Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
|
|
|
- Osborne West
- 6 years ago
- Views:
Transcription
1 Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin Smith Inventory of supplementary information Supplementary figures: 2 Figure S1. Transient and stable knockdown of LEF1. Related to Figure 4 Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion Supplementary Tables: 4 Table S1. Summary of injections of DA rat ES cells into SD host blastocysts. Related to Figure 3 Table S2. Primers and probes for real-time PCR. Related to Figure 1-4 Table S3. Primary antibodies for immunofluorescence staining. Related to Figure 1-4 Table S4. Short hairpin RNA sequence of shlef1-1 and shlef1-2. Related to Figure 4 Supplementary experimental procedures
2 Supplementary Figure 1 Figure S1. Transient and stable knockdown of LEF1. (A) qrt-pcr analysis of Tcf3 and Lef1 expression after Tcf3 and Lef1 knock down. Gene expression was first normalized to Gapdh, and then relative to values in sigfp transfected cells cultured in 2iL. (B) The design of PiggyBac vector for expression of Lef1 shrna. (C) qrt-pcr analysis of Lef1 expression in
3 shlef1 transfected cells versus control. Error bars represent standard deviation of three technical replicates. Supplementary Figure 2 Figure S2. Response of mouse ES cells to GSK3 inhibition. qrt-pcr analysis of gene expression of Cdx1, Cdx2, T, and Axin2 in mouse (dashed line) and rat (solid line) ES cells cultured on feeders with different concentrations of CH. Values are normalised to Gapdh. Error bars represent standard deviation of three technical replicates. Table S1. Summary of injections of DA rat ES cells into Sprague-Dawley (SD) host blastocysts. Related to Figure 3 Cell line Sex Genetic Passage Blastocysts Pups Chimaeras Germline modification number transferred born Transmission 16g2 F GFP /4 DAK31 M None /1 16g2.cl9 F GFP /2 16g2.cl13 F GFP /1 Passages in titrated 2i are labelled in bold. Table S2. Primers and probes for real-time PCR. Gene Forward primer sequence Reverse primer sequence Gapdh* CAGTGATGGCATGGACTGTG CAATGCATCCTGCACCAC Esrrb GGCGTTCTTCAAGAGAACCA CCCACTTTGAGGCATTTCAT Nanog* TACCTCAGCCTCCAGCAGAT GCAATGGATGCTGGGATACT Klf2 GGTAGTGGCGGGTAAGCTC AACTGCGGCAAGACCTACAC Oct4* CAGGGTCTCCGATTTGCAT GCAGCTCAGCCTTAAGAACA Lef1* CTGCTGTACATGTCACTGAAC GATGGTGGCCTCTGTGTATG Cdx2* AAGACAAATACCGGGTGGTG CTGCGGTTCTGAAACCAAAT Axin2(mouse) GCAGGAGCCTCACCCTTC TGCCAGTTTCTTTGGCTCTT Cdx1(mouse) ACGCCCTACGAATGGATG CTTGGTTCGGGTCTTACCG T(mouse) CAGCCCACCTACTGGCTCTA GAGCCTGGGGTGATGGTA
4 Gene Company Cat. No. T(Rat) Appliedbiosystem Rn _m1 (Cat#: ) Axin2(Rat) Appliedbiosystem Rn _m1 (Cat#: ) Cdx1(Rat) Appliedbiosystem Rn _m1 (Cat#: ) Cdx2(Rat) Appliedbiosystem Rn _m1 (Cat#: ) Tcf1(Hnf1a) (Rat) Appliedbiosystem Rn _m1 (Cat#: ) Tcf3(Tcf7l1) (Rat) Appliedbiosystem Rn _g1 (Cat#: ) Tcf4(Rat) Appliedbiosystem Rn _m1 (Cat#: ) Lef1(Rat) Appliedbiosystem Rn _m1 (Cat#: ) Eomes(Rat) Appliedbiosystem Rn _m1 (Cat ) Elf5(Rat) Appliedbiosystem Rn _m1(Cat ) Fgfr2(Rat) Appliedbiosystem Rn _m1(Cat ) * Sequence is conserved between mouse and rat. Table S3. Primary antibodies for immunofluorescence staining. Antigen Species Dilution Company Cat.No. CDX2 Rabbit 1:200 Cell signaling 3977S OCT4(C-10) Mouse 1:200 Santa Cruz Sc-5279 T Goat 1:200 R&D Systems AF2085 CTNNB1 (β-catenin) Mouse 1:400 BD Transduction Laboratories GATA4 Goat 1:100 Santa Cruz sc-1237 Table S4. Short hairpin RNA sequence of shlef1-1 and shlef1-2. Related to Figure 4 shlef1-1 shlef1-2 GACTTGATGTCTGCTAAGTCGCGTTTTGGCCACTGACTGACGCGA CTTAAGACATCAAGT GTAATTGTCTCTCGCTGACCAGGTTTTGGCCACTGACTGACCTGGT CAGAGAGACAATTA Supplementary experimental procedures Immunofluorescence Cells were fixed with 4% paraformaldehyde in PBS (ph 7.0) for 30 minutes at room temperature. Subsequently, cells were washed twice with PBST (0.1% Triton X-100 (Sigma) in 1XPBS) and then with blocking solution (4% donkey serum in PBST). Primary antibody solution was prepared by diluting antibody in blocking solution at the concentration listed in Table S3. Cells were incubated with the primary antibody at room temperature for 2 hours or at 4 C overnight, followed by three washes with Tris-buffered saline (TBS) containing 0.1% Tween 20 prior to incubation with the secondary antibodies at room temperature for 1 hour.
5 After nuclear staining with DAPI (Invitrogen), stained cells were detected by fluorescence microscopy or confocal-laser microscopy. TOPFlash assay 10 6 cells per well were transfected with 4μg TOPFlash or FOPFlash (Upstate) and 0.2μg Renilla luciferase plasmids using lipofectamine 2000 (Invitrogen) in 6-well plates. Cells were passaged 24hrs later and replated on feeders in a 24 well plate in triplicates in PL, T2iL and 2iL respectively. 48hrs after transfection, cells were lysed and analysed using the dual luciferase kit (Promega) according to the manufacturer s protocol.
RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the
Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the
Supplemental data. Supplemental Materials and Methods
Supplemental data Supplemental Materials and Methods Transfection of plasmid. Transfection of plasmids into FRTL5 cells was performed using Lipofectamine LTX with Plus reagent (Invitrogen) according to
SANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
gacgacgaggagaccaccgctttg aggcacattgaaggtctcaaacatg
Supplementary information Supplementary table 1: primers for cloning and sequencing cloning for E- Ras ggg aat tcc ctt gag ctg ctg ggg aat ggc ttt gcc ggt cta gag tat aaa gga agc ttt gaa tcc Tpbp Oct3/4
SUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION
SUPPLEMENTAL MATERIALS SIRTUIN PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF ACTIVATION Haranatha R. Potteti*, Subbiah Rajasekaran*, Senthilkumar B. Rajamohan*, Chandramohan R. Tamatam,
Sarker et al. Supplementary Material. Subcellular Fractionation
Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged
Supplementary Material
Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated
Supplementary Figure S1 Evi/Wls and Wnt3 are overexpressed in epithelial cells in colon cancers. (a) Validation of the specificity of the Wnt3
Supplementary Figure S1 Evi/Wls and Wnt3 are overexpressed in epithelial cells in colon cancers. (a) Validation of the specificity of the Wnt3 antibody. HCT116 cells were reverse transfected with sicontrol
Supplementary Figure 1. Reintroduction of HDAC1 in HDAC1-/- ES cells reverts the
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Reintroduction of HDAC1 in HDAC1-/- ES cells reverts the phenotype of HDAC1-/- teratomas. 3x10 6 HDAC1 reintroduced (HDAC1-/-re) and empty vector infected
ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
Data Sheet. TCF/LEF Reporter Kit Wnt / -catenin signaling pathway Catalog #: 60500
Data Sheet TCF/LEF Reporter Kit Wnt / -catenin signaling pathway Catalog #: 60500 Background The Wnt / -catenin signaling pathway controls a large and diverse set of cell fate decisions in embryonic development,
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12119 SUPPLEMENTARY FIGURES AND LEGENDS pre-let-7a- 1 +14U pre-let-7a- 1 Ddx3x Dhx30 Dis3l2 Elavl1 Ggt5 Hnrnph 2 Osbpl5 Puf60 Rnpc3 Rpl7 Sf3b3 Sf3b4 Tia1 Triobp U2af1 U2af2 1 6 2 4 3
The Transfection Collection TCF/LEF Transient Pack Wnt / -catenin Signaling Pathway Catalog #: 79273
Data Sheet The Transfection Collection TCF/LEF Transient Pack Wnt / -catenin Signaling Pathway Catalog #: 79273 Background The Wnt / -catenin signaling pathway controls a large and diverse set of cell
Transcriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3
ChIP H3K4Me3 enrichment.25.2.15.1.5 H3K4Me3 H3K4Me3 ctrl H3K4Me3 + E2 NS + E2 1. kb kb +82 kb Figure S1. Estrogen promotes entry of MCF-7 into the cell cycle but does not significantly change activation-associated
Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and
SUPPLEMENTARY MATERIALS AND METHODS Chromatin Immunoprecipitation for qpcr analysis Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and IL24, all located on chromosome 1. Primer
Supplemental Methods Cell lines and culture
Supplemental Methods Cell lines and culture AGS, CL5, BT549, and SKBR were propagated in RPMI 64 medium (Mediatech Inc., Manassas, VA) supplemented with % fetal bovine serum (FBS, Atlanta Biologicals,
Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency.
Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. (a) Transfection of different concentration of GAS5-overexpressing
Table S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number
Table S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number Stock Concentration Final concentration Volume used Advanced DMEM/F12 Invitrogen 12634010-78%
Supplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell
Supplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell Supplementary Figures S1-S3 Supplementary Methods Supplementary Figure S1. Identification
We performed RT-PCR, cloning, sequencing and qrt-pcr in murine melanoma. cell lines and melanocytic tumors from RET-mice in accordance with the method
Supplementary Material and Methods Quantitative RT-PCR (qrt-pcr) We performed RT-PCR, cloning, sequencing and qrt-pcr in murine melanoma cell lines and melanocytic tumors from RET-mice in accordance with
Bioimaging of microrna-294 expression-dependent color change. in cells by a dual fluorophore-based molecular beacon
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information for Chemical Communications Bioimaging of microrna-294 expression-dependent
Supplemental material
Supplemental material THE JOURNAL OF CELL BIOLOGY Taylor et al., http://www.jcb.org/cgi/content/full/jcb.201403021/dc1 Figure S1. Representative images of Cav 1a -YFP mutants with and without LMB treatment.
Nature Biotechnology: doi: /nbt.4166
Supplementary Figure 1 Validation of correct targeting at targeted locus. (a) by immunofluorescence staining of 2C-HR-CRISPR microinjected embryos cultured to the blastocyst stage. Embryos were stained
Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
Nature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible
Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and
Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and SSEA4 after 10 passages in mtesr 1 medium. (b) Schematic
At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in
Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm
Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR
Supplementary Methods Antibodies Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR (Cat#2646), anti-igf1r (Cat#3018), anti-insr (Cat#3020), anti-akt (pan, Cat#4691), anti-phospho-akt
supplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
Percent survival. Supplementary fig. S3 A.
Supplementary fig. S3 A. B. 100 Percent survival 80 60 40 20 Ml 0 0 100 C. Fig. S3 Comparison of leukaemia incidence rate in the triple targeted chimaeric mice and germline-transmission translocator mice
Supplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells
Supplementary Data Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Mouse induced pluripotent stem cells (ipscs) were cultured
sirna Transfection Into Primary Neurons Using Fuse-It-siRNA
sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative
SUPPLEMENTARY INFORMATION
The Supplementary Information (SI) Methods Cell culture and transfections H1299, U2OS, 293, HeLa cells were maintained in DMEM medium supplemented with 10% fetal bovine serum. H1299 and 293 cells were
Supplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered
Supplementary Information: Materials and Methods Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered saline (PBS) and lysed in TNN lysis buffer (50mM Tris at ph 8.0, 120mM NaCl
Protocol Reprogramming MEFs using the Dox Inducible Reprogramming Lentivirus Set: Mouse OKSM
STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of mouse embryonic fibroblasts (MEFs) into induced pluripotent stem (ips) cells in a 6-well format. Transduction
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. Functional assays of hepatocyte-like cells induced from H1 hescs (a) P450 and AAT staining, PAS staining, LDL uptake assay, and ICG uptake and release assay
Lullaby sirna Transfection Reagent - Results
sirna Transfection Reagent - Results OZ Biosciences is delighted to announce the launching of a new sirna transfection reagent: -sirna. This lipid based transfection reagent is specifically designed for
Supplemental Information
Supplemental Information Intrinsic protein-protein interaction mediated and chaperonin assisted sequential assembly of a stable Bardet Biedl syndome protein complex, the BBSome * Qihong Zhang 1#, Dahai
M X 500 µl. M X 1000 µl
GeneGlide TM sirna Transfection Reagent (Catalog # M1081-300, -500, -1000; Store at 4 C) I. Introduction: BioVision s GeneGlide TM sirna Transfection reagent is a cationic proprietary polymer/lipid formulation,
Supplemental Materials and Methods
Supplemental Materials and Methods In situ hybridization In situ hybridization analysis of HFE2 and genin mrna in rat liver tissues was performed as previously described (1). Briefly, the digoxigenin-labeled
A549-luc mock cells, A549-luc/shCon cells and A549-luc/shYY1 cells were seeded onto 35 mm
Supplementary Material and Methods Real-time luciferase gene expression in A549-luc cells A549-luc mock cells, A549-luc/shCon cells and A549-luc/shYY1 cells were seeded onto 35 mm dishes (100,000 cells/dish),
Mammosphere formation assay. Mammosphere culture was performed as previously described (13,
Supplemental Text Materials and Methods Mammosphere formation assay. Mammosphere culture was performed as previously described (13, 17). For co-culture with fibroblasts and treatment with CM or CCL2, fibroblasts
Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by
Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by down-regulating PKA and CREB activation Sudha Saryu Malhotra 1, Pankaj Suman 2 and Satish Kumar Gupta 1 * 1 Reproductive
Whole Mount IHC Protocol
Whole Mount IHC Protocol Authors: Ruth Sullivan, Ryan Trevena and Kyle Wegner Creation Date: 03/17/2016 All steps should be conducted with gentle agitation on an orbital shaker, unless otherwise instructed.
Supplementary Methods
Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed
Supplementary Figure 1. Isolation of GFPHigh cells.
Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
Supporting Information
Supporting Information Davidson et al. 1.173/pnas.111877719 SI Materials and Methods hesc Culture. For experiments where treatments were continued over several weeks, an identical sister plate was harvested
Confocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
Nature Medicine: doi: /nm.2171
Table 1. Anti-cystic effect of Genz-123346 in jck mouse model of PKD No No of animals Gender Dose (% in feed) Body weight (g) K/BW ratio (%) Cystic volume (%BW) BUN (mg dl 1 ) 1 Vehicle 10 F - 19.2 ± 0.6
Electromagnetic Fields Mediate Efficient Cell Reprogramming Into a Pluripotent State
Electromagnetic Fields Mediate Efficient Cell Reprogramming Into a Pluripotent State Soonbong Baek, 1 Xiaoyuan Quan, 1 Soochan Kim, 2 Christopher Lengner, 3 Jung- Keug Park, 4 and Jongpil Kim 1* 1 Lab
Firefly luciferase mutants as sensors of proteome stress
Nature Methods Firefly luciferase mutants as sensors of proteome stress Rajat Gupta, Prasad Kasturi, Andreas Bracher, Christian Loew, Min Zheng, Adriana Villella, Dan Garza, F Ulrich Hartl & Swasti Raychaudhuri
Arrest-In Transfection Reagent Catalog numbers: ATR1740, ATR1741, ATR1742, ATR1743
Arrest-In Transfection Reagent Catalog numbers: ATR1740, ATR1741, ATR1742, ATR1743 Technical support: 1-888-412-2225 Page 1 Arrest-In Transfection Reagent Catalog numbers: ATR1740, ATR1741, ATR1742, ATR1743
Supplementary Information: Materials and Methods. GST and GST-p53 were purified according to standard protocol after
Supplementary Information: Materials and Methods Recombinant protein expression and in vitro kinase assay. GST and GST-p53 were purified according to standard protocol after induction with.5mm IPTG for
B. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.
A. - Figure.S1,Li et al. B. : - + - + - + E-cadherin CK19 α-sma vimentin β -actin C. D. Apoptosis: 1.68% 2.99% 1.31% - : - + - + - + Apoptosis: 48.33% 45.32% 44.59% E. invaded cells number 400 300 200
Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons
Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental
Protocol Reprogramming Human Fibriblasts using the Dox Inducible Reprogramming Polycistronic Lentivirus Set: Human 4F2A LoxP
STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of BJ Human Fibroblasts (BJ cells) into induced pluripotent stem (ips) cells in a 6-well format. Transduction efficiency
IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity
IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα
SUPPLEMENTARY INFORMATION
(Supplementary Methods and Materials) GST pull-down assay GST-fusion proteins Fe65 365-533, and Fe65 538-700 were expressed in BL21 bacterial cells and purified with glutathione-agarose beads (Sigma).
Supplementary Figure 1. Nur77 and leptin-controlled obesity. (A) (B) (C)
Supplementary Figure 1. Nur77 and leptin-controlled obesity. (A) Effect of leptin on body weight and food intake between WT and KO mice at the age of 12 weeks (n=7). Mice were i.c.v. injected with saline
Regulation of transcription by the MLL2 complex and MLL complex-associated AKAP95
Supplementary Information Regulation of transcription by the complex and MLL complex-associated Hao Jiang, Xiangdong Lu, Miho Shimada, Yali Dou, Zhanyun Tang, and Robert G. Roeder Input HeLa NE IP lot:
Supplemental Information. Tissue Mechanics Orchestrate Wnt-Dependent. Human Embryonic Stem Cell Differentiation
Cell Stem Cell, Volume 19 Supplemental Information Tissue Mechanics Orchestrate Wnt-Dependent Human Embryonic Stem Cell Differentiation Laralynne Przybyla, Johnathon N. Lakins, and Valerie M. Weaver Supplemental
Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl
Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl, loxp sites flanking exons 3-6 (red arrowheads) were introduced into
Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and
Determining positive selection gates for LRCs and nonlrcs Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and shape of the Gaussian distributions. For
0.9 5 H M L E R -C tr l in T w is t1 C M
a. b. c. d. e. f. g. h. 2.5 C elltiter-g lo A ssay 1.1 5 M T S a s s a y Lum inescence (A.U.) 2.0 1.5 1.0 0.5 n s H M L E R -C tr l in C tr l C M H M L E R -C tr l in S n a il1 C M A bsorbance (@ 490nm
To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well
Supplemental Information: Supplemental Methods: Cell culture To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well in 96 well Primaria plates in GNS media and incubated at
Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde
Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with
Supplemental Materials
Supplemental Materials Materials and Methods Histopathologic and immunohistochemical evaluation Liver tissue was divided and fixed in phosphate-buffered neutral formalin, embedded in paraffin, and cut
Protocol Using the Reprogramming Ecotropic Retrovirus Set: Mouse OSKM to Reprogram MEFs into ips Cells
STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of mouse embryonic fibroblast (MEF) cells into induced pluripotent stem (ips) cells in a 6-well format. Transduction
Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were. oligonucleotide spanning the NF-kB site (5 -GATCC-
SUPPLEMENTARY MATERIALS AND METHODS Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were prepared as previously described. (1) A [ 32 P] datp-labeled doublestranded oligonucleotide spanning
Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2
Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 female) or wild-type (5 months old, 1 male; 11 months old,
In general, 8- to 10-week-old adult females were ovariectomized and rested for 10 days
Animal injections and tissue processing In general, 8- to 10-week-old adult females were ovariectomized and rested for 10 days before they received any injections. Mice were injected with sesame seed oil
Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila
Cell Supplemental Information Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila Bo Liu, Yonggang Zheng, Feng Yin, Jianzhong Yu, Neal Silverman, and Duojia Pan Supplemental Experimental
Protocol Reprogramming Human Fibroblasts into ips Cells using the Stemgent Reprogramming Lentivirus Set: Human OKSM
STEMGENT Page 1 Reprogramming Lentivirus Set: Human OKSM OVERVIEW The following procedure describes the reprogramming of BJ Human Fibroblasts (BJ cells) to induced pluripotent stem (ips) cells using the
Supplementary Figure S1
Supplementary Figure S1 Luciferase ctivity (%) 5 4 3 2 1 HeLa E2 OHT Figure S1. SENP2 represses estradiol-dependent transcriptional activity in HeLa cells. HeLa cells were transiently transfected with
Chemically defined conditions for human ipsc derivation and culture
Nature Methods Chemically defined conditions for human ipsc derivation and culture Guokai Chen, Daniel R Gulbranson, Zhonggang Hou, Jennifer M Bolin, Victor Ruotti, Mitchell D Probasco, Kimberly Smuga-Otto,
Supporting Information
Supporting Information Stavru et al. 0.073/pnas.357840 SI Materials and Methods Immunofluorescence. For immunofluorescence, cells were fixed for 0 min in 4% (wt/vol) paraformaldehyde (Electron Microscopy
CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration
/, Supplementary Advance Publications Materials 2016 CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration Supplementary Materials Supplementary Figure S1: In ECs CD93 silencing
NTM486-04, NTM174-04,
Transfection of transformed human trabecular meshwork TM5, and primary human NTM210-05, NTM486-04, NTM174-04, and NTM153-00 cells with Metafectene Easy Adnan Dibas1A,C, Ming Jiang1A,C, Thomas Yorio1A,C.
Supplemental Table 1 Primers used in study. Human. Mouse
Supplemental Table 1 Primers used in study Human Forward primer region(5-3 ) Reverse primer region(5-3 ) RT-PCR GAPDH gagtcaacggatttggtcgt ttgattttggagggatctcg Raftlin atgggttgcggattgaacaagttaga ctgaggtataacaccaacgaatttcaggc
Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice
Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice Supplementary Material Supplementary Methods Materials Spironolactone, aldosterone and β-glycerophosphate were
Supplementary Figure 1. Western analysis of p-smad1/5/8 of differentiated hescs.
kda 65 45 45 35 Supplementary Figure 1. Western analysis of p-smad1/5/8 of differentiated hescs. H9 hescs were differentiated with or without BMP4+BMP8A and cell lysates were collected for Western analysis
A Supersandwich Fluorescence in Situ Hybridization (SFISH) Strategy. for Highly Sensitive and Selective mrna Imaging in Tumor Cells
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information (ESI) A Supersandwich Fluorescence in Situ Hybridization (SFISH)
TOOLS sirna and mirna. User guide
TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)
Supplementary Data. Supplementary Materials and Methods Quantification of delivered sirnas. Fluorescence microscopy analysis
Supplementary Data Supplementary Materials and Methods Quantification of delivered sirnas After transfection, cells were washed in three times with phosphate buffered saline and total RNA was extracted
Product: Arrest-In TM Transfection Reagent for RNAi
Product: Arrest-In TM Transfection Reagent for RNAi Catalog #: ATR1740, ATR1741, ATR1742, ATR1743 Product Description Arrest-In transfection reagent is a proprietary polymeric formulation, developed and
Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,
Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, respectively, and their mrnas were quantified by real time
Supplementary Figure 1. Characterization of hipscs derived from primary human fibroblasts. a,b. Morphology of hipscs. hipscs exhibit hesc-like
Supplementary Figure 1. Characterization of hipscs derived from primary human fibroblasts. a,b. Morphology of hipscs. hipscs exhibit hesc-like morphology in co-culture with mouse embryonic feeder fibroblasts
Eric J. Wagner, Brandon D. Burch, Ashley C. Godfrey, Harmony R. Salzler, Robert J. Duronio, and William F. Marzluff
Molecular Cell, Volume 28 Supplemental Data A Genome-Wide RNA Interference Screen Reveals that Variant Histones Are Necessary for Replication-Dependent Histone Pre-mRNA Processing Eric J. Wagner, Brandon
Data Sheet. SBE Reporter Kit (TGFβ/SMAD signaling pathway) Catalog #: 60654
Data Sheet SBE Reporter Kit (TGFβ/SMAD signaling pathway) Catalog #: 60654 Background The transforming growth factor beta (TGFβ) signaling pathway is involved in a diverse range of cell processes such
Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene
Developmental Cell, Volume 25 Supplemental Information Brg1 Governs a Positive Feedback Circuit in the Hair Follicle for Tissue Regeneration and Repair Yiqin Xiong, Wei Li, Ching Shang, Richard M. Chen,
Premade Lentiviral Particles for ips Stem Factors: Single vector system. For generation of induced pluripotent stem (ips) cells and other applications
Premade Lentiviral Particles for ips Stem Factors: Single vector system For generation of induced pluripotent stem (ips) cells and other applications RESEARCH USE ONLY, not for diagnostics or therapeutics
TALEN mediated targeted editing of GM2/GD2-synthase gene modulates anchorage independent growth by reducing anoikis resistance in mouse tumor cells
Supplementary Information for TALEN mediated targeted editing of GM2/GD2-synthase gene modulates anchorage independent growth by reducing anoikis resistance in mouse tumor cells Barun Mahata 1, Avisek
Nemo like kinase regulates the expression of vascular endothelial growth factor (VEGF) in alveolar epithelial cells
Nemo like kinase regulates the expression of vascular endothelial growth factor (VEGF) in alveolar epithelial cells Hengning Ke, Katarzyna Chmielarska Masoumi, Kristofer Ahlqvist, Michael J. Seckl, Kristina
Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured
Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured under static conditions. Cells were seeded in the chamber area of the device and cultured overnight without medium perfusion.
Supplementary Material - Methods
Novel Protein-Protein Interactions in the Schizophrenia interactome Supplementary Material - Methods Experimental validations of predicted interactions Table S1-1: Protein pairs that were validated by
Primers used for PCR of conductin, SGK1 and GAPDH have been described in (Dehner et al,
Supplementary METHODS Flow Cytometry (FACS) For FACS analysis, trypsinized cells were fixed in ethanol, rehydrated in PBS and treated with 40μg/ml propidium iodide and 10μ/ml RNase for 30 min at room temperature.
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
Otefin, a Nuclear Membrane Protein, Determines
Developmental Cell 14 Supplemental Data Otefin, a Nuclear Membrane Protein, Determines the Fate of Germline Stem Cells in Drosophila via Interaction with Smad Complexes Xiaoyong Jiang, Laixin Xia, Dongsheng
Regulation of hepcidin expression by inflammation-induced activin B
Regulation of hepcidin expression by inflammation-induced activin B Yohei Kanamori, Makoto Sugiyama, Osamu Hashimoto, Masaru Murakami, Tohru Matsui and Masayuki Funaba Supplemental methods Liver cell separation