMSC423: Bioinformatic Algorithms, Databases and Tools. Some Genetics
CMSC423: Bioinformatic Algorithms, Databases and Tools Some Genetics CMSC423 Fall 2009 2 Chapter 13 Reading assignment CMSC423 Fall 2009 3 Gene association studies Goal: identify genes/markers associated
More informationStructural Genomics. Marco F Ramoni, PhD September 15th, Biomedical Computing / HST 950
Harvard-MIT Division of Health Sciences and Technology HST.950J: Engineering Biomedical Information: From Bioinformatics to Biosurveillance Course Directors: Dr. Isaac Kohane, Dr. Marco Ramoni Structural
More informationHaplotypes, recessives and genetic codes explained
Haplotypes, recessives and genetic codes explained This document is designed to help explain the current genetic codes which are found after the names of registered Holstein animals on pedigrees, web factsheets
More informationGene-Environment Interactions In Complex Human Diseases
Gene-Environment Interactions In Complex Human Diseases Xiaobin Wang, MD, MPH, ScD Director and The Mary Ann & J. Milburn Smith Research Professor The Mary Ann & J. Milburn Smith Child Health Research
More informationGenetic Association Studies
1 Genetic Association Studies Recent technological advancements allowing for large-scale sequencing efforts present an exciting opportunity to uncover the genetic underpinnings of complex diseases. In
More informationGENOTYPING-BY-SEQUENCING USING CUSTOM ION AMPLISEQ TECHNOLOGY AS A TOOL FOR GENOMIC SELECTION IN ATLANTIC SALMON
GENOTYPING-BY-SEQUENCING USING CUSTOM ION AMPLISEQ TECHNOLOGY AS A TOOL FOR GENOMIC SELECTION IN ATLANTIC SALMON Matthew Baranski, Casey Jowdy, Hooman Moghadam, Ashie Norris, Håvard Bakke, Anna Sonesson,
More informationCourse Announcements
Statistical Methods for Quantitative Trait Loci (QTL) Mapping II Lectures 5 Oct 2, 2 SE 527 omputational Biology, Fall 2 Instructor Su-In Lee T hristopher Miles Monday & Wednesday 2-2 Johnson Hall (JHN)
More informationFORENSIC GENETICS. DNA in the cell FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS. Sources of biological evidence
FORENSIC GENETICS FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS Establishing human corpse identity Crime cases matching suspect with evidence Paternity testing, even after
More informationUNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations
Examination Candidate Number: Desk Number: UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Human genetics Time Allowed: 2 hours Marking Scheme: Total
More informationGREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
More informationAnswers to additional linkage problems.
Spring 2013 Biology 321 Answers to Assignment Set 8 Chapter 4 http://fire.biol.wwu.edu/trent/trent/iga_10e_sm_chapter_04.pdf Answers to additional linkage problems. Problem -1 In this cell, there two copies
More informationNon-Mendelian Inheritance
Non-Mendelian Inheritance Objectives Predict possible outcomes of various genetic combinations such as monohybrid crosses, dihybrid crosses and non-mendelian inheritance (TEKS 6F) Background Information
More informationStatistical Tools for Predicting Ancestry from Genetic Data
Statistical Tools for Predicting Ancestry from Genetic Data Timothy Thornton Department of Biostatistics University of Washington March 1, 2015 1 / 33 Basic Genetic Terminology A gene is the most fundamental
More informationHST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007
MIT OpenCourseWare http://ocw.mit.edu HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.
More informationProf. Dr. Konstantin Strauch
Genetic Epidemiology and Personalized Medicine Prof. Dr. Konstantin Strauch IBE - Lehrstuhl für Genetische Epidemiologie Ludwig-Maximilians-Universität Institut für Genetische Epidemiologie Helmholtz-Zentrum
More informationMulti-SNP Models for Fine-Mapping Studies: Application to an. Kallikrein Region and Prostate Cancer
Multi-SNP Models for Fine-Mapping Studies: Application to an association study of the Kallikrein Region and Prostate Cancer November 11, 2014 Contents Background 1 Background 2 3 4 5 6 Study Motivation
More informationGENETICS - CLUTCH CH.20 QUANTITATIVE GENETICS.
!! www.clutchprep.com CONCEPT: MATHMATICAL MEASRUMENTS Common statistical measurements are used in genetics to phenotypes The mean is an average of values - A population is all individuals within the group
More informationFeature Selection in Pharmacogenetics
Feature Selection in Pharmacogenetics Application to Calcium Channel Blockers in Hypertension Treatment IEEE CIS June 2006 Dr. Troy Bremer Prediction Sciences Pharmacogenetics Great potential SNPs (Single
More informationSYLLABUS AND SAMPLE QUESTIONS FOR JRF IN BIOLOGICAL ANTHROPOLGY 2011
SYLLABUS AND SAMPLE QUESTIONS FOR JRF IN BIOLOGICAL ANTHROPOLGY 2011 SYLLABUS 1. Introduction: Definition and scope; subdivisions of anthropology; application of genetics in anthropology. 2. Human evolution:
More informationSupplementary Methods Illumina Genome-Wide Genotyping Single SNP and Microsatellite Genotyping. Supplementary Table 4a Supplementary Table 4b
Supplementary Methods Illumina Genome-Wide Genotyping All Icelandic case- and control-samples were assayed with the Infinium HumanHap300 SNP chips (Illumina, SanDiego, CA, USA), containing 317,503 haplotype
More informationAll research lines at the LMU have a strong methodological focus
Content: Genetic Epidemiology and Statistical Genetics in Complex Diseases... 2 Molecular Epidemiology of Complex Phenotypes... 2 Clinical Trials and Translational Medicine... 3 Clinical Epidemiology and
More informationPOLYMORPHISM AND VARIANT ANALYSIS. Matt Hudson Crop Sciences NCSA HPCBio IGB University of Illinois
POLYMORPHISM AND VARIANT ANALYSIS Matt Hudson Crop Sciences NCSA HPCBio IGB University of Illinois Outline How do we predict molecular or genetic functions using variants?! Predicting when a coding SNP
More informationLecture: Genetic Basis of Complex Phenotypes Advanced Topics in Computa8onal Genomics
Lecture: Genetic Basis of Complex Phenotypes 02-715 Advanced Topics in Computa8onal Genomics Genome Polymorphisms A Human Genealogy TCGAGGTATTAAC The ancestral chromosome From SNPS TCGAGGTATTAAC TCTAGGTATTAAC
More informationGenomes contain all of the information needed for an organism to grow and survive.
Section 3: Genomes contain all of the information needed for an organism to grow and survive. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the components of the
More informationGlobal Screening Array (GSA)
Technical overview - Infinium Global Screening Array (GSA) with optional Multi-disease drop in (MD) The Infinium Global Screening Array (GSA) combines a highly optimized, universal genome-wide backbone,
More informationGenome-wide analyses in admixed populations: Challenges and opportunities
Genome-wide analyses in admixed populations: Challenges and opportunities E-mail: esteban.parra@utoronto.ca Esteban J. Parra, Ph.D. Admixed populations: an invaluable resource to study the genetics of
More informationGene Environment Interaction Analysis. Methods in Bioinformatics and Computational Biology. edited by. Sumiko Anno
Gene Environment Interaction Analysis Methods in Bioinformatics and Computational Biology edited by Sumiko Anno Gene Environment Interaction Analysis Gene Environment Interaction Analysis Methods in
More informationContent Objectives Write these down!
Content Objectives Write these down! I will be able to identify: Key terms associated with Mendelian Genetics The patterns of heredity explained by Mendel The law of segregation The relationship between
More informationMutations, Meioses, and Maps
Mutations, Meioses, and Maps Adaptive success of a population requires genetic variation Re-assortment of traits increases available variation Meiosis is the cellular mechanism of re-assortment Genetic
More informationAllocation of strains to haplotypes
Allocation of strains to haplotypes Haplotypes that are shared between two mouse strains are segments of the genome that are assumed to have descended form a common ancestor. If we assume that the reason
More informationSupplementary Note: Detecting population structure in rare variant data
Supplementary Note: Detecting population structure in rare variant data Inferring ancestry from genetic data is a common problem in both population and medical genetic studies, and many methods exist to
More informationPopulation and Statistical Genetics including Hardy-Weinberg Equilibrium (HWE) and Genetic Drift
Population and Statistical Genetics including Hardy-Weinberg Equilibrium (HWE) and Genetic Drift Heather J. Cordell Professor of Statistical Genetics Institute of Genetic Medicine Newcastle University,
More informationHuman Chromosomes Section 14.1
Human Chromosomes Section 14.1 In Today s class. We will look at Human chromosome and karyotypes Autosomal and Sex chromosomes How human traits are transmitted How traits can be traced through entire families
More information