Utilization of the IWGSC Resources: Application to Wheat Breeding

Size: px
Start display at page:

Download "Utilization of the IWGSC Resources: Application to Wheat Breeding"

Transcription

1 Utilization of the IWGSC Resources: Application to Wheat Breeding Wheat Breeding: Securing Tomorrow s Profitability. Dr. Curtis J. Pozniak IWGSC Workshop, PAG, Jan 2014 Use and/or distribution of these slides is prohibited unless approval by the author is granted

2 Wheat Breeding at the UofS Spring and durum wheat breeding Objectives»Yield, maturity»abiotic stresses (terminal drought, heat)»biotic stresses (Rusts, FHB, Leaf-spotting diseases, Insect pests)»quality, Quality, Quality

3 Marker Assisted Breeding No Markers No. Data points (x1000) Focus: Stacking of single genes Biotic Stress Agronomic Quality

4

5 IWGSC Resources in Breeding BAC Libraries Physical Maps Wheat Survey Sequence 3B Sequence Unlimited source of DNA markers for MAS/Genomic Selection Candidate genes for traits = perfect markers Reduce the time and improve the success of resolving QTL Discovery and exploitation of new alleles

6 Speeding Gene Discovery: Stem Solidness in Wheat Saint Pierre et al. 2010; Functional Plant Biology, 37, 166.

7 Genetics of Stem Solidness Quantitative expression in hexaploid wheat Expression influenced by environment Evidence of suppression in hexaploid wheat Single dominant gene in durum wheat Little environmental influence on expression discrete classification

8 Stem Solidness in Wheat 3BL DH population of durum wheat (155 lines) 0.0 Xgwm SSt Xgwm Xgwm181 Houshmand et al. (2007) Mol Breeding 20:261

9 Physical Map -- High Density Map SSt1 Xgwm114 XBE XPSP3001 SSt1 Xgpw4513 Xgwm340 Xgwm247 Xgwm181 3B Physical Xgwm114 Xfba217 XBE ctg580 ctg854 Xgwm4703 ctg668 Xwmc274 ctg165 Xgwm247 Xgwm340 Xtam63 Xfba310 Xfba133.2 Xfbb293 Xdarts149 Xgwm181 Xgwm547 Xbarc68.2 Xgpw4513

10 Speed Gene Discovery: Towards Cloning SSt1 A High-density map B Fine map C 3B Pseudomolecule EI_ EI_ EK_ XBF EK_ XBF EK_ EK_ SSt EK_ EK_ SSt1 2.8 cm Approx. 2.2 Mb Ctg Xgwm Xgwm Kbp

11 Additional Marker Discovery BSA, Exome Sequencing WGS, Exome Sequencing 20 H lines SSt1- Bulk 20 S lines SSt1+ Bulk 10 SSt1- Cultivars 8 SSt1+ Cultivars Wheat 3B Pseudomolecule SNPs between bulks should be closely linked to SSt1 Filtering algorithms to identify SNPs in LD with SSt1

12 ap Fine Map Fine Map B Fine map C 3B Pseudomolecule EI_ No. SNPs No. SNPs 735 SNPs a EK_ XBF EK_ EK_ SSt1 Candidate Genes? Three genes association with cell wall biosynthesis 3 Duplicated lignin biosynthesis regulatory genes Xgwm Kbp a Includes INDELS 20 kb sliding window

13 Marker Assisted Selection HOLLOW AC Avonlea AC Morse AC Navigator AC Pathfinder CDC Verona Commander Strongfield Napoleon SOLID DT570 W9262 DT818 Fortore Colosseo Mongibello Lesina Camacho 9661-AF1D Hollow Solid Glenlea

14 D-Genome Suppression of SSt1 Strongfield DT570 Hexploid GD A0444-PJ03B DT665 DT743 H S H S H H Crossing of Glenlea derivative (AABBDD) to HOLLOW durum wheat (AABB) = SOLID Identification of SSt1 will allow us to design strategies to unsuppress SSt1 in hexaploid wheat

15 WSS and Gene Discovery Resistance to the OWBM Resistance to the OWBM (Sm1) - Localized to 2BS Current DNA markers are problematic Phenotyping is difficult/time consuming

16 Marker Discovery BSA + Exome Capture Cultivar Sequencing (Exome, WGS) 14 S lines Sm1- Bulk 14 R lines Sm1+ Bulk 15 Sm1- Cultivars 6 Sm1+ Cultivars Wheat 2Bs Wheat Survey SNPs between bulks should be closely linked to Sm1 Filtering algorithms to identify SNPs in LD with Sm1

17 Sm1 Summary of SNPs 3157 SNP calls in 1857 WSS contigs (0.1% Contigs) 100 SNPs converted to KASPar 67 Mapped to chromosome 2BS 59 Mapped with 1 cm of Sm contig b Contig gwm210 contig t Contig BS BS contig b contig b contig t contig b Contig BS contig b contig t contig t contig b contig b contig t contig b contig b contig t contig t contig t contig t BS BS contig b contig t contig t contig t contig t contig t contig b contig b contig b contig t contig b contig b contig t contig b contig t contig b contig b contig t contig b contig t contig b contig t Sm1 contig t contig t contig t contig t contig b contig b BS contig t contig t

18 Sm1 Associated SNPs Locus 2BS BS Putative Function (Rice proteome) Protein Unknown function NBS-LRR RGA Ascertainment BIAS Known Sm1 Carriers 2BS DNA replication initiation protein 2BS BS BS BS C3HC4 zinc-finger protein Protein Unknown function SAM dependent carboxyl methyltransferase Protein Unknown function Known Sm1 Carriers

19 The WSS as a Resource: Integration of marker types Anchoring of publically available mar Public Markers DArT Markers -- 4,904 Bristol SNP Markers 5,057 Illumina iselect Assay 87,218 Bin-Mapped ESTs 16,091 SSR Markers 290 Wheat MAS , , , , , , ,000 50,000 Anchoring of >3.6 Million Markers WGS/GBS 3.3 MILLION A Genome B Genome D Genome

20 WSS for Marker Improvement: Conversion to HT Genotyping Platforms Existing Markers Position in the WSS Identification of co-localized SNPs Low LOX High LOX CON SNPs High LOX Dominant marker Low LOX

21 U of Saskatchewan John Clarke Pierre Hucl Ron MacLachlan Ruan Yufeng Krysta Wiebe Amidou N Diaye NRC-PBI Andrew Sharpe Christine Sidebottom Darrin Klassen AAFC Curt McCartney Ron Knox Fran Clarke Danny Singh INRA Catherine Feuillet Pierre Sourdille Frédéric Choulet Etienne Paux Jane Rogers Kellye Eversole Klaus Mayer 21

The IWGSC: Strategies & Activities to Sequence the Bread Wheat Genome Jane Rogers IWGSC Deputy Executive Director

The IWGSC: Strategies & Activities to Sequence the Bread Wheat Genome Jane Rogers IWGSC Deputy Executive Director The IWGSC: Strategies & Activities to Sequence the Bread Wheat Genome Jane Rogers IWGSC Deputy Executive Director ACPFG Seminar University of Adelaide 1st May 2014 The International Wheat Genome Sequencing

More information

Welcome to the Future: Global Wheat Genome Sequencing Efforts

Welcome to the Future: Global Wheat Genome Sequencing Efforts Welcome to the Future: Global Wheat Genome Sequencing Efforts Crop Development Centre Durum Wheat Breeding and Genetics Program Dr. Curtis J. Pozniak Use and/or distribution of these slides is prohibited

More information

Excerpts from a Seminar at Bayer CropScience February 2015

Excerpts from a Seminar at Bayer CropScience February 2015 Excerpts from a Seminar at Bayer CropScience February 2015 Kellye Eversole IWGSC Executive Director Seminar Ghent, Belgium 12 February 2015 Update on the International Wheat Genome Sequencing Consortium

More information

Odyssey of the IWGSC Reference Genome Sequence: 12 years 1 month 28 days 11 hours 10 minutes and 14 seconds.

Odyssey of the IWGSC Reference Genome Sequence: 12 years 1 month 28 days 11 hours 10 minutes and 14 seconds. Odyssey of the IWGSC Reference Genome Sequence: 12 years 1 month 28 days 11 hours 10 minutes and 14 seconds. Kellye Eversole IWGSC Executive Director Plant Genomics and Gene Editing Congress Amsterdam,

More information

The$IWGSC:$$$ Strategies$&$Ac4vi4es$to$Sequence$ the$bread$wheat$genome$

The$IWGSC:$$$ Strategies$&$Ac4vi4es$to$Sequence$ the$bread$wheat$genome$ The$IWGSC:$$$ Strategies$&$Ac4vi4es$to$Sequence$ the$bread$wheat$genome$ Kellye$A.$Eversole! IWGSC!Execu,ve!Director! &$ The$IWGSC$ Wheat$Breeding$2014:$$Tools,$Targets,$&$Progress$ Harpenden,$United$Kingdom$

More information

FHB Resistance in Durum -Progress and Challenge

FHB Resistance in Durum -Progress and Challenge FHB Resistance in Durum -Progress and Challenge Elias Elias, Shahryar Kianian, Shaobin Zhong, and Xiwen Cai North Dakota State University, Fargo, ND Steven Xu USDA-ARS, Fargo, ND Outline Sources of resistance

More information

A draft sequence of bread wheat chromosome 7B based on individual MTP BAC sequencing using pair end and mate pair libraries.

A draft sequence of bread wheat chromosome 7B based on individual MTP BAC sequencing using pair end and mate pair libraries. A draft sequence of bread wheat chromosome 7B based on individual MTP BAC sequencing using pair end and mate pair libraries. O. A. Olsen, T. Belova, B. Zhan, S. R. Sandve, J. Hu, L. Li, J. Min, J. Chen,

More information

Association Mapping in Wheat: Issues and Trends

Association Mapping in Wheat: Issues and Trends Association Mapping in Wheat: Issues and Trends Dr. Pawan L. Kulwal Mahatma Phule Agricultural University, Rahuri-413 722 (MS), India Contents Status of AM studies in wheat Comparison with other important

More information

The international effort to sequence the 17Gb wheat genome: Yes, Wheat can!

The international effort to sequence the 17Gb wheat genome: Yes, Wheat can! ACTTGTGCATAGCATGCAATGCCAT ATATAGCAGTCTGCTAAGTCTATAG CAGACCCTCAACGTGGATCATCCGT AGCTAGCCATGACATTGATCCTGAT TTACACCATGTACTATCGAGAGCAG TACTACCATGTTACGATCAAAGCCG TTACGATAGCATGAACTTGTGCATA GCATGCAATGCCATATATAGCAGTC

More information

Using LTC Software for Physical Mapping and Assisting in Sequence Assembly

Using LTC Software for Physical Mapping and Assisting in Sequence Assembly Using LTC Software for Physical Mapping and Assisting in Sequence Assembly Z. Frenkel, V. Glikson, A. Korol Institute of Evolution, University of Haifa See also poster P1194 PAGXXIII, San Diego, January

More information

Anchoring and ordering NGS contig assemblies by population sequencing (POPSEQ)

Anchoring and ordering NGS contig assemblies by population sequencing (POPSEQ) Anchoring and ordering NGS contig assemblies by population sequencing (POPSEQ) Martin Mascher IPK Gatersleben PAG XXII January 14, 2012 slide 1 Proof-of-principle in barley Diploid model for wheat 5 Gb

More information

Progress on DNA Sequencing Project of the Wheat Chromosome 6B in Japan

Progress on DNA Sequencing Project of the Wheat Chromosome 6B in Japan Progress on DNA Sequencing Project of the Wheat Chromosome 6B in Japan Yasunari Ogihara 1, Kanako Kawaura 1, Shuhei Nasuda 2, Takashi R. Endo 2, Katsuyuki Hayakawa 3, Jaroslav Dolezel 4,Hirokazu Handa

More information

TABLE OF CONTENTS. SECTION 01 The History of Wheat Breeding in Canada. SECTION 04 The Team. SECTION 05 Funding Support. SECTION 02 Project Overview

TABLE OF CONTENTS. SECTION 01 The History of Wheat Breeding in Canada. SECTION 04 The Team. SECTION 05 Funding Support. SECTION 02 Project Overview TABLE OF CONTENTS SECTION 01 The History of Wheat Breeding in Canada SECTION 04 The Team SECTION 02 Project Overview SECTION 05 Funding Support SECTION 03 Benefits of Plant Breeding SECTION 06 Future of

More information

Determination of solid stem gene location of durum wheat using double haploid and recombinant inbred line populations

Determination of solid stem gene location of durum wheat using double haploid and recombinant inbred line populations Proceedings of The Fourth International Iran & Russia Conference 148 Determination of solid stem gene location of durum wheat using double haploid and recombinant inbred line populations Saadollah Houshmand

More information

AP 2010 Biotechnologie-Bioressources

AP 2010 Biotechnologie-Bioressources AP 2010 Biotechnologie-Bioressources Développer de nouvelles variétés de blé pour une agriculture durable: une approche intégrée de la génomique à la sélection Breeding for economically and environmentally

More information

Usage Cases of GBS. Jeff Glaubitz Senior Research Associate, Buckler Lab, Cornell University Panzea Project Manager

Usage Cases of GBS. Jeff Glaubitz Senior Research Associate, Buckler Lab, Cornell University Panzea Project Manager Usage Cases of GBS Jeff Glaubitz (jcg233@cornell.edu) Senior Research Associate, Buckler Lab, Cornell University Panzea Project Manager Cornell CBSU Workshop Sept 15 16, 2011 Some potential applications

More information

Advances in Breeding for Resistance to Stem Rust Caused by Ug99 and Ethiopian Pgt Races in Durum Wheat

Advances in Breeding for Resistance to Stem Rust Caused by Ug99 and Ethiopian Pgt Races in Durum Wheat Borlaug Global Rust Initiative Technical Workshop 2014 Session: Rust Resistance in Tetraploids Ciudad Obregon, March 23, 2014 Advances in Breeding for Resistance to Stem Rust Caused by Ug99 and Ethiopian

More information

A high density GBS map of bread wheat and its application for genetic improvement of the crop

A high density GBS map of bread wheat and its application for genetic improvement of the crop A high density GBS map of bread wheat and its application for genetic improvement of the crop Sukhwinder-Singh Wheat-Lead Seeds of Discovery (suk.singh@cgiar.org) International Maize and Wheat Improvement

More information

Application of Genotyping-By-Sequencing and Genome-Wide Association Analysis in Tetraploid Potato

Application of Genotyping-By-Sequencing and Genome-Wide Association Analysis in Tetraploid Potato Application of Genotyping-By-Sequencing and Genome-Wide Association Analysis in Tetraploid Potato Sanjeev K Sharma Cell and Molecular Sciences The 3 rd Plant Genomics Congress, London 12 th May 2015 Potato

More information

Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze

Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering,

More information

Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010

Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010 Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010 Traditional QTL approach Uses standard bi-parental mapping populations o F2 or RI These have a limited number of

More information

A brief introduction to Marker-Assisted Breeding. a BASF Plant Science Company

A brief introduction to Marker-Assisted Breeding. a BASF Plant Science Company A brief introduction to Marker-Assisted Breeding a BASF Plant Science Company Gene Expression DNA is stored in chromosomes within the nucleus of each cell RNA Cell Chromosome Gene Isoleucin Proline Valine

More information

Research Article A High-Density SNP and SSR Consensus Map Reveals Segregation Distortion Regions in Wheat

Research Article A High-Density SNP and SSR Consensus Map Reveals Segregation Distortion Regions in Wheat BioMed Research International Volume 2015, Article ID 830618, 10 pages http://dx.doi.org/10.1155/2015/830618 Research Article A High-Density SNP and SSR Consensus Map Reveals Segregation Distortion Regions

More information

Identifying the functional bases of trait variation in Brassica napus using Associative Transcriptomics

Identifying the functional bases of trait variation in Brassica napus using Associative Transcriptomics Brassica genome structure and evolution Genome framework for association genetics Establishing marker-trait associations 31 st March 2014 GENOME RELATIONSHIPS BETWEEN SPECIES U s TRIANGLE 31 st March 2014

More information

Map-Based Cloning of Qualitative Plant Genes

Map-Based Cloning of Qualitative Plant Genes Map-Based Cloning of Qualitative Plant Genes Map-based cloning using the genetic relationship between a gene and a marker as the basis for beginning a search for a gene Chromosome walking moving toward

More information

Lecture 21: Association Studies and Signatures of Selection. November 6, 2006

Lecture 21: Association Studies and Signatures of Selection. November 6, 2006 Lecture 21: Association Studies and Signatures of Selection November 6, 2006 Announcements Outline due today (10 points) Only one reading for Wednesday: Nielsen, Molecular Signatures of Natural Selection

More information

Improving barley and wheat germplasm for changing environments

Improving barley and wheat germplasm for changing environments AWARD NUMBER: 2011-68002-30029 Improving barley and wheat germplasm for changing environments Triticeae CAP (T-CAP) 56 participants, 28 institutions, 21 states Integration of wheat and barley research

More information

Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection

Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection Awais Khan Adaptation and Abiotic Stress Genetics, Potato and sweetpotato International Potato

More information

Rust Resistance Gene Cloning

Rust Resistance Gene Cloning University of Minnesota Rust Resistance Gene Cloning perfect markers and cassette development Peter Dodds BGRI technical workshop March 2014 Outlook: R gene pyramids via GM gene cassettes Stacking of multiple

More information

High level of structural and sequence divergence between homologous regions of bread wheat and T. militinae

High level of structural and sequence divergence between homologous regions of bread wheat and T. militinae High level of structural and sequence divergence between homologous regions of bread wheat and T. militinae within the powdery mildew resistance locus QPm.tut-4A Miroslav Valárik Institute of Experimental

More information

Module 1 Principles of plant breeding

Module 1 Principles of plant breeding Covered topics, Distance Learning course Plant Breeding M1-M5 V2.0 Dr. Jan-Kees Goud, Wageningen University & Research The five main modules consist of the following content: Module 1 Principles of plant

More information

Identifying and exploiting natural variation

Identifying and exploiting natural variation Identifying and exploiting natural variation New methods of fine mapping: association mapping MAGIC Methods for increasing diversity: synthetic wheat Advantages of new methods for fine mapping More efficient

More information

Functional genomics to improve wheat disease resistance. Dina Raats Postdoctoral Scientist, Krasileva Group

Functional genomics to improve wheat disease resistance. Dina Raats Postdoctoral Scientist, Krasileva Group Functional genomics to improve wheat disease resistance Dina Raats Postdoctoral Scientist, Krasileva Group Talk plan Goal: to contribute to the crop improvement by isolating YR resistance genes from cultivated

More information

SolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze

SolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze SolCAP Solanaceae Coordinated Agricultural Project Supported by the National Research Initiative Plant Genome Program of USDA CSREES for the Improvement of Potato and Tomato Executive Commitee : David

More information

Chapter 11 Development of the BAC Physical Maps of Wheat Chromosome 6B for Its Genomic Sequencing

Chapter 11 Development of the BAC Physical Maps of Wheat Chromosome 6B for Its Genomic Sequencing Chapter 11 Development of the BAC Physical Maps of Wheat Chromosome 6B for Its Genomic Sequencing Fuminori Kobayashi, Satoshi Katagiri, Wataru Karasawa, Yumiko Hanawa, Hiroyuki Kanamori, Yukiyo Ito, Hiroko

More information

GBS Usage Cases: Examples from Maize

GBS Usage Cases: Examples from Maize GBS Usage Cases: Examples from Maize Jeff Glaubitz (jcg233@cornell.edu) Senior Research Associate, Buckler Lab, Cornell University Panzea Project Manager Cornell IGD/CBSU Workshop June 17 18, 2013 Some

More information

SNPs - GWAS - eqtls. Sebastian Schmeier

SNPs - GWAS - eqtls. Sebastian Schmeier SNPs - GWAS - eqtls s.schmeier@gmail.com http://sschmeier.github.io/bioinf-workshop/ 17.08.2015 Overview Single nucleotide polymorphism (refresh) SNPs effect on genes (refresh) Genome-wide association

More information

Authors: Vivek Sharma and Ram Kunwar

Authors: Vivek Sharma and Ram Kunwar Molecular markers types and applications A genetic marker is a gene or known DNA sequence on a chromosome that can be used to identify individuals or species. Why we need Molecular Markers There will be

More information

Structure and Dynamics of the Hexaploid Wheat Genome

Structure and Dynamics of the Hexaploid Wheat Genome TGAC 2016 March 30 th Structure and Dynamics of the Hexaploid Wheat Genome Frédéric CHOULET Genetics Diversity Ecophysiology of Cereals INRA U. Clermont-Ferrand, France Structure, evolution of wheat genome

More information

Potential of human genome sequencing. Paul Pharoah Reader in Cancer Epidemiology University of Cambridge

Potential of human genome sequencing. Paul Pharoah Reader in Cancer Epidemiology University of Cambridge Potential of human genome sequencing Paul Pharoah Reader in Cancer Epidemiology University of Cambridge Key considerations Strength of association Exposure Genetic model Outcome Quantitative trait Binary

More information

USWBSI Barley CP Milestone Matrix Updated

USWBSI Barley CP Milestone Matrix Updated USWBSI Barley CP Milestone Matrix Updated 10-10-13 RA: Variety Development and Host Resistance (VDHR) CP Objective 2: Map Novel QTL for resistance to FHB in barley BS, KS Dec 2013 Make initial crosses

More information

Characterization of Sclerotinia phenotypic variation relevant to diseases of sunflower

Characterization of Sclerotinia phenotypic variation relevant to diseases of sunflower Characterization of Sclerotinia phenotypic variation relevant to diseases of sunflower Bill Underwood Research Plant Pathologist USDA-ARS Northern Crop Science Laboratory, Fargo ND Sclerotinia diseases

More information

Pharmacogenetics: A SNPshot of the Future. Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001

Pharmacogenetics: A SNPshot of the Future. Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001 Pharmacogenetics: A SNPshot of the Future Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001 1 I. What is pharmacogenetics? It is the study of how genetic variation affects drug response

More information

Applying next-generation sequencing to enable marker-assisted breeding for adaptive traits in a homegrown haricot bean (Phaseolus vulgaris L.

Applying next-generation sequencing to enable marker-assisted breeding for adaptive traits in a homegrown haricot bean (Phaseolus vulgaris L. Applying next-generation sequencing to enable marker-assisted breeding for adaptive traits in a homegrown haricot bean (Phaseolus vulgaris L.) Andrew Tock Prof Eric Holub & Dr Guy Barker University of

More information

Genomics assisted breeding for disease resistance in oats. Gnanesh Nanjappa

Genomics assisted breeding for disease resistance in oats. Gnanesh Nanjappa Genomics assisted breeding for disease resistance in oats Gnanesh Nanjappa Diseases of oats Crown rust (Puccinia coronata f. sp. avenae) Stem rust (Puccinia graminis f. sp. avenae) Resistant Breeding More

More information

Functional identification of the wheat gene enhancing mycotoxin detoxification of the major Fusarium resistance QTL Fhb1

Functional identification of the wheat gene enhancing mycotoxin detoxification of the major Fusarium resistance QTL Fhb1 Functional identification of the wheat gene enhancing mycotoxin detoxification of the major Fusarium resistance QTL Fhb1 Barbara Steiner, Simone Zimmerl, Marc Lemmens, Gerhard Adam, Bradley Till, Wolfgang

More information

PROJECT CODE BRE1010

PROJECT CODE BRE1010 1 TITLE Implementation of Markers for Pulses (imap) PROJECT CODE BRE1010 INVESTIGATORS Co-Principal Investigators: Bunyamin Tar an and Kirstin Bett, Department of Plant Sciences, University of Saskatchewan

More information

UK Wheat Productivity Research Targets and Needs. Commercial Wheat Breeding Perspective. Dr. Richard Summers RAGT Seeds

UK Wheat Productivity Research Targets and Needs. Commercial Wheat Breeding Perspective. Dr. Richard Summers RAGT Seeds UK Wheat Productivity Research Targets and Needs Commercial Wheat Breeding Perspective Dr. Richard Summers RAGT Seeds UK Wheat Productivity Research Targets and Needs Global population growth Increased

More information

Analysis of QTL for High Grain Protein Content in Canadian Durum Wheat

Analysis of QTL for High Grain Protein Content in Canadian Durum Wheat Analysis of QTL for High Grain Protein Content in Canadian Durum Wheat Suprayogi 1, C.J. Pozniak 1, J.M. Clarke 2, F.R. Clarke2 and R.E. Knox 2 1 Dept. of Plant Science and Crop Development Centre, University

More information

HIGH-QUALITY ASSEMBLY OF THE DURUM WHEAT GENOME CV. SVEVO

HIGH-QUALITY ASSEMBLY OF THE DURUM WHEAT GENOME CV. SVEVO HIGH-QUALITY ASSEMBLY OF THE DURUM WHEAT GENOME CV. SVEVO Luigi Cattivelli, The International Durum Wheat Genome Sequencing Consortium 31/01/2017 1 Durum wheat Durum wheat with a total production of about

More information

High density genotyping and phenotyping data: challenges of leveraging novel technologies for the valorization of PGR

High density genotyping and phenotyping data: challenges of leveraging novel technologies for the valorization of PGR High density genotyping and phenotyping data: challenges of leveraging novel technologies for the valorization of PGR Nils Stein, Joel Kuon, Uwe Scholz, Martin Mascher, Benjamin Kilian, Kerstin Neumann,

More information

Synthetic wheat. an underutilized genetic resource in Nordic wheat breeding. Morten Lillemo, IPM, UMB

Synthetic wheat. an underutilized genetic resource in Nordic wheat breeding. Morten Lillemo, IPM, UMB an underutilized genetic resource in Nordic wheat breeding Morten Lillemo, IPM, UMB 2111 2005 Wheat evolution There is a huge genetic diversity in Ae. tauschii Genetic diversity of bread wheat is low,

More information

Mapping by sequencing in complex polyploid genomes using genic sequence capture: a case study to map yellow rust resistance in hexaploid wheat

Mapping by sequencing in complex polyploid genomes using genic sequence capture: a case study to map yellow rust resistance in hexaploid wheat Mapping by sequencing in complex polyploid genomes using genic sequence capture: a case study to map yellow rust resistance in hexaploid wheat Article Published Version Creative Commons: Attribution 4.0

More information

Genomics in the Barossa. ITMI Workshop 3rd Annual ACPFG Research Symposium.

Genomics in the Barossa. ITMI Workshop 3rd Annual ACPFG Research Symposium. ITMI Workshop 3rd Annual ACPFG Research Symposium www.acpfg.com.au 3rd Annual ACPFG Research Symposium The International Triticeae Mapping Initiative and the Australian Centre for Plant Functional Genomics

More information

TABLE OF CONTENTS. Abbreviations List of figures List of Tables Acknowledgements Abstract..1-2

TABLE OF CONTENTS. Abbreviations List of figures List of Tables Acknowledgements Abstract..1-2 TABLE OF CONTENTS Abbreviations List of figures List of Tables Acknowledgements Abstract..1-2 Chapter 1: Introduction and Review of literature......3-30 1.1. Introduction: Wheat 1.1.1. Economic importance

More information

BIOBREED & NUTRIEFFICIENT

BIOBREED & NUTRIEFFICIENT BIOBREED & NUTRIEFFICIENT Søren K. Rasmussen Plant & Soil Science Section Molecular Plant Breeding Workshop on Nordic PPP on Pre-breeding 17th -18th February 2011, Conference Hotel Siikaranta, Finland

More information

Toward a better understanding of plant genomes structure: combining NGS and optical mapping technology to improve the sunflower assembly

Toward a better understanding of plant genomes structure: combining NGS and optical mapping technology to improve the sunflower assembly Toward a better understanding of plant genomes structure: combining NGS and optical mapping technology to improve the sunflower assembly Céline CHANTRY-DARMON 1 CNRGV The French Plant Genomic Center Created

More information

Genomic resources and gene/qtl discovery in cereals

Genomic resources and gene/qtl discovery in cereals Genomic resources and gene/qtl discovery in cereals Roberto Tuberosa Dept. of Agroenvironmental Sciences & Technology University of Bologna, Italy The ABDC Congress 1-4 March 2010 Gudalajara, Mexico Outline

More information

Identifying Genes Underlying QTLs

Identifying Genes Underlying QTLs Identifying Genes Underlying QTLs Reading: Frary, A. et al. 2000. fw2.2: A quantitative trait locus key to the evolution of tomato fruit size. Science 289:85-87. Paran, I. and D. Zamir. 2003. Quantitative

More information

I.1 The Principle: Identification and Application of Molecular Markers

I.1 The Principle: Identification and Application of Molecular Markers I.1 The Principle: Identification and Application of Molecular Markers P. Langridge and K. Chalmers 1 1 Introduction Plant breeding is based around the identification and utilisation of genetic variation.

More information

Brassica carinata crop improvement & molecular tools for improving crop performance

Brassica carinata crop improvement & molecular tools for improving crop performance Brassica carinata crop improvement & molecular tools for improving crop performance Germplasm screening Germplasm collection and diversity What has been done in the US to date, plans for future Genetic

More information

Traditional Genetic Improvement. Genetic variation is due to differences in DNA sequence. Adding DNA sequence data to traditional breeding.

Traditional Genetic Improvement. Genetic variation is due to differences in DNA sequence. Adding DNA sequence data to traditional breeding. 1 Introduction What is Genomic selection and how does it work? How can we best use DNA data in the selection of cattle? Mike Goddard 5/1/9 University of Melbourne and Victorian DPI of genomic selection

More information

MAS refers to the use of DNA markers that are tightly-linked to target loci as a substitute for or to assist phenotypic screening.

MAS refers to the use of DNA markers that are tightly-linked to target loci as a substitute for or to assist phenotypic screening. Marker assisted selection in rice Introduction The development of DNA (or molecular) markers has irreversibly changed the disciplines of plant genetics and plant breeding. While there are several applications

More information

Wheat Genome Structural Annotation Using a Modular and Evidence-combined Annotation Pipeline

Wheat Genome Structural Annotation Using a Modular and Evidence-combined Annotation Pipeline Wheat Genome Structural Annotation Using a Modular and Evidence-combined Annotation Pipeline Xi Wang Bioinformatics Scientist Computational Life Science Page 1 Bayer 4:3 Template 2010 March 2016 17/01/2017

More information

Durum Wheat Genomics and Breeding EWG Annual report and action plan

Durum Wheat Genomics and Breeding EWG Annual report and action plan Coordinating global research for wheat Durum Wheat Genomics and Breeding EWG Annual report and action plan NAME OF EXPERT WORKING GROUP EWG on DURUM WHEAT GENOMICS AND BREEDING LEADERSHIP & AUTHORSHIP

More information

OBJECTIVES-ACTIVITIES 2-4

OBJECTIVES-ACTIVITIES 2-4 OBJECTIVES-ACTIVITIES 2-4 Germplasm Phenotyping Genomics PBA BIMS MAB Pipeline Implementation GOALS, ACTIVITIES, & DELIVERABLES Cameron Peace, project co-director & MAB Pipeline Team leader Outline of

More information

Phenotypic response conferred by the Lr22a leaf rust resistance gene against ten Swiss P. triticina isolates.

Phenotypic response conferred by the Lr22a leaf rust resistance gene against ten Swiss P. triticina isolates. Supplementary Figure 1 Phenotypic response conferred by the leaf rust resistance gene against ten Swiss P. triticina isolates. The third leaf of Thatcher (left) and RL6044 (right) is shown ten days after

More information

Triticeae Gene Nomenclature

Triticeae Gene Nomenclature A Wheat Initiative workshop Triticeae Gene Nomenclature 11-13 October 2016, Munich (Germany) Report 1 Background A number of high quality genome sequences have been completed in recent years for species

More information

Genotypic data densification for genomic selection in the black poplar. Thesis director : Léopoldo SANCHEZ, Supervisor : Véronique JORGE

Genotypic data densification for genomic selection in the black poplar. Thesis director : Léopoldo SANCHEZ, Supervisor : Véronique JORGE Genotypic data densification for genomic selection in the black poplar Thesis director : Léopoldo SANCHEZ, Supervisor : Véronique JORGE Three main questions Thesis project focus on best way to implement

More information

Using molecular marker technology in studies on plant genetic diversity Final considerations

Using molecular marker technology in studies on plant genetic diversity Final considerations Using molecular marker technology in studies on plant genetic diversity Final considerations Copyright: IPGRI and Cornell University, 2003 Final considerations 1 Contents! When choosing a technique...!

More information

Sequence-based assembly of chromosome 7A and comparison to diploid progenitors

Sequence-based assembly of chromosome 7A and comparison to diploid progenitors Sequence-based assembly of chromosome 7A and comparison to diploid progenitors Gabriel Keeble-Gagnere1 J Nystrom-Persson1, C Cavanagh2, D Fleury3, H Webster1, R Appels1 1 Veterinary and Life Sciences,

More information

A barley root mutant collection for NGS-based fast-forward genetics

A barley root mutant collection for NGS-based fast-forward genetics A barley root mutant collection for NGS-based fast-forward genetics Roberto Tuberosa Dept. of Agricultural Sciences University of Bologna, Italy 2 nd Plant Genomics Congress Kuala Lumpur, 19-20 March,

More information

Bull Selection Strategies Using Genomic Estimated Breeding Values

Bull Selection Strategies Using Genomic Estimated Breeding Values R R Bull Selection Strategies Using Genomic Estimated Breeding Values Larry Schaeffer CGIL, University of Guelph ICAR-Interbull Meeting Niagara Falls, NY June 8, 2008 Understanding Cancer and Related Topics

More information

Next Generation Genetics: Using deep sequencing to connect phenotype to genotype

Next Generation Genetics: Using deep sequencing to connect phenotype to genotype Next Generation Genetics: Using deep sequencing to connect phenotype to genotype http://1001genomes.org Korbinian Schneeberger Connecting Genotype and Phenotype Genotyping SNPs small Resequencing SVs*

More information

MICROSATELLITE MARKER AND ITS UTILITY

MICROSATELLITE MARKER AND ITS UTILITY Your full article ( between 500 to 5000 words) - - Do check for grammatical errors or spelling mistakes MICROSATELLITE MARKER AND ITS UTILITY 1 Prasenjit, D., 2 Anirudha, S. K. and 3 Mallar, N.K. 1,2 M.Sc.(Agri.),

More information

A Whole Genome Assembly of Rye (Secale cereale)

A Whole Genome Assembly of Rye (Secale cereale) A Whole Genome Assembly of Rye (Secale cereale) M. Timothy Rabanus-Wallace Leibniz Institute of Plant Genetics and Crop Plant Research (IPK) Why rye? QTL analysis for Survival After Winter (SAW) scores

More information

CDC Vivid durum wheat

CDC Vivid durum wheat CULTIVAR DESCRIPTION CDC Vivid durum wheat C. J. Pozniak Crop Development Centre and Department of Plant Sciences, University of Saskatchewan, 51 Campus Drive, Saskatoon, Saskatchewan, Canada S7N 5A8 (e-mail:

More information

Could modern methods of genetics improve the disease resistance in farm animals?

Could modern methods of genetics improve the disease resistance in farm animals? Could modern methods of genetics improve the disease resistance in farm animals? (introductory lecture) A. Kuznetsov Content Innate immune response Adaptive immune response Breeding programs Transgenesis

More information

Bioinformatic Analysis of SNP Data for Genetic Association Studies EPI573

Bioinformatic Analysis of SNP Data for Genetic Association Studies EPI573 Bioinformatic Analysis of SNP Data for Genetic Association Studies EPI573 Mark J. Rieder Department of Genome Sciences mrieder@u.washington washington.edu Epidemiology Studies Cohort Outcome Model to fit/explain

More information

SCSC, GENE, MEPS and BIOT 654: Analysis of Complex Genomes (Lec) Spring 2018

SCSC, GENE, MEPS and BIOT 654: Analysis of Complex Genomes (Lec) Spring 2018 SCSC, GENE, MEPS and BIOT 654: Analysis of Complex Genomes (Lec) 1. Instructor: Spring 2018 Name: Professor Dr. Hongbin Zhang E-mail: hbz7049@tamu.edu Office: 427A Heep Center Office Phone: 862-2244 Office

More information

Construction of high-density linkage maps for mapping quantitative trait loci for multiple traits in field pea (Pisum sativum L.)

Construction of high-density linkage maps for mapping quantitative trait loci for multiple traits in field pea (Pisum sativum L.) Gali et al. BMC Plant Biology (2018) 18:172 https://doi.org/10.1186/s12870-018-1368-4 RESEARCH ARTICLE Open Access Construction of high-density linkage maps for mapping quantitative trait loci for multiple

More information

Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls

Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls BMI/CS 776 www.biostat.wisc.edu/bmi776/ Mark Craven craven@biostat.wisc.edu Spring 2011 1. Understanding Human Genetic Variation!

More information

Utilization of Genomic Information to Accelerate Soybean Breeding and Product Development through Marker Assisted Selection

Utilization of Genomic Information to Accelerate Soybean Breeding and Product Development through Marker Assisted Selection Utilization of Genomic Information to Accelerate Soybean Breeding and Product Development through Marker Assisted Selection Presented by: Ruth Wagner August 5, 2014 SOY2014 Rico Caldo,Vergel Concibido,

More information

MAS using a dense SNP markers map: Application to the Normande and Montbéliarde breeds

MAS using a dense SNP markers map: Application to the Normande and Montbéliarde breeds MAS using a dense SNP markers map: Application to the Normande and Montbéliarde breeds Guillaume F., Fritz S., Ducrocq V., Croiseau P. and Boichard D. Introduction France has run a MAS program since 2001

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information

SEQUENCING. M Ataei, PhD. Feb 2016

SEQUENCING. M Ataei, PhD. Feb 2016 CLINICAL NEXT GENERATION SEQUENCING M Ataei, PhD Tehran Medical Genetics Laboratory Feb 2016 Overview 2 Background NGS in non-invasive prenatal diagnosis (NIPD) 3 Background Background 4 In the 1970s,

More information

GDMS Templates Documentation GDMS Templates Release 1.0

GDMS Templates Documentation GDMS Templates Release 1.0 GDMS Templates Documentation GDMS Templates Release 1.0 1 Table of Contents 1. SSR Genotyping Template 03 2. DArT Genotyping Template... 05 3. SNP Genotyping Template.. 08 4. QTL Template.. 09 5. Map Template..

More information

MARS and MABB for Drought and Heat Tolerance with Rust Resistance in Wheat

MARS and MABB for Drought and Heat Tolerance with Rust Resistance in Wheat Genomics for Crop Improvement, Bengaluru Feb 18-20, 2013 MARS and MABB for Drought and Heat Tolerance with Rust Resistance in Wheat GP Singh, Neelu Jain, Vinod, JB Sharma, T Ramya and KV Prabhu Division

More information

Texas A&M University Departmental Request for a Change in Course Undergraduate Graduate Professional Submit original fonn and attachments.

Texas A&M University Departmental Request for a Change in Course Undergraduate Graduate Professional Submit original fonn and attachments. , I 1. Request submitted by (Department or Program Name): 2. Course prefix, number and complete title of course: 3. Change requested Texas A&M University Departmental Request for a Change in Course Undergraduate

More information

Agrigenomics Genotyping Solutions. Easy, flexible, automated solutions to accelerate your genomic selection and breeding programs

Agrigenomics Genotyping Solutions. Easy, flexible, automated solutions to accelerate your genomic selection and breeding programs Agrigenomics Genotyping Solutions Easy, flexible, automated solutions to accelerate your genomic selection and breeding programs Agrigenomics genotyping solutions A single platform for every phase of your

More information

Chapter 5. Structural Genomics

Chapter 5. Structural Genomics Chapter 5. Structural Genomics Contents 5. Structural Genomics 5.1. DNA Sequencing Strategies 5.1.1. Map-based Strategies 5.1.2. Whole Genome Shotgun Sequencing 5.2. Genome Annotation 5.2.1. Using Bioinformatic

More information

Toward a better understanding of plant genomes structure : Combining NGS, optical mapping technology and CRISPR-CATCH approach

Toward a better understanding of plant genomes structure : Combining NGS, optical mapping technology and CRISPR-CATCH approach Toward a better understanding of plant genomes structure : Combining NGS, optical mapping technology and CRISPR-CATCH approach Hélène BERGES Director of the Plant Genomic Center Global warming effects,

More information

Genomic resources. for non-model systems

Genomic resources. for non-model systems Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing

More information

SNP calling and Genome Wide Association Study (GWAS) Trushar Shah

SNP calling and Genome Wide Association Study (GWAS) Trushar Shah SNP calling and Genome Wide Association Study (GWAS) Trushar Shah Types of Genetic Variation Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide Variations (SNVs) Short

More information

DNBseq TM SERVICE OVERVIEW Plant and Animal Whole Genome Re-Sequencing

DNBseq TM SERVICE OVERVIEW Plant and Animal Whole Genome Re-Sequencing TM SERVICE OVERVIEW Plant and Animal Whole Genome Re-Sequencing Plant and animal whole genome re-sequencing (WGRS) involves sequencing the entire genome of a plant or animal and comparing the sequence

More information

Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls

Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls BMI/CS 776 www.biostat.wisc.edu/bmi776/ Colin Dewey cdewey@biostat.wisc.edu Spring 2012 1. Understanding Human Genetic Variation

More information

Agricultural Outlook Forum Presented: February 17, 2006 STRATEGIES IN THE APPLICATION OF BIOTECH TO DROUGHT TOLERANCE

Agricultural Outlook Forum Presented: February 17, 2006 STRATEGIES IN THE APPLICATION OF BIOTECH TO DROUGHT TOLERANCE Agricultural Outlook Forum Presented: February 17, 2006 STRATEGIES IN THE APPLICATION OF BIOTECH TO DROUGHT TOLERANCE Marc Albertsen Research Director Pioneer Hi-Bred International Incorporated Strategies

More information

Association genetics in barley

Association genetics in barley Association genetics in barley Ildikó Karsai, Hungarian Academy of Sciences, Martonvásár, Hungary Frank Ordon, Dragan Perovic, Julius Kühn Institute, Quedlinburg, Germany Günther Schweizer, Bianca Büttner,

More information

3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome

3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome Lectures 30 and 31 Genome analysis I. Genome analysis A. two general areas 1. structural 2. functional B. genome projects a status report 1. 1 st sequenced: several viral genomes 2. mitochondria and chloroplasts

More information

Discovery and development of exome-based, co-dominant single nucleotide polymorphism markers in hexaploid wheat (Triticum aestivum L.

Discovery and development of exome-based, co-dominant single nucleotide polymorphism markers in hexaploid wheat (Triticum aestivum L. Application note GAPP-0001 Discovery and development of exome-based, co-dominant single nucleotide polymorphism markers in hexaploid wheat (Triticum aestivum L.) Keith J. Edwards, University of Bristol,

More information