Bioinformatics and computational tools

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Bioinformatics and computational tools"

Transcription

1 Bioinformatics and computational tools Etienne P. de Villiers (PhD) International Livestock Research Institute Nairobi, Kenya

2 International Livestock Research Institute Nairobi, Kenya ILRI works at the crossroads of livestock and poverty, bringing high quality science and capacity building to bear on poverty reduction and sustainable development. It is one of 15 centers supported by the Consultative Group on International Agricultural Research (CGIAR) that conduct food and environmental research to help alleviate poverty and increase food security. ILRI biotech facilities: Molecular biology Laboratories (>6,000 sqm) State of the art biosciences equipment 2 ABI sequencers (3130, 3730) 1 Roche 454 GS FLX Bioinformatics unit 64 CPU high performance compute cluster BSL3 laboratory Flow cytometry and microscopy Diagnostics (nucleotide and protein based) Vaccine technology/immunology Small and Large Animal units

3 Central dogma of molecular biology

4 Bioinformatics Bioinformatics is the application of information technology and computer science to the field of molecular biology.

5 Bioinformatics Genome (DNA) sequence ACGGTGCGTAACGTCAGTCAGGTCAGTCAG Bioinformatics or computational biology Gene or protein properties Comparative analysis Protein structure and function prediction

6 The Sequencing Revolution Next Generation Sequencing High Throughput Sequencing 2000 High Throughput Sequencing sequences per hour 2.6 million sequences per hour

7 The Sequencing Revolution Third Generation Sequencing Single Molecule sequencing Pacific Biosciences Oxford Nanopore ~3,000 wells per chip 1,500 bp per well 10 bp per second $1,000 human genome

8 Sequencing the Human Genome 2001: Human Genome Project 3 billion $, 11 years : 454 1M$, 3 months Log 10 (price) : Celera 100 Million $ 3 years 2008: ABI SOLiD 60K$, 2 weeks 2009: Illumina 40-50K$ 2010: 5K$, a few days Year

9 Next Generation Sequencing Current Projects 1000 Genomes project ( Sequence genomes from 2500 people from divers backgrounds to 4x coverage to identify human genetic variation. Ensembl genomes ( 234 species sequenced from mammalians, birds to parasites. >400 bacterial species sequenced. Plant genomes 18 sequenced ( BGI (China) ( 1,000 plant and animal reference genome project.

10 Cost of Computing Intel icore7 desktop $1,000 GigaFLOPS Cray YMP $40,000, Sun HPC1000 $1,000,000 1

11 World Internet Connections

12 Cloud Computing Cloud computing is a general term for computation as aservice. Computation as a service means that customers rent the hardware and the storage only for the time needed to achieve their goals Amazon Elastic Compute Cloud (Amazon EC2) provides resizable compute capacity in the cloud including, High Performance computing (HPC) on demand 23 GB of memory 64 Compute nodes 1.7 Terabytes storage $1.60 per hour or $5,000 per year

13 Distributed computing Distributed computing is any computing that involves multiple computers remote from each other. A central server sends and receives the work units (essentially just protein structures and sequences). The client uses the spare CPU cycles on a user s computer to run the simulation algorithm on the assigned structure. Results are automatically returned and exchanged for a new work unit on a daily basis. home lab/office anywhere

14 Distributed computing Understand how existing proteins attain their specific, functional three dimensional structures. Use distributed computing through installation of screensaver on user computer. In 2009 was running on 40,000 CPUs or 5 PFLOPS Fastest standalone supercomputer is "Tianhe 1A at 2.5 PFLOPS

15 Metagenomics Metagenomics is the sequencing and analysis of DNA of organisms recovered from an environment, without the need for culturing them using next generation sequencing technologies. Organisms The Sargasso Sea community survey Acid mine drainage film Human gut communities Symbiotic community from marine worm AVID project

16 From Sequence (genomics/metagenomics) to impact phylogenetic analysis Diagnostics (meta)genome sequencing geographical mapping Global diseases surveillance Databases protein modeling Vaccine dvlpmt Compilation of complete genomes, metagenomes, annotation and curation of metadata Extraction of important biological information sequence variation analysis Primer, microarray discovery of new microorganisms and pathways Drug dvlpmt Improved drug selection Environmental sustainability Better control tools

17 AVID Arbovirus Incident & Diversity project Google.org Predict and Prevent funded project. Pilot project on Rift Valley Fever virus. virus is transmitted by mosquitoes and infect both animals and humans deadly to both humans and livestock outbreaks occur every 5 6 years A complex mix of species, sub species, populations. Can we understand its dynamics?

18 AVID Questions Where is the virus (between outbreaks )? Environment Vectors Reservoirs What is the diversity of? Virus Vector Reservoir And how do these interact? Distribution of other pathogens? Novel pathogens and variants? For example: Does a particular virus variant occur in a particular vector variant associated with a particular mammalian variant? Viral Geneflow

19 AVID Strategy Samples are collected in specific areas: Human blood, livestock, wildlife, mosquitoes, water, soil Each sample collected with a full meta data description (location, date/time, eco geo socio descriptors). Amplify sequences from multiple points on multiple possible genomes virus, insect, mammal, others. Sequence these amplicons simultaneously from 1,000s of samples using next generation sequencing. Analyse sequences look for distribution and co occurrence. Refine primers for a simple (RT) PCR approach. Move diagnostic sequences on to high throughput PCR diagnostics.

20

21 AVID Data management and BioBANK Data management is one of the biggest challenges. The project cannot achieve its goals without great data integration. All samples are biobanked with full data descriptors Opportunity to share samples across projects? Wildlife samples are very expensive and everyone is collecting them for their own purposes!!

22 Thank You

Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie. Sander van Boheemen Medical Microbiology

Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie. Sander van Boheemen Medical Microbiology Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie Sander van Boheemen Medical Microbiology Next-generation sequencing Next-generation sequencing (NGS), also known as

More information

Contact us for more information and a quotation

Contact us for more information and a quotation GenePool Information Sheet #1 Installed Sequencing Technologies in the GenePool The GenePool offers sequencing service on three platforms: Sanger (dideoxy) sequencing on ABI 3730 instruments Illumina SOLEXA

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

Human genome sequence

Human genome sequence NGS: the basics Human genome sequence June 26th 2000: official announcement of the completion of the draft of the human genome sequence (truly finished in 2004) Francis Collins Craig Venter HGP: 3 billion

More information

GMI: Global Microbial Identifier

GMI: Global Microbial Identifier GMI: Global Microbial Identifier The future of microbiology: Identification and Surveillance will merge through the use of Whole Genome Sequencing (WGS) Jørgen Schlundt Professor Technical University of

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a

More information

Genomics Market Share, Size, Analysis, Growth, Trends and Forecasts to 2024 Hexa Research

Genomics Market Share, Size, Analysis, Growth, Trends and Forecasts to 2024 Hexa Research Genomics Market Share, Size, Analysis, Growth, Trends and Forecasts to 2024 Hexa Research " Increasing usage of novel genomics techniques and tools, evaluation of their benefit to patient outcome and focusing

More information

Bridging the Science - Information Technology Gap

Bridging the Science - Information Technology Gap Bridging the Science - Information Technology Gap Presentation Outline Who is the Bioteam? Our HPC and Storage Expertise Our Data Management Solution WikiLIMS Discussion How can BioTeam serve Ignite? BioTeam

More information

Outline. General principles of clonal sequencing Analysis principles Applications CNV analysis Genome architecture

Outline. General principles of clonal sequencing Analysis principles Applications CNV analysis Genome architecture The use of new sequencing technologies for genome analysis Chris Mattocks National Genetics Reference Laboratory (Wessex) NGRL (Wessex) 2008 Outline General principles of clonal sequencing Analysis principles

More information

Applications of Next Generation Sequencing in Metagenomics Studies

Applications of Next Generation Sequencing in Metagenomics Studies Applications of Next Generation Sequencing in Metagenomics Studies Francesca Rizzo, PhD Genomix4life Laboratory of Molecular Medicine and Genomics Department of Medicine and Surgery University of Salerno

More information

resequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics

resequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics RNA Sequencing T TM variation genetics validation SNP ncrna metagenomics private trio de novo exome mendelian ChIP-seq RNA DNA bioinformatics custom target high-throughput resequencing storage ncrna comparative

More information

BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM)

BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM) BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM) PROGRAM TITLE DEGREE TITLE Master of Science Program in Bioinformatics and System Biology (International Program) Master of Science (Bioinformatics

More information

Engineering Genetic Circuits

Engineering Genetic Circuits Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art

More information

Overview of Health Informatics. ITI BMI-Dept

Overview of Health Informatics. ITI BMI-Dept Overview of Health Informatics ITI BMI-Dept Fellowship Week 5 Overview of Health Informatics ITI, BMI-Dept Day 10 7/5/2010 2 Agenda 1-Bioinformatics Definitions 2-System Biology 3-Bioinformatics vs Computational

More information

WELCOME. Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS)

WELCOME. Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS) WELCOME Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS) Director, UB Genomics and Bioinformatics Core (GBC) o o o o o o o o o o o o Grow

More information

Metagenomics of the Human Intestinal Tract

Metagenomics of the Human Intestinal Tract Metagenomics of the Human Intestinal Tract http://www.metahit.eu This presentation is licensed under the Creative Commons Attribution 3.0 Unported License available at http://creativecommons.org/licenses/by/3.0/

More information

China National Grid --- BioNode. Jun Wang Beijing Genomics Institute

China National Grid --- BioNode. Jun Wang Beijing Genomics Institute China National Grid --- BioNode Jun Wang Beijing Genomics Institute Core of life science and bio-tech: Getting, Mining, Applying the basic life information Old China meets New China? Sequencing, sequencing,

More information

Third Generation Sequencing

Third Generation Sequencing Third Generation Sequencing By Mohammad Hasan Samiee Aref Medical Genetics Laboratory of Dr. Zeinali History of DNA sequencing 1953 : Discovery of DNA structure by Watson and Crick 1973 : First sequence

More information

Next Generation Sequencing. Jeroen Van Houdt - Leuven 13/10/2017

Next Generation Sequencing. Jeroen Van Houdt - Leuven 13/10/2017 Next Generation Sequencing Jeroen Van Houdt - Leuven 13/10/2017 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977 A Maxam and W Gilbert "DNA seq by chemical degradation" F Sanger"DNA

More information

E2ES to Accelerate Next-Generation Genome Analysis in Clinical Research

E2ES to Accelerate Next-Generation Genome Analysis in Clinical Research www.hcltech.com E2ES to Accelerate Next-Generation Genome Analysis in Clinical Research whitepaper April 2015 TABLE OF CONTENTS Introduction 3 Challenges associated with NGS data analysis 3 HCL s NGS Solution

More information

Next Generation Bioinformatics on the Cloud

Next Generation Bioinformatics on the Cloud Next Generation Bioinformatics on the Cloud http://www.easygenomics.com Sifei He Director of BGI Cloud hesifei@genomics.cn Xing Xu, Ph.D Senior Product Manager EasyGenomics BGI xuxing@genomics.cn Contact

More information

Outline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information

Outline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information From to Systems Biology Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - What can we learn Limitations Integration of omics - In-class

More information

Next Generation Sequencing (NGS)

Next Generation Sequencing (NGS) Next Generation Sequencing (NGS) Fernando Alvarez Sección Biomatemática, Facultad de Ciencias, UdelaR 1 Uruguay Montevide o 3 TANGO World Champ 1930 1950 (Maraca 4 Next Generation Sequencing module Next

More information

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015 Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck

More information

Growing Needs for Practical Molecular Diagnostics: Indonesia s Preparedness for Current Trend

Growing Needs for Practical Molecular Diagnostics: Indonesia s Preparedness for Current Trend Growing Needs for Practical Molecular Diagnostics: Indonesia s Preparedness for Current Trend Dr. dr. Francisca Srioetami Tanoerahardjo, SpPK., MSi Essential Practical Molecular Diagnostics Seminar Hotel

More information

AUDREY FARBOS JEREMIE POSCHMANN PAUL O NEILL KONRAD PASZKIEWICZ KAREN MOORE

AUDREY FARBOS JEREMIE POSCHMANN PAUL O NEILL KONRAD PASZKIEWICZ KAREN MOORE We provide: AUDREY FARBOS JEREMIE POSCHMANN PAUL O NEILL KONRAD PASZKIEWICZ KAREN MOORE State of the art genomics and bioinformatics analysis Training in experimental techniques, analysis and modelling

More information

NOW GENERATION SEQUENCING. Monday, December 5, 11

NOW GENERATION SEQUENCING. Monday, December 5, 11 NOW GENERATION SEQUENCING 1 SEQUENCING TIMELINE 1953: Structure of DNA 1975: Sanger method for sequencing 1985: Human Genome Sequencing Project begins 1990s: Clinical sequencing begins 1998: NHGRI $1000

More information

Accelerate High Throughput Analysis for Genome Sequencing with GPU

Accelerate High Throughput Analysis for Genome Sequencing with GPU Accelerate High Throughput Analysis for Genome Sequencing with GPU ATIP - A*CRC Workshop on Accelerator Technologies in High Performance Computing May 7-10, 2012 Singapore BingQiang WANG, Head of Scalable

More information

Christoph Bock ICPerMed First Research Workshop Milano, 26 June 2017

Christoph Bock ICPerMed First Research Workshop Milano, 26 June 2017 New Tools for Personalized Medicine *Tools = Assays, Devices, Software Christoph Bock ICPerMed First Research Workshop Milano, 26 June 2017 http://epigenomics.cemm.oeaw.ac.at http://biomedical-sequencing.at

More information

Sequencing Theory. Brett E. Pickett, Ph.D. J. Craig Venter Institute

Sequencing Theory. Brett E. Pickett, Ph.D. J. Craig Venter Institute Sequencing Theory Brett E. Pickett, Ph.D. J. Craig Venter Institute Applications of Genomics and Bioinformatics to Infectious Diseases GABRIEL Network Agenda Sequencing Instruments Sanger Illumina Ion

More information

Next Generation Sequencing (NGS) Market Size, Growth and Trends ( )

Next Generation Sequencing (NGS) Market Size, Growth and Trends ( ) Next Generation Sequencing (NGS) Market Size, Growth and Trends (2014-2020) July, 2017 4 th edition Information contained in this market report is believed to be reliable at the time of publication. DeciBio

More information

Carl Woese. Used 16S rrna to developed a method to Identify any bacterium, and discovered a novel domain of life

Carl Woese. Used 16S rrna to developed a method to Identify any bacterium, and discovered a novel domain of life METAGENOMICS Carl Woese Used 16S rrna to developed a method to Identify any bacterium, and discovered a novel domain of life His amazing discovery, coupled with his solitary behaviour, made many contemporary

More information

CSC Assignment1SequencingReview- 1109_Su N_NEXT_GENERATION_SEQUENCING.docx By Anonymous. Similarity Index

CSC Assignment1SequencingReview- 1109_Su N_NEXT_GENERATION_SEQUENCING.docx By Anonymous. Similarity Index Page 1 of 6 Document Viewer TurnitinUK Originality Report Processed on: 05-Dec-20 10:49 AM GMT ID: 13 Word Count: 1587 Submitted: 1 CSC8313-201 - Assignment1SequencingReview- 1109_Su N_NEXT_GENERATION_SEQUENCING.docx

More information

MICROBIOTA: FROM MICROBIOME TO FUNCTIONS. Atelier «Outils et modèles d étude du microbiote Intestinal» LYONBIOPÔLE/CENS 17 Novembere 2014

MICROBIOTA: FROM MICROBIOME TO FUNCTIONS. Atelier «Outils et modèles d étude du microbiote Intestinal» LYONBIOPÔLE/CENS 17 Novembere 2014 MICROBIOTA: FROM MICROBIOME TO FUNCTIONS Atelier «Outils et modèles d étude du microbiote Intestinal» LYONBIOPÔLE/CENS 17 Novembere 2014 Artem Khlebnikov Microbiota The new frontier of biomedicine 2000,

More information

Real-Time PCR Workshop Gene Expression. Applications Absolute and Relative Quantitation

Real-Time PCR Workshop Gene Expression. Applications Absolute and Relative Quantitation Real-Time PCR Workshop Gene Expression Applications Absolute and Relative Quantitation Absolute Quantitation Easy to understand the data, difficult to develop/qualify the standards Relative Quantitation

More information

Opportunities offered by new sequencing technologies

Opportunities offered by new sequencing technologies Opportunities offered by new sequencing technologies Pierre Taberlet Laboratoire d'ecologie Alpine CNRS UMR 5553 Université Joseph Fourier, Grenoble, France Nature Biotechnology, October 2008: special

More information

Research school methods seminar Genomics and Transcriptomics

Research school methods seminar Genomics and Transcriptomics Research school methods seminar Genomics and Transcriptomics Stephan Klee 19.11.2014 2 3 4 5 Genetics, Genomics what are we talking about? Genetics and Genomics Study of genes Role of genes in inheritence

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio

More information

ACCELERATING GENOMIC ANALYSIS ON THE CLOUD. Enabling the PanCancer Analysis of Whole Genomes (PCAWG) consortia to analyze thousands of genomes

ACCELERATING GENOMIC ANALYSIS ON THE CLOUD. Enabling the PanCancer Analysis of Whole Genomes (PCAWG) consortia to analyze thousands of genomes ACCELERATING GENOMIC ANALYSIS ON THE CLOUD Enabling the PanCancer Analysis of Whole Genomes (PCAWG) consortia to analyze thousands of genomes Enabling the PanCancer Analysis of Whole Genomes (PCAWG) consortia

More information

From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow

From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with

More information

Welcome to the NGS webinar series

Welcome to the NGS webinar series Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic

More information

Analytics Behind Genomic Testing

Analytics Behind Genomic Testing A Quick Guide to the Analytics Behind Genomic Testing Elaine Gee, PhD Director, Bioinformatics ARUP Laboratories 1 Learning Objectives Catalogue various types of bioinformatics analyses that support clinical

More information

IMGM Laboratories GmbH. Sales Manager

IMGM Laboratories GmbH. Sales Manager IMGM Laboratories GmbH Dr. Jennifer K. Kuhn Sales Manager About IMGM Laboratories IMGM Laboratories was founded in 2001 IMGM operates as professional provider of advanced genomic services from research

More information

Next-Generation Sequencing. Technologies

Next-Generation Sequencing. Technologies Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062

More information

Genome Sequencing. I: Methods. MMG 835, SPRING 2016 Eukaryotic Molecular Genetics. George I. Mias

Genome Sequencing. I: Methods. MMG 835, SPRING 2016 Eukaryotic Molecular Genetics. George I. Mias Genome Sequencing I: Methods MMG 835, SPRING 2016 Eukaryotic Molecular Genetics George I. Mias Department of Biochemistry and Molecular Biology gmias@msu.edu Sequencing Methods Cost of Sequencing Wetterstrand

More information

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene

More information

ELIXIR: data for molecular biology and points of entry for marine scientists

ELIXIR: data for molecular biology and points of entry for marine scientists ELIXIR: data for molecular biology and points of entry for marine scientists Guy Cochrane, EMBL-EBI EuroMarine 2018 General Assembly meeting 17-18 January 2018 www.elixir-europe.org Scales of molecular

More information

Trans-omics for a better life

Trans-omics for a better life Trans-omics for a better life History From 1% to World Leading The largest genomic organization in the world Focus on research and applications in the healthcare, agriculture, conservation, and environmental

More information

DNA. bioinformatics. epigenetics methylation structural variation. custom. assembly. gene. tumor-normal. mendelian. BS-seq. prediction.

DNA. bioinformatics. epigenetics methylation structural variation. custom. assembly. gene. tumor-normal. mendelian. BS-seq. prediction. Epigenomics T TM activation SNP target ncrna validation metagenomics genetics private RRBS-seq de novo trio RIP-seq exome mendelian comparative genomics DNA NGS ChIP-seq bioinformatics assembly tumor-normal

More information

Lecture #1. Introduction to microarray technology

Lecture #1. Introduction to microarray technology Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing

More information

Bioinformatics: A perspective

Bioinformatics: A perspective Bioinformatics: A perspective Dr. Matthew L. Settles Genome Center University of California, Davis settles@ucdavis.edu Outline The World we are presented with Advances in DNA Sequencing Bioinformatics

More information

Molecular Biology: DNA sequencing

Molecular Biology: DNA sequencing Molecular Biology: DNA sequencing Author: Prof Marinda Oosthuizen Licensed under a Creative Commons Attribution license. SEQUENCING OF LARGE TEMPLATES As we have seen, we can obtain up to 800 nucleotides

More information

HRG Insight: IBM & Intel: Intelligent Choice for Life Sciences

HRG Insight: IBM & Intel: Intelligent Choice for Life Sciences HRG Insight: IBM & Intel: Intelligent Choice for Life Sciences IBM ex5 server technology significantly advances the state of Life Sciences research applications such as Bioinformatics, Genomic Research,

More information

NOTES - CH 15 (and 14.3): DNA Technology ( Biotech )

NOTES - CH 15 (and 14.3): DNA Technology ( Biotech ) NOTES - CH 15 (and 14.3): DNA Technology ( Biotech ) Vocabulary Genetic Engineering Gene Recombinant DNA Transgenic Restriction Enzymes Vectors Plasmids Cloning Key Concepts What is genetic engineering?

More information

Texas A&M AgriLife Research LOWER RIO GRANDE VALLEY REGION RESEARCH GOALS AND IMPACTS. Texas A&M AgriLife Research and Extension Center at Weslaco

Texas A&M AgriLife Research LOWER RIO GRANDE VALLEY REGION RESEARCH GOALS AND IMPACTS. Texas A&M AgriLife Research and Extension Center at Weslaco Texas A&M AgriLife Research LOWER RIO GRANDE VALLEY REGION RESEARCH GOALS AND IMPACTS Texas A&M AgriLife Research and Extension Center at Weslaco 2015 GOAL Protect water quality and increase the amount

More information

Next-Generation Sequencing Services à la carte

Next-Generation Sequencing Services à la carte Next-Generation Sequencing Services à la carte www.seqme.eu ngs@seqme.eu SEQme 2017 All rights reserved The trademarks and names of other companies and products mentioned in this brochure are the property

More information

Developing Tools for Rapid and Accurate Post-Sequencing Analysis of Foodborne Pathogens. Mitchell Holland, Noblis

Developing Tools for Rapid and Accurate Post-Sequencing Analysis of Foodborne Pathogens. Mitchell Holland, Noblis Developing Tools for Rapid and Accurate Post-Sequencing Analysis of Foodborne Pathogens Mitchell Holland, Noblis Agenda Introduction Whole Genome Sequencing Analysis Pipeline Sequence Alignment SNPs and

More information

2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes?

2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes? 2/5/16 DNA sequencing, Transcriptomics and Genomics Honeypot Ants "nequacatl" BY2208, Mani Lecture 3 Gene sequence changes? And/or gene expression changes? gene expression differences DNA sequencing, Transcriptomics

More information

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing

More information

B I O I N F O R M A T I C S

B I O I N F O R M A T I C S B I O I N F O R M A T I C S Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be SUPPLEMENTARY CHAPTER: DATA BASES AND MINING 1 What

More information

Genome Sequencing Technologies. Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall

Genome Sequencing Technologies. Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall Genome Sequencing Technologies Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall Sciences start with Observation Sciences start with Observation and flourish with

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Alla L Lapidus, Ph.D. SPbSU St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as "the study of

More information

Ultrasequencing: Methods and Applications of the New Generation Sequencing Platforms

Ultrasequencing: Methods and Applications of the New Generation Sequencing Platforms Ultrasequencing: Methods and Applications of the New Generation Sequencing Platforms Laura Moya Andérico Master in Advanced Genetics Genomics Class December 16 th, 2015 Brief Overview First-generation

More information

Polymerase Chain Reaction (PCR) and Its Applications

Polymerase Chain Reaction (PCR) and Its Applications Polymerase Chain Reaction (PCR) and Its Applications What is PCR? PCR is an exponentially progressing synthesis of the defined target DNA sequences in vitro. It was invented in 1983 by Dr. Kary Mullis,

More information

GENE EXPRESSION REAGENTS MARKETS (SAMPLE COPY, NOT FOR RESALE)

GENE EXPRESSION REAGENTS MARKETS (SAMPLE COPY, NOT FOR RESALE) TriMark Publications April 2007 Volume: TMRGER07-0401 GENE EXPRESSION REAGENTS MARKETS (SAMPLE COPY, NOT FOR RESALE) Trends, Industry Participants, Product Overviews and Market Drivers TABLE OF CONTENTS

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Dr. Taysir Hassan Abdel Hamid Lecturer, Information Systems Department Faculty of Computer and Information Assiut University taysirhs@aun.edu.eg taysir_soliman@hotmail.com

More information

European Technology Platform for Global Animal Health. Action Plan

European Technology Platform for Global Animal Health. Action Plan European Technology Platform for Global Animal Health Action Plan European Technology T Platform for Global Animal Health Action Plan 2 Table of contents Executive Summary 7 Chapter 1: The Action Plan

More information

Ion S5 and Ion S5 XL Systems

Ion S5 and Ion S5 XL Systems Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Explore the Ion S5 and Ion S5 XL Systems Adopting next-generation sequencing (NGS) in your lab is now simpler than ever The Ion S5

More information

Sanger vs Next-Gen Sequencing

Sanger vs Next-Gen Sequencing Tools and Algorithms in Bioinformatics GCBA815/MCGB815/BMI815, Fall 2017 Week-8: Next-Gen Sequencing RNA-seq Data Analysis Babu Guda, Ph.D. Professor, Genetics, Cell Biology & Anatomy Director, Bioinformatics

More information

JEMU call for proposals 2016

JEMU call for proposals 2016 JEMU call for proposals 2016 THE JOINT EXPERIMENTAL MOLECULAR UNIT (JEMU) Established in 2007 Royal Belgian Institute of Natural Sciences (RBINS) Royal Museum for Central Africa (RMCA) Mission: supporting

More information

Plasmodium vivax. (Guerra, 2006) (Winzeler, 2008)

Plasmodium vivax. (Guerra, 2006) (Winzeler, 2008) Plasmodium vivax Major cause of malaria outside Africa 25 40% of clinical cases worldwide Not amenable to in vitro culture Interesting biology Hypnozoites: dormant liver stage responsible for relapses

More information

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS

More information

Revolutionize Genomics with SMRT Sequencing. Single Molecule, Real-Time Technology

Revolutionize Genomics with SMRT Sequencing. Single Molecule, Real-Time Technology Revolutionize Genomics with SMRT Sequencing Single Molecule, Real-Time Technology Resolve to Master Complexity Despite large investments in population studies, the heritability of the majority of Mendelian

More information

New Programs in Quantitative Biology: Hunter College.

New Programs in Quantitative Biology: Hunter College. New Programs in Quantitative Biology: QuBi @ Hunter College What is QuBi? Quantitative Biology An initiative to join computational and quantitative disciplines to the analysis of biological data. Bioinformatics,

More information

Next Generation Sequencing. Simon Rasmussen Assistant Professor Center for Biological Sequence analysis Technical University of Denmark

Next Generation Sequencing. Simon Rasmussen Assistant Professor Center for Biological Sequence analysis Technical University of Denmark Next eneration Sequencing Simon Rasmussen Assistant Professor enter for Biological Sequence analysis Technical University of Denmark DNA Sequencing DNA sequencing Reading the order of bases in DNA fragments

More information

Analysis of Microarray Data

Analysis of Microarray Data Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review

More information

CSC 121 Computers and Scientific Thinking

CSC 121 Computers and Scientific Thinking CSC 121 Computers and Scientific Thinking Fall 2005 Computers in Biology and Bioinformatics 1 Biology biology is roughly defined as "the study of life" it is concerned with the characteristics and behaviors

More information

High Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday September 15, 2014

High Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday September 15, 2014 High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Monday September 15, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion

More information

The Integrated Biomedical Sciences Graduate Program

The Integrated Biomedical Sciences Graduate Program The Integrated Biomedical Sciences Graduate Program at the university of notre dame Cutting-edge biomedical research and training that transcends traditional departmental and disciplinary boundaries to

More information

Infectious Disease Omics

Infectious Disease Omics Infectious Disease Omics Metagenomics Ernest Diez Benavente LSHTM ernest.diezbenavente@lshtm.ac.uk Course outline What is metagenomics? In situ, culture-free genomic characterization of the taxonomic and

More information

Targeted Sequencing in the NBS Laboratory

Targeted Sequencing in the NBS Laboratory Targeted Sequencing in the NBS Laboratory Christopher Greene, PhD Newborn Screening and Molecular Biology Branch Division of Laboratory Sciences Gene Sequencing in Public Health Newborn Screening February

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics IMBB 2017 RAB, Kigali - Rwanda May 02 13, 2017 Joyce Nzioki Plan for the Week Introduction to Bioinformatics Raw sanger sequence data Introduction to CLC Bio Quality Control

More information

Introduction and Public Sequence Databases. BME 110/BIOL 181 CompBio Tools

Introduction and Public Sequence Databases. BME 110/BIOL 181 CompBio Tools Introduction and Public Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 29, 2011 Course Syllabus: Admin http://www.soe.ucsc.edu/classes/bme110/spring11 Reading: Chapters 1, 2 (pp.29-56),

More information

Impact of gdna Integrity on the Outcome of DNA Methylation Studies

Impact of gdna Integrity on the Outcome of DNA Methylation Studies Impact of gdna Integrity on the Outcome of DNA Methylation Studies Application Note Nucleic Acid Analysis Authors Emily Putnam, Keith Booher, and Xueguang Sun Zymo Research Corporation, Irvine, CA, USA

More information

Plant genome annotation using bioinformatics

Plant genome annotation using bioinformatics Plant genome annotation using bioinformatics ghorbani mandolakani Hossein, khodarahmi manouchehr darvish farrokh, taeb mohammad ghorbani24sma@yahoo.com islamic azad university of science and research branch

More information

Name: Ally Bonney. Date: January 29, 2015 February 24, Purpose

Name: Ally Bonney. Date: January 29, 2015 February 24, Purpose Name: Ally Bonney Title: Genome sequencing and annotation of Pseudomonas veronii isolated from Oregon State University soil and 16S rrna characterization of Corvallis, OR soil microbial populations Date:

More information

Algorithms in Bioinformatics

Algorithms in Bioinformatics Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline Central Dogma of Molecular

More information

BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)

BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) BIOLOGY 207 - Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) Required readings and problems: Reading: Open Genetics, Chapter 8.1 Problems: Chapter 8 Optional Griffiths (2008) 9

More information

BIOINFORMATICS Introduction

BIOINFORMATICS Introduction BIOINFORMATICS Introduction Mark Gerstein, Yale University bioinfo.mbb.yale.edu/mbb452a 1 (c) Mark Gerstein, 1999, Yale, bioinfo.mbb.yale.edu What is Bioinformatics? (Molecular) Bio -informatics One idea

More information

VECTOR CONTROL. Ms MA Groepe

VECTOR CONTROL. Ms MA Groepe VECTOR CONTROL Ms MA Groepe OUTLINE Introduction What is a vector? Type of vectors Vector borne diseases Vector control strategies Surveillance, monitoring vectors Role of the entomologist Integrated vector

More information

Next-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX

Next-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX Next-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX Technical Overview Introduction RNA Sequencing (RNA-Seq) is one of the most commonly used next-generation sequencing (NGS)

More information

Microarray Technique. Some background. M. Nath

Microarray Technique. Some background. M. Nath Microarray Technique Some background M. Nath Outline Introduction Spotting Array Technique GeneChip Technique Data analysis Applications Conclusion Now Blind Guess? Functional Pathway Microarray Technique

More information

High Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014

High Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014 High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion

More information

Lecture 1. Bioinformatics 2. About me... The class (2009) Course Outcomes. What do I think you know?

Lecture 1. Bioinformatics 2. About me... The class (2009) Course Outcomes. What do I think you know? Lecture 1 Bioinformatics 2 Introduction Course Overview & Assessment Introduction to Bioinformatics Research Careers and PhD options Core topics in Bioinformatics the central dogma of molecular biology

More information

Bioinformatics 2. Lecture 1

Bioinformatics 2. Lecture 1 Bioinformatics 2 Introduction Lecture 1 Course Overview & Assessment Introduction to Bioinformatics Research Careers and PhD options Core topics in Bioinformatics the central dogma of molecular biology

More information

Presented by: Tess L. Crisostomo Laboratory Quality Assurance/Compliance Officer Naval Medical Center San Diego

Presented by: Tess L. Crisostomo Laboratory Quality Assurance/Compliance Officer Naval Medical Center San Diego Presented by: Tess L. Crisostomo Laboratory Quality Assurance/Compliance Officer Naval Medical Center San Diego Discuss the difference between DNA Genotyping and Genome Sequencing What makes you who you

More information

2014 APHL Next Generation Sequencing (NGS) Survey

2014 APHL Next Generation Sequencing (NGS) Survey APHL would like you to complete the Next Generation Sequencing (NGS) in Public Health Laboratories Survey. The purpose of this survey is to collect information on current capacities for NGS testing and

More information

HiSeqTM 2000 Sequencing System

HiSeqTM 2000 Sequencing System IET International Equipment Trading Ltd. www.ietltd.com Proudly serving laboratories worldwide since 1979 CALL +847.913.0777 for Refurbished & Certified Lab Equipment HiSeqTM 2000 Sequencing System Performance

More information