Worksheet for Bioinformatics

Size: px
Start display at page:

Download "Worksheet for Bioinformatics"

Transcription

1 Worksheet for Bioinformatics ACTIVITY: Learn to use biological databases and sequence analysis tools Exercise 1 Biological Databases Objective: To use public biological databases to search for latest research discoveries. (1) Visit the databases below and report your findings. Research articles NCBI PubMed, What is the latest research on horse coat color? Taxonomy NCBI Taxonomy, How many protein sequences are found in corn compared with humans? Nucleotide NCBI Nucleotide, What is the nucleotide sequence of the maize domestication teosinte branched 1 gene (tb1)? Tip: Type into the search box a search phrase including gene name and organism name as below. tb1 AND zea mays[orgn] AND B73 How many matches did you get? How do you find out the length of the sequence from the match? Protein NCBI Protein, What is the protein sequence of the maize domestication tb1 gene? How long is the protein sequence? Genome NCBI Genome, How long is human chromosome 1? How long is this chromosome, i.e. how many base pairs or nucleotides? How many genes are found on this chromosome? 1

2 (2) Find examples of organisms that have been sequenced, and reasons for sequencing these genomes. How about genomes that have not been sequenced? Karyn s genome, Note that neither the sequencing corn genome nor the horse genome has been completed. How does the sequence of other genomes help us know about genes in unsequenced genomes like corn or horse. Go to and look at horse information to find out. 2

3 Exercise 2 Sequence analysis tools Objective: To use bioinformatics tools to analysis DNA and protein sequences (1) Sequence similarity search One of the genes involved in maize domestication gene is teosinte branched 1 (tb1). Use the mrna sequence below to determine which maize chromosome is the gene located? Go to NCBI BLAST, Select Nucleotide blast Cut and paste nucleotide sequence below (maize tb1 mrna) to the NCBI BLAST web site. This is your query sequence. Tip: You may need to adjust the Algorithm parameters to allow >500 hits in order to see the results of the chromosome matches. >gi : ATGGACTTACCGCTTTACCAACAACTGCAGCTAAGCCCGTCTTCCCCAAAGACGGACCAATCCAGCAGCT TCTACTGCTACCCATGCTCCCCTCCCTTCGCCGCCGCCGACGCCAGCTTTCCCCTCAGCTACCAGATCGG TAGTGCCGCGGCCGCCGACGCCACCCCTCCACAAGCCGTGATCAACTCGCCGGACCTGCCGGTGCAGGCG CTGATGGACCACGCGCCGGCGCCGGCTACAGAGCTGGGCGCCTGCGCCAGTGGTGCAGAAGGATCCGGCG CCAGCCTCGACAGGGCGGCTGCCGCGGCGAGGAAAGACCGGCACAGCAAGATATGCACCGCCGGCGGGAT GAGGGACCGCCGGATGCGGCTCTCCCTTGACGTCGCGCGCAAATTCTTCGCGCTGCAGGACATGCTTGGC TTCGACAAGGCAAGCAAGACGGTACAGTGGCTCCTCAACACGTCCAAGTCCGCCATCCAGGAGATCATGG CCGACGACGCGTCTTCGGAGTGCGTGGAGGACGGCTCCAGCAGCCTCTCCGTCGACGGCAAGCACAACCC GGCAGAGCAGCTGGGAGGAGGAGGAGATCAGAAGCCCAAGGGTAATTGCCGCGGCGAGGGGAAGAAGCCG GCCAAGGCAAGTAAAGCGGCGGCCACCCCGAAGCCGCCAAGAAAATCGGCCAATAACGCACACCAGGTCC CCGACAAGGAGACGAGGGCGAAAGCGAGGGAGAGGGCGAGGGAGCGGACCAAGGAGAAGCACCGGATGCG CTGGGTAAAGCTTGCTTCAGCAATTGACGTGGAGGCGGCGGCTGCCTCGGGGCCGAGCGACAGGCCGAGC TCGAACAATTTGAGCCACCACTCATCGTTGTCCATGAACATGCCGTGTGCTGCCGCTGAATTGGAGGAGA GGGAGAGGTGTTCATCAGCTCTCAGCAATAGATCAGCAGGTAGGATGCAAGAAATCACAGGGGCGAGCGA CGTGGTCCTGGGCTTTGGCAACGGAGGAGGAGGATACGGCGACGGCGGCGGCAACTACTACTGCCAAGAG CAATGGGAACTCGGTGGAGTCGTCTTTCAGCAGAACTCACGCTTCTACTGA (2) Translation of mrna to protein sequence Translate the maize tb1 mrna sequence into amino acid sequence. Go to the BMC launcher (Baylor College of Medicine), Cut and paste nucleotide sequence to the text box Select 6 Frame Translation Why are there six protein sequences in the results? What does the asterisks in the sequence * represent? Identify which is the corresponding amino acid sequence for tb1 mrna. 3

4 (3) Protein sequence analysis The amino acid sequence sometimes can be used to suggest the biological function of a protein. Use the tb1 protein sequence from above to find out if the protein contains any functional domains. Go to the protein domain Pfam database at, Select Search by Protein Name or sequence Cut and paste the tb1 amino acid sequence to the text box Can we suggest a function for the tb1 protein based on the search results? 4

5 Exercise 3 Case study Objective: To use combinations of databases and tools to study a specific topic 1) Study genetic diseases such as diabetes, and the genes involved a. What diabetes susceptibility gene was discovered by studying Pima Indian populations? What is the name of the gene? See article on The Pima Indians, Genetic Research from b. On which chromosomes does the diabetes gene map, and what is its function? Try searching at: NCBI Genome and NCBI Nucleotide databases ( OMIM, Online Mendelian Inheritance in Man ( c. Find examples of other genetic diseases. What are the symptoms of the disease? How are they inherited? Example of a simple recessive genetic disease, cystic fibrosis. Find more information at Try searching for other examples at 2) Study horse coat color and genes involved using: -Online Inheritance in Animals, -NCBI Nucleotide, -NCBI PubMed, a. Identify the gene involved in specifying cream coat color in horses (Tip: include both color and colour as your search terms if using NCBI Nucleotide database). b. What is the function of the protein? c. Find examples of other genes involved in horse coat color determination. 5

6 3) Study maize domestication from teosinte and genes involved using: -MaizeGDB, -NCBI Nucleotide, -NCBI PubMed, a. Using the tb1 sequence from Exercise 2, determine if the tb1 gene is found in Sorghum, a relative of maize? How to perform a sequence similarity search specifically against Sorghum sequences? b. Using the databases listed above, what can we learn about maize domestication? Can you find out additional web sites that describe maize domestication from the www? 6

Types of Databases - By Scope

Types of Databases - By Scope Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Contents Cell biology Organisms and cells Building blocks of cells How genes encode proteins? Bioinformatics What is bioinformatics? Practical applications Tools and databases

More information

Gene-centered resources at NCBI

Gene-centered resources at NCBI COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving

More information

Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks

Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional

More information

Gene-centered databases and Genome Browsers

Gene-centered databases and Genome Browsers COURSE OF BIOINFORMATICS a.a. 2015-2016 Gene-centered databases and Genome Browsers We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about

More information

Gene-centered databases and Genome Browsers

Gene-centered databases and Genome Browsers COURSE OF BIOINFORMATICS a.a. 2016-2017 Gene-centered databases and Genome Browsers We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about

More information

Chapter 2: Access to Information

Chapter 2: Access to Information Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI

More information

Data Retrieval from GenBank

Data Retrieval from GenBank Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing

More information

Sequence Analysis Lab Protocol

Sequence Analysis Lab Protocol Sequence Analysis Lab Protocol You will need this handout of instructions The sequence of your plasmid from the ABI The Accession number for Lambda DNA J02459 The Accession number for puc 18 is L09136

More information

Bioinformatics for Proteomics. Ann Loraine

Bioinformatics for Proteomics. Ann Loraine Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data

More information

Stalking the Genetic Basis of a Trait

Stalking the Genetic Basis of a Trait INTRODUCTION The short film Popped Secret: The Mysterious Origin of Corn describes how the evolution of corn was mostly a mystery until George Beadle proposed a bold new hypothesis in 1939: corn evolved

More information

Download the Lectin sequence output from

Download the Lectin sequence output from Computer Analysis of DNA and Protein Sequences Over the Internet Part I. IN CLASS Download the Lectin sequence output from http://stan.cropsci.uiuc.edu/courses/cpsc265/ Open these in BioEdit (free software).

More information

INTRODUCTION TO BIOINFORMATICS. SAINTS GENETICS Ian Bosdet

INTRODUCTION TO BIOINFORMATICS. SAINTS GENETICS Ian Bosdet INTRODUCTION TO BIOINFORMATICS SAINTS GENETICS 12-120522 - Ian Bosdet (ibosdet@bccancer.bc.ca) Bioinformatics bioinformatics is: the application of computational techniques to the fields of biology and

More information

Basics in Genetics. Teruyoshi Hishiki

Basics in Genetics. Teruyoshi Hishiki Basics in Genetics Teruyoshi Hishiki Advanced Bioinformatics 10/Apr/2017 1 Contents 1. Human Genetics: an application A case study of Familial Mediterranean Fever (FMF) patients 2. Introduction to human

More information

Genetics Transcription Translation Replication

Genetics Transcription Translation Replication Genetics Transcription Translation Replication 1. Which statement best describes the relationship between an allele and a gene? A. An allele is a variation of a gene that can be expressed as a phenotype.

More information

EECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science

EECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science EECS 730 Introduction to Bioinformatics Sequence Alignment Luke Huan Electrical Engineering and Computer Science http://people.eecs.ku.edu/~jhuan/ Database What is database An organized set of data Can

More information

FUNCTIONAL BIOINFORMATICS

FUNCTIONAL BIOINFORMATICS Molecular Biology-2018 1 FUNCTIONAL BIOINFORMATICS PREDICTING THE FUNCTION OF AN UNKNOWN PROTEIN Suppose you have found the amino acid sequence of an unknown protein and wish to find its potential function.

More information

Teaching Bioinformatics in the High School Classroom. Models for Disease. Why teach bioinformatics in high school?

Teaching Bioinformatics in the High School Classroom. Models for Disease. Why teach bioinformatics in high school? Why teach bioinformatics in high school? Teaching Bioinformatics in the High School Classroom David Form Nashoba Regional High School dform@nrsd.net Relevant, real life examples It s visual Allows for

More information

Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010

Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomics is a new and expanding field with an increasing impact

More information

Bioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine

Bioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Overview This lecture will

More information

Exome Sequencing Exome sequencing is a technique that is used to examine all of the protein-coding regions of the genome.

Exome Sequencing Exome sequencing is a technique that is used to examine all of the protein-coding regions of the genome. Glossary of Terms Genetics is a term that refers to the study of genes and their role in inheritance the way certain traits are passed down from one generation to another. Genomics is the study of all

More information

Protein Synthesis: From Gene RNA Protein Trait

Protein Synthesis: From Gene RNA Protein Trait Protein Synthesis: From Gene RNA Protein Trait Human Genome The human genome contains about genes. Each gene is a of DNA (sequence of nitrogen bases) contained within each chromosome. Each chromosome contains

More information

Assessment Schedule 2018 Biology: Demonstrate understanding of gene expression (91159)

Assessment Schedule 2018 Biology: Demonstrate understanding of gene expression (91159) NCEA Level 2 Biology (91159) 2018 page 1 of 5 Assessment Schedule 2018 Biology: Demonstrate understanding of gene expression (91159) Evidence Statement ONE (a) Triplet: 3 consecutive bases on DNA strand.

More information

Lesson Overview. Studying the Human Genome. Lesson Overview Studying the Human Genome

Lesson Overview. Studying the Human Genome. Lesson Overview Studying the Human Genome Lesson Overview 14.3 Studying the Human Genome THINK ABOUT IT Just a few decades ago, computers were gigantic machines found only in laboratories and universities. Today, many of us carry small, powerful

More information

SENIOR BIOLOGY. Blueprint of life and Genetics: the Code Broken? INTRODUCTORY NOTES NAME SCHOOL / ORGANISATION DATE. Bay 12, 1417.

SENIOR BIOLOGY. Blueprint of life and Genetics: the Code Broken? INTRODUCTORY NOTES NAME SCHOOL / ORGANISATION DATE. Bay 12, 1417. SENIOR BIOLOGY Blueprint of life and Genetics: the Code Broken? NAME SCHOOL / ORGANISATION DATE Bay 12, 1417 Bay number Specimen number INTRODUCTORY NOTES Blueprint of Life In this part of the workshop

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What

More information

Introduction to Bioinformatics for Medical Research. Gideon Greenspan TA: Oleg Rokhlenko. Lecture 1

Introduction to Bioinformatics for Medical Research. Gideon Greenspan TA: Oleg Rokhlenko. Lecture 1 Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il TA: Oleg Rokhlenko Lecture 1 Introduction to Bioinformatics Introduction to Bioinformatics What is Bioinformatics?

More information

SENIOR BIOLOGY. Blueprint of life and Genetics: the Code Broken? INTRODUCTORY NOTES NAME SCHOOL / ORGANISATION DATE. Bay 12, 1417.

SENIOR BIOLOGY. Blueprint of life and Genetics: the Code Broken? INTRODUCTORY NOTES NAME SCHOOL / ORGANISATION DATE. Bay 12, 1417. SENIOR BIOLOGY Blueprint of life and Genetics: the Code Broken? NAME SCHOOL / ORGANISATION DATE Bay 12, 1417 Bay number Specimen number INTRODUCTORY NOTES Blueprint of Life In this part of the workshop

More information

Molecular Genetics of Disease and the Human Genome Project

Molecular Genetics of Disease and the Human Genome Project 9 Molecular Genetics of Disease and the Human Genome Project Fig. 1. The 23 chromosomes in the human genome. There are 22 autosomes (chromosomes 1 to 22) and two sex chromosomes (X and Y). Females inherit

More information

Bioinformatics, in general, deals with the following important biological data:

Bioinformatics, in general, deals with the following important biological data: Pocket K No. 23 Bioinformatics for Plant Biotechnology Introduction As of July 30, 2006, scientists around the world are pursuing a total of 2,126 genome projects. There are 405 published complete genomes,

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

COMPUTER RESOURCES II:

COMPUTER RESOURCES II: COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer

More information

Bioinformatics for Cell Biologists

Bioinformatics for Cell Biologists Bioinformatics for Cell Biologists 15 19 March 2010 Developmental Biology and Regnerative Medicine (DBRM) Schedule Monday, March 15 09.00 11.00 Introduction to course and Bioinformatics (L1) D224 Helena

More information

Produced by the Centre for Genetics Education. Internet: 5

Produced by the Centre for Genetics Education. Internet:   5 Important points Genes are made of DNA The information in the DNA is in the form of a chemical code made up of four letters (A, T, C and G). Each word in the information is made up of three of these four

More information

Chapter 15 THE HUMAN GENOME PROJECT AND GENOMICS

Chapter 15 THE HUMAN GENOME PROJECT AND GENOMICS Chapter 15 THE HUMAN GENOME PROJECT AND GENOMICS Chapter Summary Mapping of human genes means identifying the chromosome and the position on that chromosome where a particular gene is located. Initially

More information

I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics

I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics Ch 12 Lecture Notes - DNA I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics 1 II. Griffith and Transformation

More information

user s guide Question 3

user s guide Question 3 Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map

More information

BME 110 Midterm Examination

BME 110 Midterm Examination BME 110 Midterm Examination May 10, 2011 Name: (please print) Directions: Please circle one answer for each question, unless the question specifies "circle all correct answers". You can use any resource

More information

Chapter 5. Structural Genomics

Chapter 5. Structural Genomics Chapter 5. Structural Genomics Contents 5. Structural Genomics 5.1. DNA Sequencing Strategies 5.1.1. Map-based Strategies 5.1.2. Whole Genome Shotgun Sequencing 5.2. Genome Annotation 5.2.1. Using Bioinformatic

More information

Two Mark question and Answers

Two Mark question and Answers 1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three

More information

O C. 5 th C. 3 rd C. the national health museum

O C. 5 th C. 3 rd C. the national health museum Elements of Molecular Biology Cells Cells is a basic unit of all living organisms. It stores all information to replicate itself Nucleus, chromosomes, genes, All living things are made of cells Prokaryote,

More information

Why learn sequence database searching? Searching Molecular Databases with BLAST

Why learn sequence database searching? Searching Molecular Databases with BLAST Why learn sequence database searching? Searching Molecular Databases with BLAST What have I cloned? Is this really!my gene"? Basic Local Alignment Search Tool How BLAST works Interpreting search results

More information

Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis

Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis Name: Date: Period: Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis ***Completing this study guide in its entirety will result in extra credit on the exam. You must show me the DAY OF the

More information

Annotation Walkthrough Workshop BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University

Annotation Walkthrough Workshop BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University Annotation Walkthrough Workshop NAME: BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University A Simple Annotation Exercise Adapted from: Alexis Nagengast,

More information

Genomes contain all of the information needed for an organism to grow and survive.

Genomes contain all of the information needed for an organism to grow and survive. Section 3: Genomes contain all of the information needed for an organism to grow and survive. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the components of the

More information

Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology

Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology Bioinformatics Model Answers Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology Page 1 of 15 Previous years questions asked. 1. Describe the software used in bioinformatics 2. Name four

More information

The University of California, Santa Cruz (UCSC) Genome Browser

The University of California, Santa Cruz (UCSC) Genome Browser The University of California, Santa Cruz (UCSC) Genome Browser There are hundreds of available userselected tracks in categories such as mapping and sequencing, phenotype and disease associations, genes,

More information

Imaging informatics computer assisted mammogram reading Clinical aka medical informatics CDSS combining bioinformatics for diagnosis, personalized

Imaging informatics computer assisted mammogram reading Clinical aka medical informatics CDSS combining bioinformatics for diagnosis, personalized 1 2 3 Imaging informatics computer assisted mammogram reading Clinical aka medical informatics CDSS combining bioinformatics for diagnosis, personalized medicine, risk assessment etc Public Health Bio

More information

Engineering Genetic Circuits

Engineering Genetic Circuits Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art

More information

HC70AL SUMMER 2014 PROFESSOR BOB GOLDBERG Gene Annotation Worksheet

HC70AL SUMMER 2014 PROFESSOR BOB GOLDBERG Gene Annotation Worksheet HC70AL SUMMER 2014 PROFESSOR BOB GOLDBERG Gene Annotation Worksheet NAME: DATE: QUESTION ONE Using primers given to you by your TA, you carried out sequencing reactions to determine the identity of the

More information

BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers

BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html UCSC

More information

BIOINFORMATICS IN BIOCHEMISTRY

BIOINFORMATICS IN BIOCHEMISTRY BIOINFORMATICS IN BIOCHEMISTRY Bioinformatics a field at the interface of molecular biology, computer science, and mathematics Bioinformatics focuses on the analysis of molecular sequences (DNA, RNA, and

More information

Biotechnology Explorer

Biotechnology Explorer Biotechnology Explorer C. elegans Behavior Kit Bioinformatics Supplement explorer.bio-rad.com Catalog #166-5120EDU This kit contains temperature-sensitive reagents. Open immediately and see individual

More information

Text Reference: Ch and 12-2

Text Reference: Ch and 12-2 Text Reference: Ch. 12-1 and 12-2 Name Date Block Part I: Short Answer/ Completion 1. What combination of sex chromosomes produces a female? 2. What combination of sex chromosomes produces a male? 3. Which

More information

BLASTing through the kingdom of life

BLASTing through the kingdom of life Information for teachers Description: In this activity, students copy unknown DNA sequences and use them to search GenBank, the main database of nucleotide sequences at the National Center for Biotechnology

More information

Bioinformatics for proteomics

Bioinformatics for proteomics Purdue-UAB Botanicals Center for Age-Related Disease Bioinformatics for proteomics Stephen Barnes, PhD Purdue-UAB Botanical Center Workshop 2002 Mass Spectrometry Methods in Botanicals Research Objectives

More information

user s guide Question 3

user s guide Question 3 Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru

More information

Algorithms in Bioinformatics

Algorithms in Bioinformatics Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline Central Dogma of Molecular

More information

Stalking the Genetic Basis of a Trait

Stalking the Genetic Basis of a Trait OVERVIEW This activity supplements the short film Popped Secret: The Mysterious Origin of Corn. It focuses on the tb1 gene, whose expression is related to phenotypic changes associated with the evolution

More information

Genes and human health - the science and ethics

Genes and human health - the science and ethics Deoxyribonucleic acid (DNA) - why is it so important? Genes and human health - the science and ethics DNA is essential to all living organisms, from bacteria to man, as it contains a code which specifies

More information

Visit ABLE on the Web at:

Visit ABLE on the Web at: This article reprinted from: Barrette-Ng, I. H., D. MacMillan, and D. Hansen. 2010. Towards A Deeper Understanding: Linking Mendelian Genetics With Molecular Genetics Using Web-Based Bioinformatics Tools.

More information

Online Mendelian Inheritance in Man (OMIM)

Online Mendelian Inheritance in Man (OMIM) HUMAN MUTATION 15:57 61 (2000) MDI SPECIAL ARTICLE Online Mendelian Inheritance in Man (OMIM) Ada Hamosh, Alan F. Scott,* Joanna Amberger, David Valle, and Victor A. McKusick McKusick-Nathans Institute

More information

Community-assisted genome annotation: The Pseudomonas example. Geoff Winsor, Simon Fraser University Burnaby (greater Vancouver), Canada

Community-assisted genome annotation: The Pseudomonas example. Geoff Winsor, Simon Fraser University Burnaby (greater Vancouver), Canada Community-assisted genome annotation: The Pseudomonas example Geoff Winsor, Simon Fraser University Burnaby (greater Vancouver), Canada Overview Pseudomonas Community Annotation Project (PseudoCAP) Past

More information

Hands-On Four Investigating Inherited Diseases

Hands-On Four Investigating Inherited Diseases Hands-On Four Investigating Inherited Diseases The purpose of these exercises is to introduce bioinformatics databases and tools. We investigate an important human gene and see how mutations give rise

More information

NCBI web resources I: databases and Entrez

NCBI web resources I: databases and Entrez NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table

More information

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005 Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of

More information

Subterm 2 Final Review Guide

Subterm 2 Final Review Guide Name: Date: Period: Subterm 2 Final Review Guide *** This review guide is only some of what you should know for the final. Make sure you study ALL of your notes and any diagrams that are appropriate (Pedigrees,

More information

Genetic databases. Anna Sowińska-Seidler, MSc, PhD Department of Medical Genetics

Genetic databases. Anna Sowińska-Seidler, MSc, PhD Department of Medical Genetics Genetic databases Anna Sowińska-Seidler, MSc, PhD seidler@ump.edu.pl Department of Medical Genetics Genetic databases what to start with? www.ncbi.nml.nih.gov NCBI National Center for Biotechnology Information

More information

Lecture 7 Motif Databases and Gene Finding

Lecture 7 Motif Databases and Gene Finding Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il Lecture 7 Motif Databases and Gene Finding Motif Databases & Gene Finding Motifs Recap Motif Databases TRANSFAC

More information

2. The dropdown box has a number of databases that are searchable. Select the gene option and search for dihydrofolate reductase.

2. The dropdown box has a number of databases that are searchable. Select the gene option and search for dihydrofolate reductase. Bioinformatics Introduction Worksheet The first part of this exercise is aimed at walking you through some of the key tools used by scientists to explore the relationship between genes and proteins throughout

More information

Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers

Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html

More information

DNA and the Production of Proteins Course Notes. Cell Biology. Sub-Topic 1.3 DNA and the Production of Proteins

DNA and the Production of Proteins Course Notes. Cell Biology. Sub-Topic 1.3 DNA and the Production of Proteins Cell Biology Sub-Topic 1.3 DNA and the Production of Proteins On completion of this subtopic I will be able to state that: Chromosomes contain genetic information that gives rise to an organism s characteristics.

More information

Exercise I, Sequence Analysis

Exercise I, Sequence Analysis Exercise I, Sequence Analysis atgcacttgagcagggaagaaatccacaaggactcaccagtctcctggtctgcagagaagacagaatcaacatgagcacagcaggaaaa gtaatcaaatgcaaagcagctgtgctatgggagttaaagaaacccttttccattgaggaggtggaggttgcacctcctaaggcccatgaagt

More information

DNA is normally found in pairs, held together by hydrogen bonds between the bases

DNA is normally found in pairs, held together by hydrogen bonds between the bases Bioinformatics Biology Review The genetic code is stored in DNA Deoxyribonucleic acid. DNA molecules are chains of four nucleotide bases Guanine, Thymine, Cytosine, Adenine DNA is normally found in pairs,

More information

Danika Bannasch DVM PhD. School of Veterinary Medicine University of California Davis

Danika Bannasch DVM PhD. School of Veterinary Medicine University of California Davis Genetics 101 Danika Bannasch DVM PhD Maxine Adler Endowed Chair in Genetics School of Veterinary Medicine University of California Davis Outline Basic genetics: The Rules Not so basic genetics: The exceptions

More information

Understanding Genes & Mutations. John A Phillips III May 16, 2005

Understanding Genes & Mutations. John A Phillips III May 16, 2005 Understanding Genes & Mutations John A Phillips III May 16, 2005 Learning Objectives Understand gene structure Become familiar with genetic & mutation databases Be able to find information on genetic variation

More information

Collect, analyze and synthesize. Annotation. Annotation for D. virilis. Evidence Based Annotation. GEP goals: Evidence for Gene Models 08/22/2017

Collect, analyze and synthesize. Annotation. Annotation for D. virilis. Evidence Based Annotation. GEP goals: Evidence for Gene Models 08/22/2017 Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l

More information

(Very) Basic Molecular Biology

(Very) Basic Molecular Biology (Very) Basic Molecular Biology (Very) Basic Molecular Biology Each human cell has 46 chromosomes --double-helix DNA molecule (Very) Basic Molecular Biology Each human cell has 46 chromosomes --double-helix

More information

Lesson: Bioinformatics: How can analysis of protein and / or nucleotide sequences help us to better understand living organisms?

Lesson: Bioinformatics: How can analysis of protein and / or nucleotide sequences help us to better understand living organisms? GENA Project Summer Workshop 2008 Partnership: Anita Klein and Linda Albright Lesson: Bioinformatics: How can analysis of protein and / or nucleotide sequences help us to better understand living organisms?

More information

Collect, analyze and synthesize. Annotation. Annotation for D. virilis. GEP goals: Evidence Based Annotation. Evidence for Gene Models 12/26/2018

Collect, analyze and synthesize. Annotation. Annotation for D. virilis. GEP goals: Evidence Based Annotation. Evidence for Gene Models 12/26/2018 Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l

More information

Finding Genes, Building Search Strategies and Visiting a Gene Page

Finding Genes, Building Search Strategies and Visiting a Gene Page Finding Genes, Building Search Strategies and Visiting a Gene Page 1. Finding a gene using text search. For this exercise use http://www.plasmodb.org a. Find all possible kinases in Plasmodium. Hint: use

More information

Finding Genes, Building Search Strategies and Visiting a Gene Page

Finding Genes, Building Search Strategies and Visiting a Gene Page Finding Genes, Building Search Strategies and Visiting a Gene Page 1. Finding a gene using text search. For this exercise use http://www.plasmodb.org a. Find all possible kinases in Plasmodium. Hint: use

More information

(a) (3 points) Which of these plants (use number) show e/e pattern? Which show E/E Pattern and which showed heterozygous e/e pattern?

(a) (3 points) Which of these plants (use number) show e/e pattern? Which show E/E Pattern and which showed heterozygous e/e pattern? 1. (20 points) What are each of the following molecular markers? (Indicate (a) what they stand for; (b) the nature of the molecular polymorphism and (c) Methods of detection (such as gel electrophoresis,

More information

GENETICS 1 Classification, Heredity, DNA & RNA. Classification, Objectives At the end of this sub section you should be able to: Heredity, DNA and RNA

GENETICS 1 Classification, Heredity, DNA & RNA. Classification, Objectives At the end of this sub section you should be able to: Heredity, DNA and RNA Classification, Heredity, DNA and Objectives At the end of this sub section you should be able to: RNA Heredity and Variation Gene Expression DNA structure DNA Profiling Protein Synthesis 1. Discuss the

More information

THE TEOSINTE HYPOTHESIS

THE TEOSINTE HYPOTHESIS THE TEOSINTE HYPOTHESIS OVERVIEW This lesson serves as a supplement to the short film (http://media.hhmi.org/biointeractive/films/poppedsecret.html) by providing students with a better understanding of

More information

Sequence Databases and database scanning

Sequence Databases and database scanning Sequence Databases and database scanning Marjolein Thunnissen Lund, 2012 Types of databases: Primary sequence databases (proteins and nucleic acids). Composite protein sequence databases. Secondary databases.

More information

ELE4120 Bioinformatics. Tutorial 5

ELE4120 Bioinformatics. Tutorial 5 ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar

More information

Your name: BSCI410-LIU/Spring 2007 Homework #2 Due March 27 (Tu), 07

Your name: BSCI410-LIU/Spring 2007 Homework #2 Due March 27 (Tu), 07 BSCI410-LIU/Spring 2007 Homework #2 Due March 27 (Tu), 07 KEY 1. What are each of the following molecular markers? (Indicate (a) what they stand for; (b) the nature of the molecular polymorphism and (c)

More information

Retrieval of gene information at NCBI

Retrieval of gene information at NCBI Retrieval of gene information at NCBI Some notes 1. http://www.cs.ucf.edu/~xiaoman/fall/ 2. Slides are for presenting the main paper, should minimize the copy and paste from the paper, should write in

More information

WSSP-10 Chapter 9 Determine ORF and BLASTP

WSSP-10 Chapter 9 Determine ORF and BLASTP WSSP-10 Chapter 9 Determine ORF and BLASTP Steps and terms used in protein expression 1 st ATG in mrna p 9-1 Cloning the cdna library p 9-1 Possible reading frames p 9-2 Possible types of clones in the

More information

You will need to follow the instructions below and answer any questions that accompany each section being studied.

You will need to follow the instructions below and answer any questions that accompany each section being studied. Genetics Science Learning Center Internet Activity This activity has been developed to review information you have learned in previous chapters and to introduce you to information that will be studied

More information

DNA & Protein Synthesis. The source and the process!

DNA & Protein Synthesis. The source and the process! DNA & Protein Synthesis The source and the process! Agenda I. DNA and Genes II. Protein Synthesis III. The Genetic Code I. DNA & Genes: The beauty of DNA Remember: DNA is a macromolecule that stores information

More information

Bioinformatics Programming and Analysis CSC Dr. Garrett Dancik

Bioinformatics Programming and Analysis CSC Dr. Garrett Dancik Bioinformatics Programming and Analysis CSC 315-01 Dr. Garrett Dancik What is bioinformatics Bioinformatics: Biology + information the study and utilization of methods for storing, retrieving and analyzing

More information

Non-Mendelian Inheritance

Non-Mendelian Inheritance Non-Mendelian Inheritance Objectives Predict possible outcomes of various genetic combinations such as monohybrid crosses, dihybrid crosses and non-mendelian inheritance (TEKS 6F) Background Information

More information

Grundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson

Grundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson Grundlagen der Bioinformatik, SoSe 11, D. Huson, April 11, 2011 1 1 Introduction Grundlagen der Bioinformatik Summer 2011 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a) 1.1

More information

Gene Annotation Project. Group 1. Tyler Tiede Yanzhu Ji Jenae Skelton

Gene Annotation Project. Group 1. Tyler Tiede Yanzhu Ji Jenae Skelton Gene Annotation Project Group 1 Tyler Tiede Yanzhu Ji Jenae Skelton Outline Tools Overview of 150kb region Overview of annotation process Characterization of 5 putative gene regions Analysis of masked

More information

Classical and Modern Genetics

Classical and Modern Genetics Classical and Modern Genetics Chapter 23 Great Idea: All living things use the same genetic code to guide the chemical reactions in every cell. 1 Chapter Outline Classical Genetics DNA and the Birth of

More information

Read each question, and write your answer in the space provided. 2. How did Mendel s scientific work differ from the work of T. A. Knight?

Read each question, and write your answer in the space provided. 2. How did Mendel s scientific work differ from the work of T. A. Knight? Name Date Class CHAPTER 8 DIRECTED READING Mendel and Heredity Section 8-1: The Origins of Genetics Mendel and Others Studied Garden-Pea Traits 1. What did T. A. Knight discover? 2. How did Mendel s scientific

More information