Bioinformatics and computational tools

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Bioinformatics and computational tools"

Transcription

1 Bioinformatics and computational tools Etienne P. de Villiers (PhD) International Livestock Research Institute Nairobi, Kenya

2 International Livestock Research Institute Nairobi, Kenya ILRI works at the crossroads of livestock and poverty, bringing high quality science and capacity building to bear on poverty reduction and sustainable development. It is one of 15 centers supported by the Consultative Group on International Agricultural Research (CGIAR) that conduct food and environmental research to help alleviate poverty and increase food security. ILRI biotech facilities: Molecular biology Laboratories (>6,000 sqm) State of the art biosciences equipment 2 ABI sequencers (3130, 3730) 1 Roche 454 GS FLX Bioinformatics unit 64 CPU high performance compute cluster BSL3 laboratory Flow cytometry and microscopy Diagnostics (nucleotide and protein based) Vaccine technology/immunology Small and Large Animal units

3 Central dogma of molecular biology

4 Bioinformatics Bioinformatics is the application of information technology and computer science to the field of molecular biology.

5 Bioinformatics Genome (DNA) sequence ACGGTGCGTAACGTCAGTCAGGTCAGTCAG Bioinformatics or computational biology Gene or protein properties Comparative analysis Protein structure and function prediction

6 The Sequencing Revolution Next Generation Sequencing High Throughput Sequencing 2000 High Throughput Sequencing sequences per hour 2.6 million sequences per hour

7 The Sequencing Revolution Third Generation Sequencing Single Molecule sequencing Pacific Biosciences Oxford Nanopore ~3,000 wells per chip 1,500 bp per well 10 bp per second $1,000 human genome

8 Sequencing the Human Genome 2001: Human Genome Project 3 billion $, 11 years : 454 1M$, 3 months Log 10 (price) : Celera 100 Million $ 3 years 2008: ABI SOLiD 60K$, 2 weeks 2009: Illumina 40-50K$ 2010: 5K$, a few days Year

9 Next Generation Sequencing Current Projects 1000 Genomes project (www.1000genomes.org) Sequence genomes from 2500 people from divers backgrounds to 4x coverage to identify human genetic variation. Ensembl genomes (www.ensemblgenomes.org) 234 species sequenced from mammalians, birds to parasites. >400 bacterial species sequenced. Plant genomes 18 sequenced (www.phytozome.org/) BGI (China) (www.genomics.cn) 1,000 plant and animal reference genome project.

10 Cost of Computing Intel icore7 desktop $1,000 GigaFLOPS Cray YMP $40,000, Sun HPC1000 $1,000,000 1

11 World Internet Connections

12 Cloud Computing Cloud computing is a general term for computation as aservice. Computation as a service means that customers rent the hardware and the storage only for the time needed to achieve their goals Amazon Elastic Compute Cloud (Amazon EC2) provides resizable compute capacity in the cloud including, High Performance computing (HPC) on demand 23 GB of memory 64 Compute nodes 1.7 Terabytes storage $1.60 per hour or $5,000 per year

13 Distributed computing Distributed computing is any computing that involves multiple computers remote from each other. A central server sends and receives the work units (essentially just protein structures and sequences). The client uses the spare CPU cycles on a user s computer to run the simulation algorithm on the assigned structure. Results are automatically returned and exchanged for a new work unit on a daily basis. home lab/office anywhere

14 Distributed computing Understand how existing proteins attain their specific, functional three dimensional structures. Use distributed computing through installation of screensaver on user computer. In 2009 was running on 40,000 CPUs or 5 PFLOPS Fastest standalone supercomputer is "Tianhe 1A at 2.5 PFLOPS

15 Metagenomics Metagenomics is the sequencing and analysis of DNA of organisms recovered from an environment, without the need for culturing them using next generation sequencing technologies. Organisms The Sargasso Sea community survey Acid mine drainage film Human gut communities Symbiotic community from marine worm AVID project

16 From Sequence (genomics/metagenomics) to impact phylogenetic analysis Diagnostics (meta)genome sequencing geographical mapping Global diseases surveillance Databases protein modeling Vaccine dvlpmt Compilation of complete genomes, metagenomes, annotation and curation of metadata Extraction of important biological information sequence variation analysis Primer, microarray discovery of new microorganisms and pathways Drug dvlpmt Improved drug selection Environmental sustainability Better control tools

17 AVID Arbovirus Incident & Diversity project Google.org Predict and Prevent funded project. Pilot project on Rift Valley Fever virus. virus is transmitted by mosquitoes and infect both animals and humans deadly to both humans and livestock outbreaks occur every 5 6 years A complex mix of species, sub species, populations. Can we understand its dynamics?

18 AVID Questions Where is the virus (between outbreaks )? Environment Vectors Reservoirs What is the diversity of? Virus Vector Reservoir And how do these interact? Distribution of other pathogens? Novel pathogens and variants? For example: Does a particular virus variant occur in a particular vector variant associated with a particular mammalian variant? Viral Geneflow

19 AVID Strategy Samples are collected in specific areas: Human blood, livestock, wildlife, mosquitoes, water, soil Each sample collected with a full meta data description (location, date/time, eco geo socio descriptors). Amplify sequences from multiple points on multiple possible genomes virus, insect, mammal, others. Sequence these amplicons simultaneously from 1,000s of samples using next generation sequencing. Analyse sequences look for distribution and co occurrence. Refine primers for a simple (RT) PCR approach. Move diagnostic sequences on to high throughput PCR diagnostics.

20

21 AVID Data management and BioBANK Data management is one of the biggest challenges. The project cannot achieve its goals without great data integration. All samples are biobanked with full data descriptors Opportunity to share samples across projects? Wildlife samples are very expensive and everyone is collecting them for their own purposes!!

22 Thank You

Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie. Sander van Boheemen Medical Microbiology

Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie. Sander van Boheemen Medical Microbiology Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie Sander van Boheemen Medical Microbiology Next-generation sequencing Next-generation sequencing (NGS), also known as

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

Human genome sequence

Human genome sequence NGS: the basics Human genome sequence June 26th 2000: official announcement of the completion of the draft of the human genome sequence (truly finished in 2004) Francis Collins Craig Venter HGP: 3 billion

More information

Outline. General principles of clonal sequencing Analysis principles Applications CNV analysis Genome architecture

Outline. General principles of clonal sequencing Analysis principles Applications CNV analysis Genome architecture The use of new sequencing technologies for genome analysis Chris Mattocks National Genetics Reference Laboratory (Wessex) NGRL (Wessex) 2008 Outline General principles of clonal sequencing Analysis principles

More information

Engineering Genetic Circuits

Engineering Genetic Circuits Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art

More information

Overview of Health Informatics. ITI BMI-Dept

Overview of Health Informatics. ITI BMI-Dept Overview of Health Informatics ITI BMI-Dept Fellowship Week 5 Overview of Health Informatics ITI, BMI-Dept Day 10 7/5/2010 2 Agenda 1-Bioinformatics Definitions 2-System Biology 3-Bioinformatics vs Computational

More information

China National Grid --- BioNode. Jun Wang Beijing Genomics Institute

China National Grid --- BioNode. Jun Wang Beijing Genomics Institute China National Grid --- BioNode Jun Wang Beijing Genomics Institute Core of life science and bio-tech: Getting, Mining, Applying the basic life information Old China meets New China? Sequencing, sequencing,

More information

Next Generation Sequencing. Jeroen Van Houdt - Leuven 13/10/2017

Next Generation Sequencing. Jeroen Van Houdt - Leuven 13/10/2017 Next Generation Sequencing Jeroen Van Houdt - Leuven 13/10/2017 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977 A Maxam and W Gilbert "DNA seq by chemical degradation" F Sanger"DNA

More information

Third Generation Sequencing

Third Generation Sequencing Third Generation Sequencing By Mohammad Hasan Samiee Aref Medical Genetics Laboratory of Dr. Zeinali History of DNA sequencing 1953 : Discovery of DNA structure by Watson and Crick 1973 : First sequence

More information

E2ES to Accelerate Next-Generation Genome Analysis in Clinical Research

E2ES to Accelerate Next-Generation Genome Analysis in Clinical Research www.hcltech.com E2ES to Accelerate Next-Generation Genome Analysis in Clinical Research whitepaper April 2015 TABLE OF CONTENTS Introduction 3 Challenges associated with NGS data analysis 3 HCL s NGS Solution

More information

Next Generation Bioinformatics on the Cloud

Next Generation Bioinformatics on the Cloud Next Generation Bioinformatics on the Cloud http://www.easygenomics.com Sifei He Director of BGI Cloud hesifei@genomics.cn Xing Xu, Ph.D Senior Product Manager EasyGenomics BGI xuxing@genomics.cn Contact

More information

NOW GENERATION SEQUENCING. Monday, December 5, 11

NOW GENERATION SEQUENCING. Monday, December 5, 11 NOW GENERATION SEQUENCING 1 SEQUENCING TIMELINE 1953: Structure of DNA 1975: Sanger method for sequencing 1985: Human Genome Sequencing Project begins 1990s: Clinical sequencing begins 1998: NHGRI $1000

More information

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015 Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck

More information

Next Generation Sequencing (NGS) Market Size, Growth and Trends ( )

Next Generation Sequencing (NGS) Market Size, Growth and Trends ( ) Next Generation Sequencing (NGS) Market Size, Growth and Trends (2014-2020) July, 2017 4 th edition Information contained in this market report is believed to be reliable at the time of publication. DeciBio

More information

Sequencing Theory. Brett E. Pickett, Ph.D. J. Craig Venter Institute

Sequencing Theory. Brett E. Pickett, Ph.D. J. Craig Venter Institute Sequencing Theory Brett E. Pickett, Ph.D. J. Craig Venter Institute Applications of Genomics and Bioinformatics to Infectious Diseases GABRIEL Network Agenda Sequencing Instruments Sanger Illumina Ion

More information

MetaShot: a complete workflow for the characterization of human microbiome from shotgun data Joint NETTAB and Integrative Bioinformatics meeting 2015

MetaShot: a complete workflow for the characterization of human microbiome from shotgun data Joint NETTAB and Integrative Bioinformatics meeting 2015 MetaShot: a complete workflow for the characterization of human microbiome from shotgun data Joint NETTAB and Integrative Bioinformatics meeting 2015 Bari, October 14th Bruno Fosso, Ph.D. IBBE-CNR METAGENOMICS

More information

Opportunities offered by new sequencing technologies

Opportunities offered by new sequencing technologies Opportunities offered by new sequencing technologies Pierre Taberlet Laboratoire d'ecologie Alpine CNRS UMR 5553 Université Joseph Fourier, Grenoble, France Nature Biotechnology, October 2008: special

More information

Research school methods seminar Genomics and Transcriptomics

Research school methods seminar Genomics and Transcriptomics Research school methods seminar Genomics and Transcriptomics Stephan Klee 19.11.2014 2 3 4 5 Genetics, Genomics what are we talking about? Genetics and Genomics Study of genes Role of genes in inheritence

More information

Accelerate High Throughput Analysis for Genome Sequencing with GPU

Accelerate High Throughput Analysis for Genome Sequencing with GPU Accelerate High Throughput Analysis for Genome Sequencing with GPU ATIP - A*CRC Workshop on Accelerator Technologies in High Performance Computing May 7-10, 2012 Singapore BingQiang WANG, Head of Scalable

More information

Real-Time PCR Workshop Gene Expression. Applications Absolute and Relative Quantitation

Real-Time PCR Workshop Gene Expression. Applications Absolute and Relative Quantitation Real-Time PCR Workshop Gene Expression Applications Absolute and Relative Quantitation Absolute Quantitation Easy to understand the data, difficult to develop/qualify the standards Relative Quantitation

More information

ACCELERATING GENOMIC ANALYSIS ON THE CLOUD. Enabling the PanCancer Analysis of Whole Genomes (PCAWG) consortia to analyze thousands of genomes

ACCELERATING GENOMIC ANALYSIS ON THE CLOUD. Enabling the PanCancer Analysis of Whole Genomes (PCAWG) consortia to analyze thousands of genomes ACCELERATING GENOMIC ANALYSIS ON THE CLOUD Enabling the PanCancer Analysis of Whole Genomes (PCAWG) consortia to analyze thousands of genomes Enabling the PanCancer Analysis of Whole Genomes (PCAWG) consortia

More information

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio

More information

Getting Bioinformatics Done With Galaxy

Getting Bioinformatics Done With Galaxy Getting Bioinformatics Done With Galaxy J Fass, M Britton, N Joshi, R Feltstykket UCD Genome Center Bioinformatics Core bioinformatics.core@ucdavis.edu May 13, 2015 The Bioinformatics Core Nik Joshi Monica

More information

Welcome to the NGS webinar series

Welcome to the NGS webinar series Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic

More information

Next-Generation Sequencing. Technologies

Next-Generation Sequencing. Technologies Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062

More information

Genome Sequencing. I: Methods. MMG 835, SPRING 2016 Eukaryotic Molecular Genetics. George I. Mias

Genome Sequencing. I: Methods. MMG 835, SPRING 2016 Eukaryotic Molecular Genetics. George I. Mias Genome Sequencing I: Methods MMG 835, SPRING 2016 Eukaryotic Molecular Genetics George I. Mias Department of Biochemistry and Molecular Biology gmias@msu.edu Sequencing Methods Cost of Sequencing Wetterstrand

More information

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene

More information

Trans-omics for a better life

Trans-omics for a better life Trans-omics for a better life History From 1% to World Leading The largest genomic organization in the world Focus on research and applications in the healthcare, agriculture, conservation, and environmental

More information

European Technology Platform for Global Animal Health. Action Plan

European Technology Platform for Global Animal Health. Action Plan European Technology Platform for Global Animal Health Action Plan European Technology T Platform for Global Animal Health Action Plan 2 Table of contents Executive Summary 7 Chapter 1: The Action Plan

More information

Lecture #1. Introduction to microarray technology

Lecture #1. Introduction to microarray technology Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing

More information

Molecular Biology: DNA sequencing

Molecular Biology: DNA sequencing Molecular Biology: DNA sequencing Author: Prof Marinda Oosthuizen Licensed under a Creative Commons Attribution license. SEQUENCING OF LARGE TEMPLATES As we have seen, we can obtain up to 800 nucleotides

More information

Texas A&M AgriLife Research LOWER RIO GRANDE VALLEY REGION RESEARCH GOALS AND IMPACTS. Texas A&M AgriLife Research and Extension Center at Weslaco

Texas A&M AgriLife Research LOWER RIO GRANDE VALLEY REGION RESEARCH GOALS AND IMPACTS. Texas A&M AgriLife Research and Extension Center at Weslaco Texas A&M AgriLife Research LOWER RIO GRANDE VALLEY REGION RESEARCH GOALS AND IMPACTS Texas A&M AgriLife Research and Extension Center at Weslaco 2015 GOAL Protect water quality and increase the amount

More information

NOTES - CH 15 (and 14.3): DNA Technology ( Biotech )

NOTES - CH 15 (and 14.3): DNA Technology ( Biotech ) NOTES - CH 15 (and 14.3): DNA Technology ( Biotech ) Vocabulary Genetic Engineering Gene Recombinant DNA Transgenic Restriction Enzymes Vectors Plasmids Cloning Key Concepts What is genetic engineering?

More information

Genome Sequencing Technologies. Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall

Genome Sequencing Technologies. Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall Genome Sequencing Technologies Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall Sciences start with Observation Sciences start with Observation and flourish with

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Alla L Lapidus, Ph.D. SPbSU St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as "the study of

More information

Ultrasequencing: Methods and Applications of the New Generation Sequencing Platforms

Ultrasequencing: Methods and Applications of the New Generation Sequencing Platforms Ultrasequencing: Methods and Applications of the New Generation Sequencing Platforms Laura Moya Andérico Master in Advanced Genetics Genomics Class December 16 th, 2015 Brief Overview First-generation

More information

B I O I N F O R M A T I C S

B I O I N F O R M A T I C S B I O I N F O R M A T I C S Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be SUPPLEMENTARY CHAPTER: DATA BASES AND MINING 1 What

More information

Polymerase Chain Reaction (PCR) and Its Applications

Polymerase Chain Reaction (PCR) and Its Applications Polymerase Chain Reaction (PCR) and Its Applications What is PCR? PCR is an exponentially progressing synthesis of the defined target DNA sequences in vitro. It was invented in 1983 by Dr. Kary Mullis,

More information

GENE EXPRESSION REAGENTS MARKETS (SAMPLE COPY, NOT FOR RESALE)

GENE EXPRESSION REAGENTS MARKETS (SAMPLE COPY, NOT FOR RESALE) TriMark Publications April 2007 Volume: TMRGER07-0401 GENE EXPRESSION REAGENTS MARKETS (SAMPLE COPY, NOT FOR RESALE) Trends, Industry Participants, Product Overviews and Market Drivers TABLE OF CONTENTS

More information

Ion S5 and Ion S5 XL Systems

Ion S5 and Ion S5 XL Systems Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Explore the Ion S5 and Ion S5 XL Systems Adopting next-generation sequencing (NGS) in your lab is now simpler than ever The Ion S5

More information

Sanger vs Next-Gen Sequencing

Sanger vs Next-Gen Sequencing Tools and Algorithms in Bioinformatics GCBA815/MCGB815/BMI815, Fall 2017 Week-8: Next-Gen Sequencing RNA-seq Data Analysis Babu Guda, Ph.D. Professor, Genetics, Cell Biology & Anatomy Director, Bioinformatics

More information

The Integrated Biomedical Sciences Graduate Program

The Integrated Biomedical Sciences Graduate Program The Integrated Biomedical Sciences Graduate Program at the university of notre dame Cutting-edge biomedical research and training that transcends traditional departmental and disciplinary boundaries to

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics IMBB 2017 RAB, Kigali - Rwanda May 02 13, 2017 Joyce Nzioki Plan for the Week Introduction to Bioinformatics Raw sanger sequence data Introduction to CLC Bio Quality Control

More information

Infectious Disease Omics

Infectious Disease Omics Infectious Disease Omics Metagenomics Ernest Diez Benavente LSHTM ernest.diezbenavente@lshtm.ac.uk Course outline What is metagenomics? In situ, culture-free genomic characterization of the taxonomic and

More information

Plant genome annotation using bioinformatics

Plant genome annotation using bioinformatics Plant genome annotation using bioinformatics ghorbani mandolakani Hossein, khodarahmi manouchehr darvish farrokh, taeb mohammad ghorbani24sma@yahoo.com islamic azad university of science and research branch

More information

Targeted Sequencing in the NBS Laboratory

Targeted Sequencing in the NBS Laboratory Targeted Sequencing in the NBS Laboratory Christopher Greene, PhD Newborn Screening and Molecular Biology Branch Division of Laboratory Sciences Gene Sequencing in Public Health Newborn Screening February

More information

Microarray Technique. Some background. M. Nath

Microarray Technique. Some background. M. Nath Microarray Technique Some background M. Nath Outline Introduction Spotting Array Technique GeneChip Technique Data analysis Applications Conclusion Now Blind Guess? Functional Pathway Microarray Technique

More information

Lecture 1. Bioinformatics 2. About me... The class (2009) Course Outcomes. What do I think you know?

Lecture 1. Bioinformatics 2. About me... The class (2009) Course Outcomes. What do I think you know? Lecture 1 Bioinformatics 2 Introduction Course Overview & Assessment Introduction to Bioinformatics Research Careers and PhD options Core topics in Bioinformatics the central dogma of molecular biology

More information

Bioinformatics 2. Lecture 1

Bioinformatics 2. Lecture 1 Bioinformatics 2 Introduction Lecture 1 Course Overview & Assessment Introduction to Bioinformatics Research Careers and PhD options Core topics in Bioinformatics the central dogma of molecular biology

More information

BIOINFORMATICS Introduction

BIOINFORMATICS Introduction BIOINFORMATICS Introduction Mark Gerstein, Yale University bioinfo.mbb.yale.edu/mbb452a 1 (c) Mark Gerstein, 1999, Yale, bioinfo.mbb.yale.edu What is Bioinformatics? (Molecular) Bio -informatics One idea

More information

Next-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX

Next-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX Next-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX Technical Overview Introduction RNA Sequencing (RNA-Seq) is one of the most commonly used next-generation sequencing (NGS)

More information

Course Descriptions. BIOL: Biology. MICB: Microbiology. [1]

Course Descriptions. BIOL: Biology. MICB: Microbiology.  [1] Course Descriptions BIOL: Biology http://www.calendar.ubc.ca/vancouver/courses.cfm?code=biol [1] BIOL 112 (3) Biology of the Cell The principles of cellular and molecular biology using bacterial and eukaryotic

More information

Presented by: Tess L. Crisostomo Laboratory Quality Assurance/Compliance Officer Naval Medical Center San Diego

Presented by: Tess L. Crisostomo Laboratory Quality Assurance/Compliance Officer Naval Medical Center San Diego Presented by: Tess L. Crisostomo Laboratory Quality Assurance/Compliance Officer Naval Medical Center San Diego Discuss the difference between DNA Genotyping and Genome Sequencing What makes you who you

More information

HiSeqTM 2000 Sequencing System

HiSeqTM 2000 Sequencing System IET International Equipment Trading Ltd. www.ietltd.com Proudly serving laboratories worldwide since 1979 CALL +847.913.0777 for Refurbished & Certified Lab Equipment HiSeqTM 2000 Sequencing System Performance

More information

2014 APHL Next Generation Sequencing (NGS) Survey

2014 APHL Next Generation Sequencing (NGS) Survey APHL would like you to complete the Next Generation Sequencing (NGS) in Public Health Laboratories Survey. The purpose of this survey is to collect information on current capacities for NGS testing and

More information

Introduction to NGS Technologies

Introduction to NGS Technologies Introduction to NGS Technologies Ignacio Medina imedina@ebi.ac.uk Project Manager & Senior Software Engineer at EBI Variation European Bioinformatics Institute (EMBL-EBI) European Molecular Biology Laboratory

More information

How much sequencing do I need? Emily Crisovan Genomics Core

How much sequencing do I need? Emily Crisovan Genomics Core How much sequencing do I need? Emily Crisovan Genomics Core How much sequencing? Three questions: 1. How much sequence is required for good experimental design? 2. What type of sequencing run is best?

More information

Genetics Lecture 21 Recombinant DNA

Genetics Lecture 21 Recombinant DNA Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of

More information

AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1

AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1 AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1 - Genetics: Progress from Mendel to DNA: Gregor Mendel, in the mid 19 th century provided the

More information

Targeted Sequencing Using Droplet-Based Microfluidics. Keith Brown Director, Sales

Targeted Sequencing Using Droplet-Based Microfluidics. Keith Brown Director, Sales Targeted Sequencing Using Droplet-Based Microfluidics Keith Brown Director, Sales brownk@raindancetech.com Who we are: is a Provider of Microdroplet-based Solutions The Company s RainStorm TM Technology

More information

Genomic Data Is Going Google. Ask Bigger Biological Questions

Genomic Data Is Going Google. Ask Bigger Biological Questions Genomic Data Is Going Google Ask Bigger Biological Questions You know your research could have a significant scientific impact and answer questions that may redefine how a disease is diagnosed or treated.

More information

SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM

SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM SNP GENOTYPING Accurate, sensitive, flexible MassARRAY System SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM Biomarker validation Routine genetic testing Somatic mutation profiling Up to 400

More information

Philippine e-science Grid. Initiatives

Philippine e-science Grid. Initiatives Ψ Initiatives Philippine e-science Grid Ren Gabas Advanced Science and Technology Institute Outline Current Researches Proposed Program Philippine e-science Grid Implementation of Projects Potential Beneficiaries

More information

Microbially Mediated Plant Salt Tolerance and Microbiome based Solutions for Saline Agriculture

Microbially Mediated Plant Salt Tolerance and Microbiome based Solutions for Saline Agriculture Microbially Mediated Plant Salt Tolerance and Microbiome based Solutions for Saline Agriculture Contents Introduction Abiotic Tolerance Approaches Reasons for failure Roots, microorganisms and soil-interaction

More information

Course Presentation. Ignacio Medina Presentation

Course Presentation. Ignacio Medina Presentation Course Index Introduction Agenda Analysis pipeline Some considerations Introduction Who we are Teachers: Marta Bleda: Computational Biologist and Data Analyst at Department of Medicine, Addenbrooke's Hospital

More information

BIOINFORMATICS IN AQUACULTURE. Aleksei Krasnov AKVAFORSK (Ås, Norway) Bergen, September 21, 2007

BIOINFORMATICS IN AQUACULTURE. Aleksei Krasnov AKVAFORSK (Ås, Norway) Bergen, September 21, 2007 BIOINFORMATICS IN AQUACULTURE Aleksei Krasnov AKVAFORSK (Ås, Norway) Bergen, September 21, 2007 Research area Functional genomics of salmonids Major in diseases, stress and toxicity Experience is in -

More information

Targeted Sequencing of Leukemia-Associated Genes Using 454 Sequencing Systems

Targeted Sequencing of Leukemia-Associated Genes Using 454 Sequencing Systems Sequencing Application Note March 2012 Targeted Sequencing of Leukemia-Associated Genes Using 454 Sequencing Systems GS GType TET2/CBL/KRAS and RUNX1 Primer Sets for the GS Junior and GS FLX Systems. Introduction

More information

Next Gen Sequencing. Expansion of sequencing technology. Contents

Next Gen Sequencing. Expansion of sequencing technology. Contents Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND

More information

USING HPC CLASS INFRASTRUCTURE FOR HIGH THROUGHPUT COMPUTING IN GENOMICS

USING HPC CLASS INFRASTRUCTURE FOR HIGH THROUGHPUT COMPUTING IN GENOMICS USING HPC CLASS INFRASTRUCTURE FOR HIGH THROUGHPUT COMPUTING IN GENOMICS Claude SCARPELLI Claude.Scarpelli@cea.fr FUNDAMENTAL RESEARCH DIVISION GENOMIC INSTITUTE Intel DDN Life Science Field Day Heidelberg,

More information

Network System Inference

Network System Inference Network System Inference Francis J. Doyle III University of California, Santa Barbara Douglas Lauffenburger Massachusetts Institute of Technology WTEC Systems Biology Final Workshop March 11, 2005 What

More information

Nordic Register and Biobank Data

Nordic Register and Biobank Data Nordic Register and Biobank Data A basis for innovative research on health and welfare Juni Palmgren Karolinska Institutet, Stockholm Nordic conference on Real World Data Helsinki November 2016 Nordic

More information

MICROBIO, IMMUN, PATHOLOGY-MIP (MIP)

MICROBIO, IMMUN, PATHOLOGY-MIP (MIP) Microbio, Immun, Pathology-MIP (MIP) 1 MICROBIO, IMMUN, PATHOLOGY-MIP (MIP) Courses MIP 101 Introduction to Human Disease (GT-SC2) Credits: 3 (3-0-0) Survey of human systems and diseases. Additional Information:

More information

Data Mining in Bioinformatics. Prof. André de Carvalho ICMC-Universidade de São Paulo

Data Mining in Bioinformatics. Prof. André de Carvalho ICMC-Universidade de São Paulo Data Mining in Bioinformatics Prof. André de Carvalho ICMC-Universidade de São Paulo Main topics Motivation Data Mining Prediction Bioinformatics Molecular Biology Using DM in Molecular Biology Case studies

More information

Microbiome Analysis in Kawasaki Disease. Kristine M. Wylie, Susan C. Baker, George M. Weinstock, Stanford T. Shulman, and Anne H.

Microbiome Analysis in Kawasaki Disease. Kristine M. Wylie, Susan C. Baker, George M. Weinstock, Stanford T. Shulman, and Anne H. Microbiome Analysis in Kawasaki Disease Kristine M. Wylie, Susan C. Baker, George M. Weinstock, Stanford T. Shulman, and Anne H. Rowley Disclosures Kristine M. Wylie Microbiome Analysis in Kawasaki Disease

More information

SURVEILLANCE AND LABORATORY DIAGNOSTICS OF INFECTIOUS DISEASES IN THE RUSSIAN FEDERATION I. DYATLOV

SURVEILLANCE AND LABORATORY DIAGNOSTICS OF INFECTIOUS DISEASES IN THE RUSSIAN FEDERATION I. DYATLOV SURVEILLANCE AND LABORATORY DIAGNOSTICS OF INFECTIOUS DISEASES IN THE RUSSIAN FEDERATION FEDERAL SERVICE OF SURVAILLANCE IN THE FIELD OF CONSUMER RIGHT PROTECTION & HUMAN WELFARE, RUSSIA I. DYATLOV Russia

More information

Next Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms

Next Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms Next Generation Sequencing Lecture Saarbrücken, 19. March 2012 Sequencing Platforms Contents Introduction Sequencing Workflow Platforms Roche 454 ABI SOLiD Illumina Genome Anlayzer / HiSeq Problems Quality

More information

Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, ; ; 330 PCR, ; 329.

Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, ; ; 330 PCR, ; 329. Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, 240-245; 286-87; 330 PCR, 270-274; 329. Take Home Lesson(s) from Lecture 2: 1. DNA is a double helix of complementary

More information

Bioinformatics Advice on Experimental Design

Bioinformatics Advice on Experimental Design Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics

More information

240EQ222 - Genetic Engineering

240EQ222 - Genetic Engineering Coordinating unit: Teaching unit: Academic year: Degree: ECTS credits: 2017 295 - EEBE - Barcelona East School of Engineering 713 - EQ - Department of Chemical Engineering MASTER'S DEGREE IN CHEMICAL ENGINEERING

More information

Expression Array System

Expression Array System Integrated Science for Gene Expression Applied Biosystems Expression Array System Expression Array System SEE MORE GENES The most complete, most sensitive system for whole genome expression analysis. The

More information

CMPS 3110 : Bioinformatics. High-Throughput Sequencing and Applications

CMPS 3110 : Bioinformatics. High-Throughput Sequencing and Applications CMPS 3110 : Bioinformatics High-Throughput Sequencing and Applications Sanger (1982) introduced chaintermination sequencing. Main idea: Obtain fragments of all possible lengths, ending in A, C, T, G. Using

More information

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen

More information

Access to Information from Molecular Biology and Genome Research

Access to Information from Molecular Biology and Genome Research Future Needs for Research Infrastructures in Biomedical Sciences Access to Information from Molecular Biology and Genome Research DG Research: Brussels March 2005 User Community for this information is

More information

Marie Skłodowska-Curie European Fellowship

Marie Skłodowska-Curie European Fellowship Marie Skłodowska-Curie European Fellowship Expression of Interest Application Form 2017 This form must be completed for Expressions of Interest (EoIs) to the Marie Skłodowska-Curie European Fellowship

More information

Next Generation Sequencing: An Overview

Next Generation Sequencing: An Overview Next Generation Sequencing: An Overview Cavan Reilly November 13, 2017 Table of contents Next generation sequencing NGS and microarrays Study design Quality assessment Burrows Wheeler transform Next generation

More information

HTCaaS: Leveraging Distributed Supercomputing Infrastructures for Large- Scale Scientific Computing

HTCaaS: Leveraging Distributed Supercomputing Infrastructures for Large- Scale Scientific Computing HTCaaS: Leveraging Distributed Supercomputing Infrastructures for Large- Scale Scientific Computing Jik-Soo Kim, Ph.D National Institute of Supercomputing and Networking(NISN) at KISTI Table of Contents

More information

Microbial Biotechnology agustin krisna wardani

Microbial Biotechnology agustin krisna wardani Microbial Biotechnology agustin krisna wardani 1. The Structure of Microbes Microbes (microorganisms) are tiny organisms that are too small to be seen individually by the naked eye and must be viewed with

More information

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how

More information

Marine Biotechnology and Aquaculture

Marine Biotechnology and Aquaculture Marine Biotechnology and Aquaculture The salmon aquaculture sector and new breeding technologies Ashie Norris. ERA-NET Marine biotechnology Oceans of opportunity! Seafood becoming more important in food

More information

NCBI web resources I: databases and Entrez

NCBI web resources I: databases and Entrez NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table

More information

TERTIARY MOTIF INTERACTIONS ON RNA STRUCTURE

TERTIARY MOTIF INTERACTIONS ON RNA STRUCTURE 1 TERTIARY MOTIF INTERACTIONS ON RNA STRUCTURE Bioinformatics Senior Project Wasay Hussain Spring 2009 Overview of RNA 2 The central Dogma of Molecular biology is DNA RNA Proteins The RNA (Ribonucleic

More information

GUIDANCE ON THE EVALUATION OF NON ACCREDITED QUALIFICATIONS

GUIDANCE ON THE EVALUATION OF NON ACCREDITED QUALIFICATIONS GUIDANCE ON THE EVALUATION OF NON ACCREDITED QUALIFICATIONS 1. Introduction 1.1 This document provides guidance notes for the assessment of academic qualifications that have not been formally accredited

More information

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s

More information

Single Cell Genomics (SCG): Market Size, Segmentation, Growth, Competition and Trends ( )

Single Cell Genomics (SCG): Market Size, Segmentation, Growth, Competition and Trends ( ) Single Cell Genomics (SCG): Market Size, Segmentation, Growth, Competition and Trends (2013-2021) May, 2017 3 rd Edition Information contained in this market report is believed to be reliable at the time

More information

Chapter 10 Analytical Biotechnology and the Human Genome

Chapter 10 Analytical Biotechnology and the Human Genome Chapter 10 Analytical Biotechnology and the Human Genome Chapter Outline Enzyme tests and biosensors DNA-based tests DNA analysis technologies Human genome and genome-based analytical methods 1 Enzyme-based

More information

ANSYS, Inc. March 12, ANSYS HPC Licensing Options - Release

ANSYS, Inc. March 12, ANSYS HPC Licensing Options - Release 1 2016 ANSYS, Inc. March 12, 2017 ANSYS HPC Licensing Options - Release 18.0 - 4 Main Products HPC (per-process) 10 instead of 8 in 1 st Pack at Release 18.0 and higher HPC Pack HPC product rewarding volume

More information

Bioinformatic tools for metagenomic data analysis

Bioinformatic tools for metagenomic data analysis Bioinformatic tools for metagenomic data analysis MEGAN - blast-based tool for exploring taxonomic content MG-RAST (SEED, FIG) - rapid annotation of metagenomic data, phylogenetic classification and metabolic

More information

Ion S5 and Ion S5 XL Systems

Ion S5 and Ion S5 XL Systems Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Introducing the Ion S5 and Ion S5 XL systems Now, adopting next-generation sequencing in your lab is simpler than ever. The Ion S5

More information