Bioinformatics and computational tools

Size: px
Start display at page:

Download "Bioinformatics and computational tools"

Transcription

1 Bioinformatics and computational tools Etienne P. de Villiers (PhD) International Livestock Research Institute Nairobi, Kenya

2 International Livestock Research Institute Nairobi, Kenya ILRI works at the crossroads of livestock and poverty, bringing high quality science and capacity building to bear on poverty reduction and sustainable development. It is one of 15 centers supported by the Consultative Group on International Agricultural Research (CGIAR) that conduct food and environmental research to help alleviate poverty and increase food security. ILRI biotech facilities: Molecular biology Laboratories (>6,000 sqm) State of the art biosciences equipment 2 ABI sequencers (3130, 3730) 1 Roche 454 GS FLX Bioinformatics unit 64 CPU high performance compute cluster BSL3 laboratory Flow cytometry and microscopy Diagnostics (nucleotide and protein based) Vaccine technology/immunology Small and Large Animal units

3 Central dogma of molecular biology

4 Bioinformatics Bioinformatics is the application of information technology and computer science to the field of molecular biology.

5 Bioinformatics Genome (DNA) sequence ACGGTGCGTAACGTCAGTCAGGTCAGTCAG Bioinformatics or computational biology Gene or protein properties Comparative analysis Protein structure and function prediction

6 The Sequencing Revolution Next Generation Sequencing High Throughput Sequencing 2000 High Throughput Sequencing sequences per hour 2.6 million sequences per hour

7 The Sequencing Revolution Third Generation Sequencing Single Molecule sequencing Pacific Biosciences Oxford Nanopore ~3,000 wells per chip 1,500 bp per well 10 bp per second $1,000 human genome

8 Sequencing the Human Genome 2001: Human Genome Project 3 billion $, 11 years : 454 1M$, 3 months Log 10 (price) : Celera 100 Million $ 3 years 2008: ABI SOLiD 60K$, 2 weeks 2009: Illumina 40-50K$ 2010: 5K$, a few days Year

9 Next Generation Sequencing Current Projects 1000 Genomes project ( Sequence genomes from 2500 people from divers backgrounds to 4x coverage to identify human genetic variation. Ensembl genomes ( 234 species sequenced from mammalians, birds to parasites. >400 bacterial species sequenced. Plant genomes 18 sequenced ( BGI (China) ( 1,000 plant and animal reference genome project.

10 Cost of Computing Intel icore7 desktop $1,000 GigaFLOPS Cray YMP $40,000, Sun HPC1000 $1,000,000 1

11 World Internet Connections

12 Cloud Computing Cloud computing is a general term for computation as aservice. Computation as a service means that customers rent the hardware and the storage only for the time needed to achieve their goals Amazon Elastic Compute Cloud (Amazon EC2) provides resizable compute capacity in the cloud including, High Performance computing (HPC) on demand 23 GB of memory 64 Compute nodes 1.7 Terabytes storage $1.60 per hour or $5,000 per year

13 Distributed computing Distributed computing is any computing that involves multiple computers remote from each other. A central server sends and receives the work units (essentially just protein structures and sequences). The client uses the spare CPU cycles on a user s computer to run the simulation algorithm on the assigned structure. Results are automatically returned and exchanged for a new work unit on a daily basis. home lab/office anywhere

14 Distributed computing Understand how existing proteins attain their specific, functional three dimensional structures. Use distributed computing through installation of screensaver on user computer. In 2009 was running on 40,000 CPUs or 5 PFLOPS Fastest standalone supercomputer is "Tianhe 1A at 2.5 PFLOPS

15 Metagenomics Metagenomics is the sequencing and analysis of DNA of organisms recovered from an environment, without the need for culturing them using next generation sequencing technologies. Organisms The Sargasso Sea community survey Acid mine drainage film Human gut communities Symbiotic community from marine worm AVID project

16 From Sequence (genomics/metagenomics) to impact phylogenetic analysis Diagnostics (meta)genome sequencing geographical mapping Global diseases surveillance Databases protein modeling Vaccine dvlpmt Compilation of complete genomes, metagenomes, annotation and curation of metadata Extraction of important biological information sequence variation analysis Primer, microarray discovery of new microorganisms and pathways Drug dvlpmt Improved drug selection Environmental sustainability Better control tools

17 AVID Arbovirus Incident & Diversity project Google.org Predict and Prevent funded project. Pilot project on Rift Valley Fever virus. virus is transmitted by mosquitoes and infect both animals and humans deadly to both humans and livestock outbreaks occur every 5 6 years A complex mix of species, sub species, populations. Can we understand its dynamics?

18 AVID Questions Where is the virus (between outbreaks )? Environment Vectors Reservoirs What is the diversity of? Virus Vector Reservoir And how do these interact? Distribution of other pathogens? Novel pathogens and variants? For example: Does a particular virus variant occur in a particular vector variant associated with a particular mammalian variant? Viral Geneflow

19 AVID Strategy Samples are collected in specific areas: Human blood, livestock, wildlife, mosquitoes, water, soil Each sample collected with a full meta data description (location, date/time, eco geo socio descriptors). Amplify sequences from multiple points on multiple possible genomes virus, insect, mammal, others. Sequence these amplicons simultaneously from 1,000s of samples using next generation sequencing. Analyse sequences look for distribution and co occurrence. Refine primers for a simple (RT) PCR approach. Move diagnostic sequences on to high throughput PCR diagnostics.

20

21 AVID Data management and BioBANK Data management is one of the biggest challenges. The project cannot achieve its goals without great data integration. All samples are biobanked with full data descriptors Opportunity to share samples across projects? Wildlife samples are very expensive and everyone is collecting them for their own purposes!!

22 Thank You

Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie. Sander van Boheemen Medical Microbiology

Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie. Sander van Boheemen Medical Microbiology Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie Sander van Boheemen Medical Microbiology Next-generation sequencing Next-generation sequencing (NGS), also known as

More information

LARGE DATA AND BIOMEDICAL COMPUTATIONAL PIPELINES FOR COMPLEX DISEASES

LARGE DATA AND BIOMEDICAL COMPUTATIONAL PIPELINES FOR COMPLEX DISEASES 1 LARGE DATA AND BIOMEDICAL COMPUTATIONAL PIPELINES FOR COMPLEX DISEASES Ezekiel Adebiyi, PhD Professor and Head, Covenant University Bioinformatics Research and CU NIH H3AbioNet node Covenant University,

More information

Using New ThiNGS on Small Things. Shane Byrne

Using New ThiNGS on Small Things. Shane Byrne Using New ThiNGS on Small Things Shane Byrne Next Generation Sequencing New Things Small Things NGS Next Generation Sequencing = 2 nd generation of sequencing 454 GS FLX, SOLiD, GAIIx, HiSeq, MiSeq, Ion

More information

FUTURE PROSPECTS IN MOLECULAR INFECTIOUS DISEASES DIAGNOSIS

FUTURE PROSPECTS IN MOLECULAR INFECTIOUS DISEASES DIAGNOSIS FUTURE PROSPECTS IN MOLECULAR INFECTIOUS DISEASES DIAGNOSIS Richard L. Hodinka, Ph.D. University of South Carolina School of Medicine Greenville Greenville Health System, Greenville, SC hodinka@greenvillemed.sc.edu

More information

Next generation sequencing techniques" Toma Tebaldi Centre for Integrative Biology University of Trento

Next generation sequencing techniques Toma Tebaldi Centre for Integrative Biology University of Trento Next generation sequencing techniques" Toma Tebaldi Centre for Integrative Biology University of Trento Mattarello September 28, 2009 Sequencing Fundamental task in modern biology read the information

More information

Next Generation Sequencing. Tobias Österlund

Next Generation Sequencing. Tobias Österlund Next Generation Sequencing Tobias Österlund tobiaso@chalmers.se NGS part of the course Week 4 Friday 13/2 15.15-17.00 NGS lecture 1: Introduction to NGS, alignment, assembly Week 6 Thursday 26/2 08.00-09.45

More information

High peformance computing infrastructure for bioinformatics

High peformance computing infrastructure for bioinformatics High peformance computing infrastructure for bioinformatics Scott Hazelhurst University of the Witwatersrand December 2009 What we need Skills, time What we need Skills, time Fast network Lots of storage

More information

The Journey of DNA Sequencing. Chromosomes. What is a genome? Genome size. H. Sunny Sun

The Journey of DNA Sequencing. Chromosomes. What is a genome? Genome size. H. Sunny Sun The Journey of DNA Sequencing H. Sunny Sun What is a genome? Genome is the total genetic complement of a living organism. The nuclear genome comprises approximately 3.2 * 10 9 nucleotides of DNA, divided

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru

More information

From Lab Bench to Supercomputer: Advanced Life Sciences Computing. John Fonner, PhD Life Sciences Computing

From Lab Bench to Supercomputer: Advanced Life Sciences Computing. John Fonner, PhD Life Sciences Computing From Lab Bench to Supercomputer: Advanced Life Sciences Computing John Fonner, PhD Life Sciences Computing A Decade s Progress in DNA Sequencing 2003: ABI 3730 Sequencer Human Genome: $2.7 Billion, 13

More information

Day 3. Examine gels from PCR. Learn about more molecular methods in microbial ecology

Day 3. Examine gels from PCR. Learn about more molecular methods in microbial ecology Day 3 Examine gels from PCR Learn about more molecular methods in microbial ecology Genes We Targeted 1: dsrab 1800bp 2: mcra 750bp 3: Bacteria 1450bp 4: Archaea 950bp 5: Archaea + 950bp 6: Negative control

More information

Contact us for more information and a quotation

Contact us for more information and a quotation GenePool Information Sheet #1 Installed Sequencing Technologies in the GenePool The GenePool offers sequencing service on three platforms: Sanger (dideoxy) sequencing on ABI 3730 instruments Illumina SOLEXA

More information

What is Bioinformatics?

What is Bioinformatics? What is Bioinformatics? Bioinformatics is the field of science in which biology, computer science, and information technology merge to form a single discipline. - NCBI The ultimate goal of the field is

More information

Introduction to NGS. Josef K Vogt Slides by: Simon Rasmussen Next Generation Sequencing Analysis

Introduction to NGS. Josef K Vogt Slides by: Simon Rasmussen Next Generation Sequencing Analysis Introduction to NGS Josef K Vogt Slides by: Simon Rasmussen 2017 Life science data deluge Massive unstructured data from several areas DNA, patient journals, proteomics, imaging,... Impacts Industry, Environment,

More information

Capabilities & Services

Capabilities & Services Capabilities & Services Accelerating Research & Development Table of Contents Introduction to DHMRI 3 Services and Capabilites: Genomics 4 Proteomics & Protein Characterization 5 Metabolomics 6 In Vitro

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

CBC Data Therapy. Metagenomics Discussion

CBC Data Therapy. Metagenomics Discussion CBC Data Therapy Metagenomics Discussion General Workflow Microbial sample Generate Metaomic data Process data (QC, etc.) Analysis Marker Genes Extract DNA Amplify with targeted primers Filter errors,

More information

TREE CODE PRODUCT BROCHURE

TREE CODE PRODUCT BROCHURE TREE CODE PRODUCT BROCHURE Single Molecule, Real-Time (SMRT) Sequencing technology offers: Long read sequencing ~10 Gb with 20 kb average read lengths for WGS ~20 Gb with 40 kb average read length for

More information

NGS technologies: a user s guide. Karim Gharbi & Mark Blaxter

NGS technologies: a user s guide. Karim Gharbi & Mark Blaxter NGS technologies: a user s guide Karim Gharbi & Mark Blaxter genepool-manager@ed.ac.uk Natural history of sequencing 2 Brief history of sequencing 100s bp throughput 100 Gb 1977 1986 1995 1999 2005 2007

More information

Human genome sequence

Human genome sequence NGS: the basics Human genome sequence June 26th 2000: official announcement of the completion of the draft of the human genome sequence (truly finished in 2004) Francis Collins Craig Venter HGP: 3 billion

More information

GMI: Global Microbial Identifier

GMI: Global Microbial Identifier GMI: Global Microbial Identifier The future of microbiology: Identification and Surveillance will merge through the use of Whole Genome Sequencing (WGS) Jørgen Schlundt Professor Technical University of

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/

More information

Introduction to NGS. Simon Rasmussen Associate Professor DTU Bioinformatics Technical University of Denmark 2018

Introduction to NGS. Simon Rasmussen Associate Professor DTU Bioinformatics Technical University of Denmark 2018 Introduction to NGS Simon Rasmussen Associate Professor DTU Bioinformatics Technical University of Denmark 2018 Life science data deluge Massive unstructured data from several areas DNA, patient journals,

More information

Understanding the science and technology of whole genome sequencing

Understanding the science and technology of whole genome sequencing Understanding the science and technology of whole genome sequencing Dag Undlien Department of Medical Genetics Oslo University Hospital University of Oslo and The Norwegian Sequencing Centre d.e.undlien@medisin.uio.no

More information

SPO GRANTS (2001) PHASES

SPO GRANTS (2001) PHASES 2002 SPO GRANTS (2001) PHASES MAIN PHASES Legal organisation of the Institute of Biotechnology Ankara University Biotechnology Labs Organisation of Central Lab of the Institute of Biotechnology/ Purchase

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Vocabulary Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 Gene: Genetics: Genome: Genomics: hereditary

More information

MicroSEQ TM ID Rapid Microbial Identification System:

MicroSEQ TM ID Rapid Microbial Identification System: MicroSEQ TM ID Rapid Microbial Identification System: the complete solution for reliable genotypic microbial identification 1 The world leader in serving science Rapid molecular methods for pharmaceutical

More information

Outline. General principles of clonal sequencing Analysis principles Applications CNV analysis Genome architecture

Outline. General principles of clonal sequencing Analysis principles Applications CNV analysis Genome architecture The use of new sequencing technologies for genome analysis Chris Mattocks National Genetics Reference Laboratory (Wessex) NGRL (Wessex) 2008 Outline General principles of clonal sequencing Analysis principles

More information

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005 Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of

More information

Computational Challenges of Medical Genomics

Computational Challenges of Medical Genomics Talk at the VSC User Workshop Neusiedl am See, 27 February 2012 [cbock@cemm.oeaw.ac.at] http://medical-epigenomics.org (lab) http://www.cemm.oeaw.ac.at (institute) Introducing myself to Vienna s scientific

More information

Engineering Genetic Circuits

Engineering Genetic Circuits Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art

More information

Aaron Liston, Oregon State University Botany 2012 Intro to Next Generation Sequencing Workshop

Aaron Liston, Oregon State University Botany 2012 Intro to Next Generation Sequencing Workshop Output (bp) Aaron Liston, Oregon State University Growth in Next-Gen Sequencing Capacity 3.5E+11 2002 2004 2006 2008 2010 3.0E+11 2.5E+11 2.0E+11 1.5E+11 1.0E+11 Adapted from Mardis, 2011, Nature 5.0E+10

More information

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology. G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic

More information

Genomics Market Share, Size, Analysis, Growth, Trends and Forecasts to 2024 Hexa Research

Genomics Market Share, Size, Analysis, Growth, Trends and Forecasts to 2024 Hexa Research Genomics Market Share, Size, Analysis, Growth, Trends and Forecasts to 2024 Hexa Research " Increasing usage of novel genomics techniques and tools, evaluation of their benefit to patient outcome and focusing

More information

Introduction to 'Omics and Bioinformatics

Introduction to 'Omics and Bioinformatics Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current

More information

resequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics

resequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics RNA Sequencing T TM variation genetics validation SNP ncrna metagenomics private trio de novo exome mendelian ChIP-seq RNA DNA bioinformatics custom target high-throughput resequencing storage ncrna comparative

More information

Applications of Next Generation Sequencing in Metagenomics Studies

Applications of Next Generation Sequencing in Metagenomics Studies Applications of Next Generation Sequencing in Metagenomics Studies Francesca Rizzo, PhD Genomix4life Laboratory of Molecular Medicine and Genomics Department of Medicine and Surgery University of Salerno

More information

Grand Challenges in Computational Biology

Grand Challenges in Computational Biology Grand Challenges in Computational Biology Kimmen Sjölander UC Berkeley Reconstructing the Tree of Life CITRIS-INRIA workshop 24 May, 2011 Prediction of biological pathways and networks Human microbiome

More information

Overview of Health Informatics. ITI BMI-Dept

Overview of Health Informatics. ITI BMI-Dept Overview of Health Informatics ITI BMI-Dept Fellowship Week 5 Overview of Health Informatics ITI, BMI-Dept Day 10 7/5/2010 2 Agenda 1-Bioinformatics Definitions 2-System Biology 3-Bioinformatics vs Computational

More information

Metagenomics of the Human Intestinal Tract

Metagenomics of the Human Intestinal Tract Metagenomics of the Human Intestinal Tract http://www.metahit.eu This presentation is licensed under the Creative Commons Attribution 3.0 Unported License available at http://creativecommons.org/licenses/by/3.0/

More information

BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM)

BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM) BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM) PROGRAM TITLE DEGREE TITLE Master of Science Program in Bioinformatics and System Biology (International Program) Master of Science (Bioinformatics

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map

More information

ngs metagenomics target variation amplicon bioinformatics diagnostics dna trio indel high-throughput gene structural variation ChIP-seq mendelian

ngs metagenomics target variation amplicon bioinformatics diagnostics dna trio indel high-throughput gene structural variation ChIP-seq mendelian Metagenomics T TM storage genetics assembly ncrna custom genotyping RNA-seq de novo mendelian ChIP-seq exome genomics indel ngs trio prediction metagenomics SNP resequencing bioinformatics diagnostics

More information

WELCOME. Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS)

WELCOME. Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS) WELCOME Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS) Director, UB Genomics and Bioinformatics Core (GBC) o o o o o o o o o o o o Grow

More information

China National Grid --- BioNode. Jun Wang Beijing Genomics Institute

China National Grid --- BioNode. Jun Wang Beijing Genomics Institute China National Grid --- BioNode Jun Wang Beijing Genomics Institute Core of life science and bio-tech: Getting, Mining, Applying the basic life information Old China meets New China? Sequencing, sequencing,

More information

DNA Sequencing and Assembly

DNA Sequencing and Assembly DNA Sequencing and Assembly CS 262 Lecture Notes, Winter 2016 February 2nd, 2016 Scribe: Mark Berger Abstract In this lecture, we survey a variety of different sequencing technologies, including their

More information

Whole Genome Sequencing for food safety FSA Chief Scientific Advisor Report and 2013 Listeria pilot study

Whole Genome Sequencing for food safety FSA Chief Scientific Advisor Report and 2013 Listeria pilot study Whole Genome Sequencing for food safety FSA Chief Scientific Advisor Report and 2013 Listeria pilot study Dr Edward Hayes Date: July 2016, Version 1 Foodborne Pathogens 280,000 cases of Campylobacter,

More information

Overview of Next Generation Sequencing technologies. Céline Keime

Overview of Next Generation Sequencing technologies. Céline Keime Overview of Next Generation Sequencing technologies Céline Keime keime@igbmc.fr Next Generation Sequencing < Second generation sequencing < General principle < Sequencing by synthesis - Illumina < Sequencing

More information

MARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305

MARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305 MARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305 UNIT-1 MARINE GENOMICS AND PROTEOMICS 1. Define genomics? 2. Scope and functional genomics? 3. What is Genetics? 4. Define functional genomics? 5. What

More information

Achievement Level Descriptors for Medical Interventions

Achievement Level Descriptors for Medical Interventions Achievement Level Descriptors for Medical Interventions Achievement Level Descriptors (ALDs) are statements of what students should know and be able to do in a PLTW classroom. The ALDs can be used to better

More information

Third Generation Sequencing

Third Generation Sequencing Third Generation Sequencing By Mohammad Hasan Samiee Aref Medical Genetics Laboratory of Dr. Zeinali History of DNA sequencing 1953 : Discovery of DNA structure by Watson and Crick 1973 : First sequence

More information

DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.

DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel. DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private

More information

Climate change impacts on animal health and vector borne diseases

Climate change impacts on animal health and vector borne diseases Climate change impacts on animal health and vector borne diseases Bernard Bett and Delia Grace International Livestock Research Institute USAID Climate Change Technical Officers Meeting Windsor Golf Hotel,

More information

TECHNIQUES FOR STUDYING METAGENOME DATASETS METAGENOMES TO SYSTEMS.

TECHNIQUES FOR STUDYING METAGENOME DATASETS METAGENOMES TO SYSTEMS. TECHNIQUES FOR STUDYING METAGENOME DATASETS METAGENOMES TO SYSTEMS. Ian Jeffery I.Jeffery@ucc.ie What is metagenomics Metagenomics is the study of genetic material recovered directly from environmental

More information

Bridging the Science - Information Technology Gap

Bridging the Science - Information Technology Gap Bridging the Science - Information Technology Gap Presentation Outline Who is the Bioteam? Our HPC and Storage Expertise Our Data Management Solution WikiLIMS Discussion How can BioTeam serve Ignite? BioTeam

More information

Fun GCAT (Functional Genomic and Computational Assessment of Threats)

Fun GCAT (Functional Genomic and Computational Assessment of Threats) Fun GCAT (Functional Genomic and Computational Assessment of Threats) John Julias, Ph.D. Program Manager Intelligence Advanced Research Projects Activity (IARPA) Fun GCAT seeks to significantly advance

More information

Next Generation Sequencing. Jeroen Van Houdt - Leuven 13/10/2017

Next Generation Sequencing. Jeroen Van Houdt - Leuven 13/10/2017 Next Generation Sequencing Jeroen Van Houdt - Leuven 13/10/2017 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977 A Maxam and W Gilbert "DNA seq by chemical degradation" F Sanger"DNA

More information

Next Generation Bioinformatics on the Cloud

Next Generation Bioinformatics on the Cloud Next Generation Bioinformatics on the Cloud http://www.easygenomics.com Sifei He Director of BGI Cloud hesifei@genomics.cn Xing Xu, Ph.D Senior Product Manager EasyGenomics BGI xuxing@genomics.cn Contact

More information

Matthew Tinning Australian Genome Research Facility. July 2012

Matthew Tinning Australian Genome Research Facility. July 2012 Next-Generation Sequencing: an overview of technologies and applications Matthew Tinning Australian Genome Research Facility July 2012 History of Sequencing Where have we been? 1869 Discovery of DNA 1909

More information

Outline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information

Outline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information From to Systems Biology Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - What can we learn Limitations Integration of omics - In-class

More information

The Computational Impact of Genomics on Biotechnology R&D (sort of )

The Computational Impact of Genomics on Biotechnology R&D (sort of ) The Computational Impact of Genomics on Biotechnology R&D (sort of ) John Scooter Morris, Ph.D. Genentech, Inc. November 13, 2001 page 1 Biotechnology? Means many things to many people Genomics Gene therapy

More information

ILLUMINA SEQUENCING SYSTEMS

ILLUMINA SEQUENCING SYSTEMS ILLUMINA SEQUENCING SYSTEMS PROVEN QUALITY. TRUSTED SOLUTIONS. Every day, researchers are using Illumina next-generation sequencing (NGS) systems to better understand human health and disease, as well

More information

Supplementary Figure 1. Design of the control microarray. a, Genomic DNA from the

Supplementary Figure 1. Design of the control microarray. a, Genomic DNA from the Supplementary Information Supplementary Figures Supplementary Figure 1. Design of the control microarray. a, Genomic DNA from the strain M8 of S. ruber and a fosmid containing the S. ruber M8 virus M8CR4

More information

High-Performance Computing (HPC) Up-close

High-Performance Computing (HPC) Up-close High-Performance Computing (HPC) Up-close What It Can Do For You In this InfoBrief, we examine what High-Performance Computing is, how industry is benefiting, why it equips business for the future, what

More information

Bioinformatics: A perspective

Bioinformatics: A perspective Bioinformatics: A perspective Dr. Matthew L. Settles Genome Center University of California, Davis settles@ucdavis.edu Outline Advances in DNA Sequencing The World we are presented with Bioinformatics

More information

21.5 The "Omics" Revolution Has Created a New Era of Biological Research

21.5 The Omics Revolution Has Created a New Era of Biological Research 21.5 The "Omics" Revolution Has Created a New Era of Biological Research 1 Section 21.5 Areas of biological research having an "omics" connection are continually developing These include proteomics, metabolomics,

More information

Short summary of the main features

Short summary of the main features Michael, D., and Yarden, A. (2007). Genetic engineering: from principles and methods to research and applications (A student text, and an internet site http://stwww.weizmann.ac.il/g-bio/geneengine/animations.html,

More information

Carl Woese. Used 16S rrna to develop a method to Identify any bacterium, and discovered a novel domain of life

Carl Woese. Used 16S rrna to develop a method to Identify any bacterium, and discovered a novel domain of life METAGENOMICS Carl Woese Used 16S rrna to develop a method to Identify any bacterium, and discovered a novel domain of life His amazing discovery, coupled with his solitary behaviour, made many contemporary

More information

Next Generation Sequencing (NGS)

Next Generation Sequencing (NGS) Next Generation Sequencing (NGS) Fernando Alvarez Sección Biomatemática, Facultad de Ciencias, UdelaR 1 Uruguay Montevide o 3 TANGO World Champ 1930 1950 (Maraca 4 Next Generation Sequencing module Next

More information

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015 Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck

More information

Could modern methods of genetics improve the disease resistance in farm animals?

Could modern methods of genetics improve the disease resistance in farm animals? Could modern methods of genetics improve the disease resistance in farm animals? (introductory lecture) A. Kuznetsov Content Innate immune response Adaptive immune response Breeding programs Transgenesis

More information

Molecular methods to characterize the microbiota in the mouse tissues

Molecular methods to characterize the microbiota in the mouse tissues Molecular methods to characterize the microbiota in the mouse tissues Olivier Bouchez, GeT-PlaGe, INRA Toulouse @GeT_Genotoul Who are we? Genomic and transcriptomic core facility spreads on 5 sites GeT

More information

Bioinformatics: A perspective

Bioinformatics: A perspective Bioinformatics: A perspective Dr. Matthew L. Settles Genome Center University of California, Davis settles@ucdavis.edu Outline The World we are presented with Advances in DNA Sequencing Bioinformatics

More information

Course Agenda. Day One

Course Agenda. Day One Course Agenda BioImmersion: Biotech for the Non-Scientist A three-day, in-depth course that provides the background required for understanding today s fast-paced biotech marketplace. Beginning with an

More information

AUDREY FARBOS JEREMIE POSCHMANN PAUL O NEILL KONRAD PASZKIEWICZ KAREN MOORE

AUDREY FARBOS JEREMIE POSCHMANN PAUL O NEILL KONRAD PASZKIEWICZ KAREN MOORE We provide: AUDREY FARBOS JEREMIE POSCHMANN PAUL O NEILL KONRAD PASZKIEWICZ KAREN MOORE State of the art genomics and bioinformatics analysis Training in experimental techniques, analysis and modelling

More information

Questionnaire on the use of High Throughput Sequencing, Bioinformatics and Computational Genomics (HTS-BCG) in the OIE Reference Centre network

Questionnaire on the use of High Throughput Sequencing, Bioinformatics and Computational Genomics (HTS-BCG) in the OIE Reference Centre network Questionnaire on the use of High Throughput Sequencing, Bioinformatics and Computational Genomics (HTS-BCG) in the OIE Reference Centre network Massimo Palmarini MRC-University of Glasgow Centre for Virus

More information

Towards a P4 Healthcare System: Predictive, Preventive, Personalized & Participatory

Towards a P4 Healthcare System: Predictive, Preventive, Personalized & Participatory Towards a P4 Healthcare System: Predictive, Preventive, Personalized & Participatory Bull, 2012 Natalia Jiménez Lozano Business Development Manager BULL e-health Consultancy & Business Solutions Tlf: 913939253

More information

Bayer Pharma s High Tech Platform integrates technology experts worldwide establishing one of the leading drug discovery research platforms

Bayer Pharma s High Tech Platform integrates technology experts worldwide establishing one of the leading drug discovery research platforms Bayer Pharma s High Tech Platform integrates technology experts worldwide establishing one of the leading drug discovery research platforms Genomics Bioinformatics HTS Combinatorial chemistry Protein drugs

More information

DNA amplification and analysis: minipcr TM Food Safety Lab

DNA amplification and analysis: minipcr TM Food Safety Lab Science for everyone, everywhere DNA amplification and analysis: minipcr TM Food Safety Lab Release date: 09 September 2014 Welcome Our goals for today: Review DNA amplification theory Solve a public health

More information

Bioinformatics. Dick de Ridder. Tuinbouw Digitaal, 12/11/15

Bioinformatics. Dick de Ridder. Tuinbouw Digitaal, 12/11/15 Bioinformatics Dick de Ridder Tuinbouw Digitaal, 12/11/15 Bioinformatics is not Bioinformatics is also not Bioinformatics Bioinformatics (2) Bioinformatics (3) US National Institutes of Health (NIH): Bioinformatics:

More information

Nagahama Institute of Bio-Science and Technology. National Institute of Genetics and SOKENDAI Nagahama Institute of Bio-Science and Technology

Nagahama Institute of Bio-Science and Technology. National Institute of Genetics and SOKENDAI Nagahama Institute of Bio-Science and Technology A Large-scale Batch-learning Self-organizing Map for Function Prediction of Poorly-characterized Proteins Progressively Accumulating in Sequence Databases Project Representative Toshimichi Ikemura Authors

More information

Growing Needs for Practical Molecular Diagnostics: Indonesia s Preparedness for Current Trend

Growing Needs for Practical Molecular Diagnostics: Indonesia s Preparedness for Current Trend Growing Needs for Practical Molecular Diagnostics: Indonesia s Preparedness for Current Trend Dr. dr. Francisca Srioetami Tanoerahardjo, SpPK., MSi Essential Practical Molecular Diagnostics Seminar Hotel

More information

Introduction to iplant Collaborative Jinyu Yang Bioinformatics and Mathematical Biosciences Lab

Introduction to iplant Collaborative Jinyu Yang Bioinformatics and Mathematical Biosciences Lab Introduction to iplant Collaborative Jinyu Yang Bioinformatics and Mathematical Biosciences Lab May/27 th /2016 About iplant What is iplant Collaborative? 1. A virtual organization 2. Created by a cooperative

More information

Genetics and Bioinformatics

Genetics and Bioinformatics Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s

More information

Sequencing Theory. Brett E. Pickett, Ph.D. J. Craig Venter Institute

Sequencing Theory. Brett E. Pickett, Ph.D. J. Craig Venter Institute Sequencing Theory Brett E. Pickett, Ph.D. J. Craig Venter Institute Applications of Genomics and Bioinformatics to Infectious Diseases GABRIEL Network Agenda Sequencing Instruments Sanger Illumina Ion

More information

NGS part 2: applications. Tobias Österlund

NGS part 2: applications. Tobias Österlund NGS part 2: applications Tobias Österlund tobiaso@chalmers.se NGS part of the course Week 4 Friday 13/2 15.15-17.00 NGS lecture 1: Introduction to NGS, alignment, assembly Week 6 Thursday 26/2 08.00-09.45

More information

NOW GENERATION SEQUENCING. Monday, December 5, 11

NOW GENERATION SEQUENCING. Monday, December 5, 11 NOW GENERATION SEQUENCING 1 SEQUENCING TIMELINE 1953: Structure of DNA 1975: Sanger method for sequencing 1985: Human Genome Sequencing Project begins 1990s: Clinical sequencing begins 1998: NHGRI $1000

More information

fastest next-gen workflow 10X more throughput fastest-selling sequencer all in six months Ion Personal Genome Machine Sequencer

fastest next-gen workflow 10X more throughput fastest-selling sequencer all in six months Ion Personal Genome Machine Sequencer fastest next-gen workflow 10X more throughput fastest-selling sequencer all in six months Ion Personal Genome Machine Sequencer Semiconductor Sequencing Semiconductor technology has transformed every industry

More information

Bioinformatics for Microbial Biology

Bioinformatics for Microbial Biology Bioinformatics for Microbial Biology Chaochun Wei ( 韦朝春 ) ccwei@sjtu.edu.cn http://cbb.sjtu.edu.cn/~ccwei Fall 2013 1 Outline Part I: Visualization tools for microbial genomes Tools: Gbrowser Part II:

More information

Advances in genomic technologies and understanding infection

Advances in genomic technologies and understanding infection Advances in genomic technologies and understanding infection Mick Watson Director of ARK-Genomics The Roslin Institute Structure The Roslin Institute Challenges in food security Genetics and Genomics Technologies

More information

Human Genomics. Higher Human Biology

Human Genomics. Higher Human Biology Human Genomics Higher Human Biology Learning Intentions Explain what is meant by human genomics State that bioinformatics can be used to identify DNA sequences Human Genomics The genome is the whole hereditary

More information

Next Generation Sequencing (NGS) Market Size, Growth and Trends ( )

Next Generation Sequencing (NGS) Market Size, Growth and Trends ( ) Next Generation Sequencing (NGS) Market Size, Growth and Trends (2014-2020) July, 2017 4 th edition Information contained in this market report is believed to be reliable at the time of publication. DeciBio

More information

Biology 644: Bioinformatics

Biology 644: Bioinformatics Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....

More information

European Genome phenome Archive at the European Bioinformatics Institute. Helen Parkinson Head of Molecular Archives

European Genome phenome Archive at the European Bioinformatics Institute. Helen Parkinson Head of Molecular Archives European Genome phenome Archive at the European Bioinformatics Institute Helen Parkinson Head of Molecular Archives What is EMBL-EBI? International, non-profit research institute Part of the European Molecular

More information

Next-generation sequencing Technology Overview

Next-generation sequencing Technology Overview Next-generation sequencing Technology Overview UQ Winter School 2018 Christopher Noune, PhD AGRF Melbourne christopher.noune@agrf.org.au What is NGS? Ion Torrent PGM (Thermo-Fisher) MiSeq (Illumina) High-Throughput

More information

Carl Woese. Used 16S rrna to developed a method to Identify any bacterium, and discovered a novel domain of life

Carl Woese. Used 16S rrna to developed a method to Identify any bacterium, and discovered a novel domain of life METAGENOMICS Carl Woese Used 16S rrna to developed a method to Identify any bacterium, and discovered a novel domain of life His amazing discovery, coupled with his solitary behaviour, made many contemporary

More information

Next Generation Sequencing Applications in Food Safety and Quality

Next Generation Sequencing Applications in Food Safety and Quality Next Generation Sequencing Applications in Food Safety and Quality Our science National and international centre of excellence for interdisciplinary investigation and problem solving across plant and bee

More information

HPC in Bioinformatics and Genomics. Daniel Kahn, Clément Rezvoy and Frédéric Vivien Lyon 1 University & INRIA HELIX team LIP-ENS & INRIA GRAAL team

HPC in Bioinformatics and Genomics. Daniel Kahn, Clément Rezvoy and Frédéric Vivien Lyon 1 University & INRIA HELIX team LIP-ENS & INRIA GRAAL team HPC in Bioinformatics and Genomics Daniel Kahn, Clément Rezvoy and Frédéric Vivien Lyon 1 University & INRIA HELIX team LIP-ENS & INRIA GRAAL team Moore s law in genomics Exponential increase Doubling

More information

Motivation From Protein to Gene

Motivation From Protein to Gene MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein

More information