Next Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms

Transcription

1 Next Generation Sequencing Lecture Saarbrücken, 19. March 2012 Sequencing Platforms

2 Contents Introduction Sequencing Workflow Platforms Roche 454 ABI SOLiD Illumina Genome Anlayzer / HiSeq Problems Quality Scores Tweaks Data Formats Resources 2

3 Introduction Rapid technological development 3 NGS platforms mainly used: Roche 454 ABI SOLiD Illumina Genome Anlayzer / HiSeq Others Sanger ( 1 st generation ) Polonator Ion Torrent Budget systems: Illumina MySeq, 454 Junior, Helicos Heliscope Oxford Nanopore Pacific Biosciences SMRT Sequencing Platforms Fabian Müller 3 Baker, Nature Methods, 2010

4 Distribution of Platforms All platforms 4

5 Distribution of Platforms GAII 5

6 Distribution of Platforms HiSeq 6

7 Distribution of Platforms SOLiD 7

8 Distribution of Platforms

9 Distribution of Platforms all platforms Sequencing Platforms Fabian Müller

10 Workflow Library preparation Fragmentation Adapter ligation Size selection Amplification Dehybridization Immobilization (2 nd ) Amplification Emulsion PCR Solid phase Sequencing Platforms Fabian Müller 10 Mardis, Annu. Rev. Genomics Hum. Genet., 2008

11 Workflow Library preparation Fragmentation Adapter ligation Size selection Amplification Dehybridization Immobilization (2 nd ) Amplification Emulsion PCR Solid phase Sequencing By synthesis o Cyclic reversible termination o Single-nucleotide addition By ligation Imaging Base calling Alignment/assembly Higher level data processing Quality Control 11

12 Illumina Genome Analyzer / HiSeq Previously: Solexa Then: Genome Analyzer State of the art: HiSeq 2500 Currently the most widely used platform Cluster generation step Sequencing by synthesis Reversible terminators 12

13 Illumina Genome Analyzer / HiSeq Hybridization to flow cell lawn of sequences complimentary to adapters 1 flow cell has 8 lanes 13 Mardis, Annu. Rev. Genomics Hum. Genet., 2008;

14 Illumina Genome Analyzer / HiSeq Cluster Generation: Bridge Amplification Denaturation Random cluster distances Strand removal s.t. a single direction can be sequenced 14 Mardis, Annu. Rev. Genomics Hum. Genet., 2008

15 Illumina Genome Analyzer / HiSeq Sequencing by synthesis using reversible terminator chemistry Add sequencing primer Add labeled nucleotides Excite and detect light emission Remove blocking group Image analysis for cluster identification Sequence of images yields DNA sequence 15 Metzker, Nature Reviews Genetics, 2010

16 Illumina Genome Analyzer / HiSeq Extensive output HiSeq allows for 2 flowcells to be processed simultaneously and images from top and bottom Substitutions are the most common error Spike-ins facilitate quality control and base calling calibration e.g. ΦX174 phage genome Limitations Read length limited by dephasing Quality decreases towards read ends as signal intensities decline Substitution biases as only 2 lasers excite 4 dntp (A/C, G/T) Alternative base callers (e.g. Ibis) Low complexity reads o Results from sequencing junk (e.g. dust, lints, ) 16

17 Roche 454 GS / FLX / Titanium Current machine version: GS FLX+ Emulsion PCR amplification Sequencing by synthesis Pyrosequencing 17

18 Roche 454 GS20 / FLX / Titanium Emulsion PCR Use water in oil emulsion to isolate single DNA molecules Amplification in microreactors produces millions of copies on each bead Applies also to ABI SOLiD Molecule to bead ratio to ensure 1 molecule per bead Occupied beads can be selected from empty ones via the second adapter sequence Sequencing Platforms Fabian Müller 18 Metzker, Nature Reviews Genetics, 2010

19 Roche 454 GS20 / FLX / Titanium A picotiter plate contains 1 bead per well ~2M wells Reagents are added Nucleotides (unlabeled) are successively washed across the plate ATP driven luciferase light reactions allows to monitor which and how many bases are incorporated 19 Metzker, Nature Reviews Genetics, 2010

20 Roche 454 GS20 / FLX / Titanium A picotiter plate contains 1 bead per well ~2M wells Reagents are added Nucleotides (unlabeled) are successively washed across the plate ATP driven luciferase light reactions allows to monitor which and how many bases are incorporated Imaging via high resolution CCD camera 20 Metzker, Nature Reviews Genetics, 2010

21 Roche 454 GS20 / FLX / Titanium Problems Mixed beads o Software postprocessing Long homopolymers can lead to inconsistent calls o Primary errors are insertions and deletions Bleed-over signals and ghost wells o Strong light emissions may influence neighboring well readout o Software correction Limitations Emulsion PCR technically challenging Polymerase and luciferase efficiency drops during run Long reads Deep sequencing 21

22 ABI SOLiD Life Technologies/Applied Biosystems Current machine versions: SOLiD4, 5500XL Emulsion PCR similar to 454 Sequencing by ligation Sequencing Platforms Fabian Müller 22

23 ABI SOLiD Use labeled oligonucleotides Degenerate positions 3-5 Specific dinucleotides at of 4 fluorescent dyes Sequencing Platforms Fabian Müller 23 Mardis, Annu. Rev. Genomics Hum. Genet., 2008

24 ABI SOLiD Sequencing: Ligation of oligos from mixture o First 2 bases will match the template Imaging Capping of unextended probes o Phosphatase treatment to prevent any remaining unextended strands from contributing to out of phase ligation events Cleaving off the flour Sequencing Platforms Fabian Müller 24 Mardis, Annu. Rev. Genomics Hum. Genet., 2008

25 Do for 5 primer offsets ABI SOLiD Sequencing: Do for n cycles Ligation of oligos from mixture o First 2 bases will match the template Imaging Capping of unextended probes o Phosphatase treatment to prevent any remaining unextended strands from contributing to out of phase ligation events Cleaving off the flour 25 Mardis, Annu. Rev. Genomics Hum. Genet., 2008

26 Do for 5 primer offsets ABI SOLiD Sequencing: Do for n cycles Ligation of oligos from mixture o First 2 bases will match the template Imaging Capping of unextended probes o Phosphatase treatment to prevent any remaining unextended strands from contributing to out of phase ligation events Cleaving off the flour 26 Mardis, Annu. Rev. Genomics Hum. Genet., 2008

27 ABI SOLiD Imaging cycling produces a chain of colors (color space) 27

28 ABI SOLiD Imaging cycling produces a chain of colors (color space) Each base is captured twice 28

29 ABI SOLiD Imaging cycling produces a chain of colors (color space) Each base is captured twice If the first base is known (we know the adapter), then for a given sequence the remaining bases follow Alignment in color space 29

30 ABI SOLiD Double interogation of each base facilitates discrimation of errors from true polymorphisms (SNPs) If reference sequence is present Works better in theory than in practice High accuracy 30

31 ABI SOLiD Double interogation of each base facilitates discrimation of errors from true polymorphisms (SNPs) If reference sequence is present Works better in theory than in practice High accuracy Problems Probes do not necessarily ligate next to the primer signal decline Limitations Emulsion PCR technically challenging Long run times Short read lengths 31

32 Problems All Platforms Dephasing Sequencing cycles out of sync Source o Multiple bases inserted o No base inserted o Terminator stuck or ineffective Adapter problems Adapter chimeras Sequencing into the adapter PCR artifacts E.g. coverage variation Library contamination Local effects E.g. bubbles, machine calibration, incomplete mixing of reagents, broken chemistry E.g. degraded fluorophores/ polymerase QC is essential! Tools: FastQC, SuperDeDuper, samtools, GATK, o See exercise 32

33 Platform Comparison Roche 454 ABI SOLiD Illumina HiSeq Read length bp 75bp (75+35bp PE) 2 * 105bp Runtime 23 h 7 d / genome 12 d Initial release 10/ Early 2007 #reads 1*10 6 6*10 8 3*10 9 (SE) 6*10 9 (PE) Error rates ~1% ~0.1% ~1% Machine cost ~ 690,000$ Sequencing cost ~ 20$ / Mb ~ 0.5$ / MB ~ 30$ / Gb 33

34 Quality Scores Phred Score (Q): Q = 10 log 10 P Here P denotes the estimated base calling error probability Base quality scores tend to decline towards the end of the read Reads are often trimmed before or in the alignment step 34

35 Tweaks Paired End Sequencing Virtually increases read length Better mapping Long inserts allow for efficient assembly Helpful in resolving structural variations and repetitive regions Sequencing Platforms Fabian Müller Kircher 2011

36 Tweaks Paired End Sequencing Virtually increases read length Better mapping Long inserts allow for efficient assembly Helpful in resolving structural variations and repetitive regions Mate Pair libraries Similar to paired end, but involves circularization Used for larger DNA molecules Provides distance information Sequencing Platforms Fabian Müller Kircher 2011

37 Tweaks Directional libraries Sequence only 1 strand Barcoding Aka multiplexing Adding sample specific tags allows for sequencing multiple samples in a single lane The samples can be separated based on their tags Sequencing Platforms Fabian Müller

38 File Formats Image data Usually discarded after base calling FASTA/FASTQ identifier (typically specifies flow cell location) Sequence quality scores (FASTQ only) SAM/BAM File format for aligned reads However due to good compression and annotation, also often used for storing unaligned reads More in the alignment lecture 38

39 File Formats FASTA/FASTQ identifier (typically specifies flow cell location and read number) Sequence quality scores (ASCII encoded, FASTQ only) Color space equivalents exist for SOLiD GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC +HWUSI-EAS100R:6:73:941:1973#0/1 IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC Different ASCII encodings for quality scores exist 39

40 File Formats FASTA/FASTQ identifier (typically specifies flow cell location and read number) Sequence quality scores (ASCII encoded, FASTQ only) Color space equivalents exist for SOLiD Different ASCII encodings for quality scores exist *.csfasta / *.qual >186_2041_1641_F3 T >186_2041_1706_F3 T >186_2041_1709_F3 T >97_2040_1850_F >97_2040_1898_F

41 Resources Seqanswers Forum and wiki for all sorts of questions concerning NGS NCBI Short Read Archive (SRA) Data archive for NGS data Discontinued? Maybe not European Nucleotide Archive (ENA) DNAnexus Cloud based data management and analysis capabilities for sequencing providers and researchers 41

42 Sequencing Platforms Questions? Sequencing Platforms Fabian Müller