Péter Antal Ádám Arany Bence Bolgár András Gézsi Gergely Hajós Gábor Hullám Péter Marx András Millinghoffer László Poppe Péter Sárközy BIOINFORMATICS

Size: px
Start display at page:

Download "Péter Antal Ádám Arany Bence Bolgár András Gézsi Gergely Hajós Gábor Hullám Péter Marx András Millinghoffer László Poppe Péter Sárközy BIOINFORMATICS"

Transcription

1 Péter Antal Ádám Arany Bence Bolgár András Gézsi Gergely Hajós Gábor Hullám Péter Marx András Millinghoffer László Poppe Péter Sárközy BIOINFORMATICS The Bioinformatics book covers new topics in the rapidly expanding field of bioinformatics, from next-generation sequencing to drug discovery and metagenomics. The first two chapters overviews genetic measurement methods. The next four chapters discuss topics related to the effect of genetic variants from protein modeling to gene regulatory networks. Standard statistical analysis in association studies are discussed in the next two chapters. The systems biology approach is illustrated by discussing a systems-based biomarker analysis method, the graph-based network science, the dynamical systems based approaches and a Bayesian causal inference method in subsequent chapters. The next chapter discusses text-mining methods in biomedicine, especially their application in interpretation and translation. The decision theoretic approach to study design, especially multi-stage, sequential study design is discussed in the next chapter, introducing the concepts of value of information and the expected value of an experiment. Next, the heterogeneity of biomedical big data sources is overviewed, together with data and knowledge fusion methods, and with the discussion of semantic publishing, which can lead to a new unification of biomedicine. Subsequently, bioinformatic workflow methods are summarized. At last, drug discovery methods are overviewed with an outlook for personalized medicine and the final chapter presents the main steps and workflows in metagenomics. Keywords: genotyping, next-generation sequencing methods, protein modeling, gene regulatory networks, omic networks, study design, data and knowledge fusion, worklfow systems, association study, biomarker analysis, medical decision support systems, semantic publishing, similarity based drug discovery, metagenomics. Budapest University of Technology & Economics and Semmelweis University Typotex Kiadó 2014

2 COPYRIGHT: , Péter Antal, Ádám Arany, Bence Bolgár, András Gézsi, Gergely Hajós, Gábor Hullám, Péter Marx, András Millinghoffer, László Poppe, Péter Sárközy, Budapest University of Technology and Economics, Semmelweis University Creative Commons NonCommercial-NoDerivs 3.0 (CC BY-NC-ND 3.0) Terms of use of : This work can be reproduced, circulated, published and performed for non-commercial purposes without restriction by indicating the author s name, but it cannot be modified. Scientific lectors: Viktor Molnár, András Antos ISBN Prepared under the editorship of Typotex Kiadó Responsible manager: Zsuzsa Votisky Prepared within the framework of the project Konzorcium a biotechnológia aktív tanulásáért ( Consortium for the Active Studying of Biotechnology ) Grant No. TÁMOP /A/1-11/

3 Contents 1 DNA recombinant measurement technology, noise and error models Historic overview Clinical aspects of genome sequencing Partial Genetic Association Studies Genome Wide Association Studies First generation automated Sanger sequencing Next generation sequencing technologies Pyrosequencing and ph based sequencing Reversible terminator based sequencing Nanopore based sequencing Error characteristics of Next Generation Sequencing Carry forward/incomplete extension Homopolymer errors Capture technologies PCR capture Emulsion PCR Bridge amplification Targeted resequencing De-novo sequencing Next generation sequencing workflows Filtering Mapping Assembly Variant calling Paired end sequencing Multiplexing samples The post-processing, haplotype reconstruction, and imputation Genome Genotype Single nucleotide polymorphisms Types of point mutation Haplotypes and recombination

4 Contents Linkage Disequilibrium Haplotype reconstruction Imputation Genotyping platforms Sample preparation Regions of interest Primer Design PCR Probe-tag based genotyping Sanger sequencing Real-time qualitative polymerase chain reaction SNP arrays Genotyping vs. gene expression Call rate and accuracy Comparative protein modeling and molecular docking Introduction The protein structure gap Methods of protein modeling Comparative protein modeling Steps of homology modeling Tools for homology modeling Molecular docking Protein-ligand interaction predictions Protein-biomacromolecule interaction predictions Methods of determining structure of proteins and protein structure databases Introduction Protein identification tools Simple protein analyses Levels and problems of protein structure predictions Experimental methods to determine the secondary structure of proteins Protein circular dichroism (CD) Synchrotron radiation circular dichroism (SRCD) Experimental methods to determining atomic structures of proteins Protein X-ray crystallography Protein NMR spectroscopy Protein electron microscopy, electron diffraction and electron crystallography Protein neutron crystallography

5 Contents 5 5 Quantitative models of the functional effects of genetic variants Introduction Variants SNP, indel Alternative splicing Levels of regulation Different regulatory elements microrna mirna development mirna regulatory methods Transcription factors Epigenetics Methylation Histone modifications Mathematical models of gene regulatory networks Introduction Learning networks Representation Types of network learning algorithms TF, mirna, mrna regulatory networks Standard analysis of genetic association studies Introduction Genetic data transformation Filtering Standard test for Hardy Weinberg equilibrium Phenotype data transformation Transformation Discretization Univariate analysis methods Standard association tests Cochran Armitage test for trend Odds ratios Univariate Bayesian methods Multivariate analysis methods Logistic regression Haplotype association Analysis of statistical power Analyzing gene expression studies Introduction Pre-procession

6 Contents Background correction Normalization Summarization Filtering Data analysis Clustering Differential expression Biological interpretation of results Biomarker analysis 115 Notation Introduction Background Bayesian multilevel analysis of relevance Multivariate scalability: k-mbs and k-mbg features A knowledge-rich aggregation of input features Interaction, redundancy based on posterior decomposition Relevance for multiple targets Conditional and contextual relevance Posteriors for the predictive power of input features Algorithmic aspects and applications Summary Network biology Introduction Biological networks Basics of graph theory Network analysis Network topology Network models and dynamics Assortativity, degree distribution and scale-free networks Tasks and challenges An application to drug discovery Dynamic modeling in cell biology Biochemical concepts and their computational representations Modeling with ordinary differential equations Stochastic modeling Hybrid methods Reaction diffusion systems Model fitting Whole-cell simulation Overview

7 Contents 7 12 Causal inference in biomedicine 152 Notation Introduction Representing independence and causal relations by Bayesian networks Constraint based inference of causal relations and models Learning complete causal domain models Bayesian inference of causal features Edges: direct pairwise dependencies Pairwise causal relations MBG subnetworks Ordering of the variables Effect modifiers Text mining methods in bioinformatics Introduction Biomedical text mining Constructing the corpus Constructing the vocabulary Text mining tasks Basic techniques Pattern matching Document representation Methods for named entity recognition Methods for relation extraction Lexicalized probabilistic context-free grammars Difficulties in biomedical text mining Text mining and knowledge management Experimental design: from the basics to active learning extensions Introduction The elements of experimental design Phases of biomedical DOE Types of biological experiments A decision theoretic approach to DoE Expected value of an experiment Adaptive designs and budgeted learning A Bayesian treatment of sequential decision processes Approaches to target variable selection Gene Prioritization Active learning Other practical tasks relying on bioinformatics

8 Contents 8 15 Big data in biomedicine Introduction The first wave of biomedical big data Post-genomic big data: the second wave The common big data The health-related common big data in biomedicine Bioinformatic challenges of common big data Analysis of heterogeneous biomedical data through information fusion Introduction Information fusion and data fusion Types of data fusion Early fusion Intermediate fusion Late fusion Similarity-based data fusion The Bayesian Encyclopedia Introduction The three worlds of data, knowledge and computation From fragmentation problems to workflow for unification Data repositories with semantic technologies Semantic publishing for the literature world Causal Bayesian network-based data analytic knowledge bases Examples for links between worlds Prospects for the Bayesian Encyclopedia Bioinformatical workflow systems case study Overview of tasks Data model and representation Use cases and architecture Implementation details of the server Postprocessing steps Computational aspects of pharmaceutical research Overview of the process Chemoinformatical background Screening criteria Method Fragment-based design Drug repositioning

9 Contents 9 20 Metagenomics Introduction Metagenome analysis Community profiling Functional metagenomics Metagenomics step by step Sampling Sequencing Assembly Binning Gene calling and functional inference

Bioinformatics. Created by XMLmind XSL-FO Converter.

Bioinformatics. Created by XMLmind XSL-FO Converter. Antal, Péter Hullám, Gábor Millinghoffer, András Hajós, Gergely Marx, Péter Arany, Ádám Bolgár, Bence Gézsi, András Sárközy, Péter Poppe, László írta Antal, Péter, Hullám, Gábor, Millinghoffer, András,

More information

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology. G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic

More information

Capabilities & Services

Capabilities & Services Capabilities & Services Accelerating Research & Development Table of Contents Introduction to DHMRI 3 Services and Capabilites: Genomics 4 Proteomics & Protein Characterization 5 Metabolomics 6 In Vitro

More information

Data Mining and Applications in Genomics

Data Mining and Applications in Genomics Data Mining and Applications in Genomics Lecture Notes in Electrical Engineering Volume 25 For other titles published in this series, go to www.springer.com/series/7818 Sio-Iong Ao Data Mining and Applications

More information

Biology 644: Bioinformatics

Biology 644: Bioinformatics Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....

More information

Computational methods in bioinformatics: Lecture 1

Computational methods in bioinformatics: Lecture 1 Computational methods in bioinformatics: Lecture 1 Graham J.L. Kemp 2 November 2015 What is biology? Ecosystem Rain forest, desert, fresh water lake, digestive tract of an animal Community All species

More information

Transcriptomics analysis with RNA seq: an overview Frederik Coppens

Transcriptomics analysis with RNA seq: an overview Frederik Coppens Transcriptomics analysis with RNA seq: an overview Frederik Coppens Platforms Applications Analysis Quantification RNA content Platforms Platforms Short (few hundred bases) Long reads (multiple kilobases)

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information

Pioneering Clinical Omics

Pioneering Clinical Omics Pioneering Clinical Omics Clinical Genomics Strand NGS An analysis tool for data generated by cutting-edge Next Generation Sequencing(NGS) instruments. Strand NGS enables read alignment and analysis of

More information

Introduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013

Introduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance

More information

Pharmacogenetics: A SNPshot of the Future. Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001

Pharmacogenetics: A SNPshot of the Future. Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001 Pharmacogenetics: A SNPshot of the Future Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001 1 I. What is pharmacogenetics? It is the study of how genetic variation affects drug response

More information

Welcome to the NGS webinar series

Welcome to the NGS webinar series Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic

More information

Microbial Metabolism Systems Microbiology

Microbial Metabolism Systems Microbiology 1 Microbial Metabolism Systems Microbiology Ching-Tsan Huang ( 黃慶璨 ) Office: Agronomy Hall, Room 111 Tel: (02) 33664454 E-mail: cthuang@ntu.edu.tw MIT OCW Systems Microbiology aims to integrate basic biological

More information

CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016

CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 Topics Genetic variation Population structure Linkage disequilibrium Natural disease variants Genome Wide Association Studies Gene

More information

Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie. Sander van Boheemen Medical Microbiology

Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie. Sander van Boheemen Medical Microbiology Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie Sander van Boheemen Medical Microbiology Next-generation sequencing Next-generation sequencing (NGS), also known as

More information

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS

More information

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio

More information

Understanding the science and technology of whole genome sequencing

Understanding the science and technology of whole genome sequencing Understanding the science and technology of whole genome sequencing Dag Undlien Department of Medical Genetics Oslo University Hospital University of Oslo and The Norwegian Sequencing Centre d.e.undlien@medisin.uio.no

More information

Genetics and Bioinformatics

Genetics and Bioinformatics Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s

More information

resequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics

resequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics RNA Sequencing T TM variation genetics validation SNP ncrna metagenomics private trio de novo exome mendelian ChIP-seq RNA DNA bioinformatics custom target high-throughput resequencing storage ncrna comparative

More information

TECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298

TECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298 DIAGNOSTICS BUSINESS ANALYSIS SERIES: TECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298 By ADAMS BUSINESS ASSOCIATES March 2017. March 2017 ABA 298 1 Technologies, Products & Services

More information

Types of Databases - By Scope

Types of Databases - By Scope Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of

More information

Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze

Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering,

More information

Contact us for more information and a quotation

Contact us for more information and a quotation GenePool Information Sheet #1 Installed Sequencing Technologies in the GenePool The GenePool offers sequencing service on three platforms: Sanger (dideoxy) sequencing on ABI 3730 instruments Illumina SOLEXA

More information

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio

More information

Motivation From Protein to Gene

Motivation From Protein to Gene MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein

More information

RNA-SEQUENCING ANALYSIS

RNA-SEQUENCING ANALYSIS RNA-SEQUENCING ANALYSIS Joseph Powell SISG- 2018 CONTENTS Introduction to RNA sequencing Data structure Analyses Transcript counting Alternative splicing Allele specific expression Discovery APPLICATIONS

More information

SolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze

SolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze SolCAP Solanaceae Coordinated Agricultural Project Supported by the National Research Initiative Plant Genome Program of USDA CSREES for the Improvement of Potato and Tomato Executive Commitee : David

More information

ALGORITHMS IN BIO INFORMATICS. Chapman & Hall/CRC Mathematical and Computational Biology Series A PRACTICAL INTRODUCTION. CRC Press WING-KIN SUNG

ALGORITHMS IN BIO INFORMATICS. Chapman & Hall/CRC Mathematical and Computational Biology Series A PRACTICAL INTRODUCTION. CRC Press WING-KIN SUNG Chapman & Hall/CRC Mathematical and Computational Biology Series ALGORITHMS IN BIO INFORMATICS A PRACTICAL INTRODUCTION WING-KIN SUNG CRC Press Taylor & Francis Group Boca Raton London New York CRC Press

More information

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio

More information

Era with Computational Biology/Toxicology

Era with Computational Biology/Toxicology USM Seminar 1/22/2010 Embracing the Post-Omics Era with Computational Biology/Toxicology Ping Gong Environmental Genomics and Genetics (EGG) Team @ Environmental Laboratory Outline Introduction Bioinformatics

More information

Prostate Cancer Genetics: Today and tomorrow

Prostate Cancer Genetics: Today and tomorrow Prostate Cancer Genetics: Today and tomorrow Henrik Grönberg Professor Cancer Epidemiology, Deputy Chair Department of Medical Epidemiology and Biostatistics ( MEB) Karolinska Institutet, Stockholm IMPACT-Atanta

More information

Outline General NGS background and terms 11/14/2016 CONFLICT OF INTEREST. HLA region targeted enrichment. NGS library preparation methodologies

Outline General NGS background and terms 11/14/2016 CONFLICT OF INTEREST. HLA region targeted enrichment. NGS library preparation methodologies Eric T. Weimer, PhD, D(ABMLI) Assistant Professor, Pathology & Laboratory Medicine, UNC School of Medicine Director, Molecular Immunology Associate Director, Clinical Flow Cytometry, HLA, and Immunology

More information

The application of hidden markov model in building genetic regulatory network

The application of hidden markov model in building genetic regulatory network J. Biomedical Science and Engineering, 2010, 3, 633-637 doi:10.4236/bise.2010.36086 Published Online June 2010 (http://www.scirp.org/ournal/bise/). The application of hidden markov model in building genetic

More information

The Expanded Illumina Sequencing Portfolio New Sample Prep Solutions and Workflow

The Expanded Illumina Sequencing Portfolio New Sample Prep Solutions and Workflow The Expanded Illumina Sequencing Portfolio New Sample Prep Solutions and Workflow Marcus Hausch, Ph.D. 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life, Oligator,

More information

Lecture #1. Introduction to microarray technology

Lecture #1. Introduction to microarray technology Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing

More information

Informatic Issues in Genomics

Informatic Issues in Genomics Informatic Issues in Genomics DEISE PRACE Symposium Barcelona, 10 12 May 2010 Ivo Glynne Gut, PhD Centro Nacional de Analisis Genomico Barcelona Our Objectives Improve the quality of life Understand the

More information

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis 1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

Chapter 6 - Molecular Genetic Techniques

Chapter 6 - Molecular Genetic Techniques Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting

More information

Single Nucleotide Polymorphisms: Methods And Protocols (Methods In Molecular Biology)

Single Nucleotide Polymorphisms: Methods And Protocols (Methods In Molecular Biology) Single Nucleotide Polymorphisms: Methods And Protocols (Methods In Molecular Biology) If you are looking for a ebook Single Nucleotide Polymorphisms: Methods and Protocols (Methods in Molecular Biology)

More information

Frumkin, 2e Part 1: Methods and Paradigms. Chapter 6: Genetics and Environmental Health

Frumkin, 2e Part 1: Methods and Paradigms. Chapter 6: Genetics and Environmental Health Frumkin, 2e Part 1: Methods and Paradigms Chapter 6: Genetics and Environmental Health Genetics Genetics, the study of individual genes, has expanded to include genomics, which is the study of all the

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Vocabulary Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 Gene: Genetics: Genome: Genomics: hereditary

More information

VALLIAMMAI ENGINEERING COLLEGE

VALLIAMMAI ENGINEERING COLLEGE VALLIAMMAI ENGINEERING COLLEGE SRM Nagar, Kattankulathur 603 203 DEPARTMENT OF COMPUTER SCIENCE AND ENGINEERING QUESTION BANK VII SEMESTER BM6005 BIO INFORMATICS Regulation 2013 Academic Year 2018-19 Prepared

More information

From Bench to Bedside: Role of Informatics. Nagasuma Chandra Indian Institute of Science Bangalore

From Bench to Bedside: Role of Informatics. Nagasuma Chandra Indian Institute of Science Bangalore From Bench to Bedside: Role of Informatics Nagasuma Chandra Indian Institute of Science Bangalore Electrocardiogram Apparent disconnect among DATA pieces STUDYING THE SAME SYSTEM Echocardiogram Chest sounds

More information

2/23/16. Protein-Protein Interactions. Protein Interactions. Protein-Protein Interactions: The Interactome

2/23/16. Protein-Protein Interactions. Protein Interactions. Protein-Protein Interactions: The Interactome Protein-Protein Interactions Protein Interactions A Protein may interact with: Other proteins Nucleic Acids Small molecules Protein-Protein Interactions: The Interactome Experimental methods: Mass Spec,

More information

Smart India Hackathon

Smart India Hackathon TM Persistent and Hackathons Smart India Hackathon 2017 i4c www.i4c.co.in Digital Transformation 25% of India between age of 16-25 Our country needs audacious digital transformation to reach its potential

More information

BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM)

BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM) BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM) PROGRAM TITLE DEGREE TITLE Master of Science Program in Bioinformatics and System Biology (International Program) Master of Science (Bioinformatics

More information

Cover Page. The handle holds various files of this Leiden University dissertation.

Cover Page. The handle   holds various files of this Leiden University dissertation. Cover Page The handle http://hdl.handle.net/1887/22550 holds various files of this Leiden University dissertation. Author: Yan, Kuan Title: Image analysis and platform development for automated phenotyping

More information

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005 Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of

More information

Chapter 17 Lecture. Concepts of Genetics. Tenth Edition. Regulation of Gene Expression in Eukaryotes

Chapter 17 Lecture. Concepts of Genetics. Tenth Edition. Regulation of Gene Expression in Eukaryotes Chapter 17 Lecture Concepts of Genetics Tenth Edition Regulation of Gene Expression in Eukaryotes Chapter Contents 17.1 Eukaryotic Gene Regulation Can Occur at Any of the Steps Leading from DNA to Protein

More information

SNPs - GWAS - eqtls. Sebastian Schmeier

SNPs - GWAS - eqtls. Sebastian Schmeier SNPs - GWAS - eqtls s.schmeier@gmail.com http://sschmeier.github.io/bioinf-workshop/ 17.08.2015 Overview Single nucleotide polymorphism (refresh) SNPs effect on genes (refresh) Genome-wide association

More information

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8 Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically

More information

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis 1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

Introduction to Bioinformatics and Gene Expression Technology

Introduction to Bioinformatics and Gene Expression Technology Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA

More information

MATH 5610, Computational Biology

MATH 5610, Computational Biology MATH 5610, Computational Biology Lecture 1 Intro to Molecular Biology Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/14 Announcements Homework 1 due next Tuesday

More information

Agilent GeneSpring GX 10: Beyond. Pam Tangvoranuntakul Product Manager, GeneSpring October 1, 2008

Agilent GeneSpring GX 10: Beyond. Pam Tangvoranuntakul Product Manager, GeneSpring October 1, 2008 Agilent GeneSpring GX 10: Gene Expression and Beyond Pam Tangvoranuntakul Product Manager, GeneSpring October 1, 2008 GeneSpring GX 10 in the News Our Goals for GeneSpring GX 10 Goal 1: Bring back GeneSpring

More information

Applicazioni biotecnologiche

Applicazioni biotecnologiche Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence

More information

Bioinformatics. Dick de Ridder. Tuinbouw Digitaal, 12/11/15

Bioinformatics. Dick de Ridder. Tuinbouw Digitaal, 12/11/15 Bioinformatics Dick de Ridder Tuinbouw Digitaal, 12/11/15 Bioinformatics is not Bioinformatics is also not Bioinformatics Bioinformatics (2) Bioinformatics (3) US National Institutes of Health (NIH): Bioinformatics:

More information

Axiom Biobank Genotyping Solution

Axiom Biobank Genotyping Solution TCCGGCAACTGTA AGTTACATCCAG G T ATCGGCATACCA C AGTTAATACCAG A Axiom Biobank Genotyping Solution The power of discovery is in the design GWAS has evolved why and how? More than 2,000 genetic loci have been

More information

ROAD TO STATISTICAL BIOINFORMATICS CHALLENGE 1: MULTIPLE-COMPARISONS ISSUE

ROAD TO STATISTICAL BIOINFORMATICS CHALLENGE 1: MULTIPLE-COMPARISONS ISSUE CHAPTER1 ROAD TO STATISTICAL BIOINFORMATICS Jae K. Lee Department of Public Health Science, University of Virginia, Charlottesville, Virginia, USA There has been a great explosion of biological data and

More information

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS. !! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,

More information

Introduction to human genomics and genome informatics

Introduction to human genomics and genome informatics Introduction to human genomics and genome informatics Session 1 Prince of Wales Clinical School Dr Jason Wong ARC Future Fellow Head, Bioinformatics & Integrative Genomics Adult Cancer Program, Lowy Cancer

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map

More information

THE HEALTH AND RETIREMENT STUDY: GENETIC DATA UPDATE

THE HEALTH AND RETIREMENT STUDY: GENETIC DATA UPDATE : GENETIC DATA UPDATE April 30, 2014 Biomarker Network Meeting PAA Jessica Faul, Ph.D., M.P.H. Health and Retirement Study Survey Research Center Institute for Social Research University of Michigan HRS

More information

The University of California, Santa Cruz (UCSC) Genome Browser

The University of California, Santa Cruz (UCSC) Genome Browser The University of California, Santa Cruz (UCSC) Genome Browser There are hundreds of available userselected tracks in categories such as mapping and sequencing, phenotype and disease associations, genes,

More information

Chapter 1. from genomics to proteomics Ⅱ

Chapter 1. from genomics to proteomics Ⅱ Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more

More information

02 Agenda Item 03 Agenda Item

02 Agenda Item 03 Agenda Item 01 Agenda Item 02 Agenda Item 03 Agenda Item SOLiD 3 System: Applications Overview April 12th, 2010 Jennifer Stover Field Application Specialist - SOLiD Applications Workflow for SOLiD Application Application

More information

Syllabus for BIOS 101, SPRING 2013

Syllabus for BIOS 101, SPRING 2013 Page 1 Syllabus for BIOS 101, SPRING 2013 Name: BIOSTATISTICS 101 for Cancer Researchers Time: March 20 -- May 29 4-5pm in Wednesdays, [except 4/15 (Mon) and 5/7 (Tue)] Location: SRB Auditorium Background

More information

Sequence Variations. Baxevanis and Ouellette, Chapter 7 - Sequence Polymorphisms. NCBI SNP Primer:

Sequence Variations. Baxevanis and Ouellette, Chapter 7 - Sequence Polymorphisms. NCBI SNP Primer: Sequence Variations Baxevanis and Ouellette, Chapter 7 - Sequence Polymorphisms NCBI SNP Primer: http://www.ncbi.nlm.nih.gov/about/primer/snps.html Overview Mutation and Alleles Linkage Genetic variation

More information

Unit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)

Unit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total) Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 16 The Molecular Basis of Inheritance Unit 6: Molecular Genetics

More information

Genome-Wide Association Studies (GWAS): Computational Them

Genome-Wide Association Studies (GWAS): Computational Them Genome-Wide Association Studies (GWAS): Computational Themes and Caveats October 14, 2014 Many issues in Genomewide Association Studies We show that even for the simplest analysis, there is little consensus

More information

Chapter 10 Genetic Engineering: A Revolution in Molecular Biology

Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical

More information

Quality assurance in NGS (diagnostics)

Quality assurance in NGS (diagnostics) Quality assurance in NGS (diagnostics) Chris Mattocks National Genetics Reference Laboratory (Wessex) Research Diagnostics Quality assurance Any systematic process of checking to see whether a product

More information

Bioinformatics Advice on Experimental Design

Bioinformatics Advice on Experimental Design Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics

More information

Chapter 7. DNA Microarrays

Chapter 7. DNA Microarrays Bioinformatics III Structural Bioinformatics and Genome Analysis Chapter 7. DNA Microarrays 7.9 Next Generation Sequencing 454 Sequencing Solexa Illumina Solid TM System Sequencing Process of determining

More information

Human Genetic Variation. Ricardo Lebrón Dpto. Genética UGR

Human Genetic Variation. Ricardo Lebrón Dpto. Genética UGR Human Genetic Variation Ricardo Lebrón rlebron@ugr.es Dpto. Genética UGR What is Genetic Variation? Origins of Genetic Variation Genetic Variation is the difference in DNA sequences between individuals.

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru

More information

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s

More information

Single-cell RNA-sequencing

Single-cell RNA-sequencing Single-cell RNA-sequencing Stefania Giacomello UC Davis, 22 June 2018 Applications - Heterogeneity analysis - Cell-type identification - Cellular states in differentiation and developmental processes -

More information

BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology. Lecture 2: Microarray analysis

BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology. Lecture 2: Microarray analysis BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology Lecture 2: Microarray analysis Genome wide measurement of gene transcription using DNA microarray Bruce Alberts, et al., Molecular Biology

More information

Aaron Liston, Oregon State University Botany 2012 Intro to Next Generation Sequencing Workshop

Aaron Liston, Oregon State University Botany 2012 Intro to Next Generation Sequencing Workshop Output (bp) Aaron Liston, Oregon State University Growth in Next-Gen Sequencing Capacity 3.5E+11 2002 2004 2006 2008 2010 3.0E+11 2.5E+11 2.0E+11 1.5E+11 1.0E+11 Adapted from Mardis, 2011, Nature 5.0E+10

More information

Structure, Measurement & Analysis of Genetic Variation

Structure, Measurement & Analysis of Genetic Variation Structure, Measurement & Analysis of Genetic Variation Sven Cichon, PhD Professor of Medical Genetics, Director, Division of Medcial Genetics, University of Basel Institute of Neuroscience and Medicine

More information

Genomic resources. for non-model systems

Genomic resources. for non-model systems Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing

More information

Get to Know Your DNA. Every Single Fragment.

Get to Know Your DNA. Every Single Fragment. HaloPlex HS NGS Target Enrichment System Get to Know Your DNA. Every Single Fragment. High sensitivity detection of rare variants using molecular barcodes How Does Molecular Barcoding Work? HaloPlex HS

More information

From Genotype to Phenotype

From Genotype to Phenotype From Genotype to Phenotype Johanna Vilkki Green technology, Natural Resources Institute Finland Systems biology Genome Transcriptome genes mrna Genotyping methodology SNP TOOLS, WG SEQUENCING Functional

More information

BIMM 143: Introduction to Bioinformatics (Winter 2018)

BIMM 143: Introduction to Bioinformatics (Winter 2018) BIMM 143: Introduction to Bioinformatics (Winter 2018) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bimm143_w18/ DRAFT: 2017-12-02 (20:48:10 PST

More information

CS262 Lecture 12 Notes Single Cell Sequencing Jan. 11, 2016

CS262 Lecture 12 Notes Single Cell Sequencing Jan. 11, 2016 CS262 Lecture 12 Notes Single Cell Sequencing Jan. 11, 2016 Background A typical human cell consists of ~6 billion base pairs of DNA and ~600 million bases of mrna. It is time-consuming and expensive to

More information

Perspectives on the Priorities for Bioinformatics Education in the 21 st Century

Perspectives on the Priorities for Bioinformatics Education in the 21 st Century Perspectives on the Priorities for Bioinformatics Education in the 21 st Century Oyekanmi Nash, PhD Associate Professor & Director Genetics, Genomics & Bioinformatics National Biotechnology Development

More information

Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017

Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Agenda What is Functional Genomics? RNA Transcription/Gene Expression Measuring Gene

More information

Matthew Tinning Australian Genome Research Facility. July 2012

Matthew Tinning Australian Genome Research Facility. July 2012 Next-Generation Sequencing: an overview of technologies and applications Matthew Tinning Australian Genome Research Facility July 2012 History of Sequencing Where have we been? 1869 Discovery of DNA 1909

More information

Introduction to some aspects of molecular genetics

Introduction to some aspects of molecular genetics Introduction to some aspects of molecular genetics Julius van der Werf (partly based on notes from Margaret Katz) University of New England, Armidale, Australia Genetic and Physical maps of the genome...

More information

The Biotechnology Toolbox

The Biotechnology Toolbox Chapter 15 The Biotechnology Toolbox Cutting and Pasting DNA Cutting DNA Restriction endonuclease or restriction enzymes Cellular protection mechanism for infected foreign DNA Recognition and cutting specific

More information

Microarray Gene Expression Analysis at CNIO

Microarray Gene Expression Analysis at CNIO Microarray Gene Expression Analysis at CNIO Orlando Domínguez Genomics Unit Biotechnology Program, CNIO 8 May 2013 Workflow, from samples to Gene Expression data Experimental design user/gu/ubio Samples

More information

From Proteomics to Systems Biology. Integration of omics - information

From Proteomics to Systems Biology. Integration of omics - information From Proteomics to Systems Biology Integration of omics - information Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - data What

More information

Chapter 15 Gene Technologies and Human Applications

Chapter 15 Gene Technologies and Human Applications Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect

More information

Data representation for clinical data and metadata

Data representation for clinical data and metadata Data representation for clinical data and metadata WP1: Data representation for clinical data and metadata Inconsistent terminology creates barriers to identifying common clinical entities in disparate

More information

Genomic region (ENCODE) Gene definitions

Genomic region (ENCODE) Gene definitions DNA From genes to proteins Bioinformatics Methods RNA PROMOTER ELEMENTS TRANSCRIPTION Iosif Vaisman mrna SPLICE SITES SPLICING Email: ivaisman@gmu.edu START CODON STOP CODON TRANSLATION PROTEIN From genes

More information

Redefine what s possible with the Axiom Genotyping Solution

Redefine what s possible with the Axiom Genotyping Solution Redefine what s possible with the Axiom Genotyping Solution From discovery to translation on a single platform The Axiom Genotyping Solution enables enhanced genotyping studies to accelerate your research

More information

Human Genomics. Higher Human Biology

Human Genomics. Higher Human Biology Human Genomics Higher Human Biology Learning Intentions Explain what is meant by human genomics State that bioinformatics can be used to identify DNA sequences Human Genomics The genome is the whole hereditary

More information