MCDB /15/13 Working with DNA and Biotechnology

Size: px
Start display at page:

Download "MCDB /15/13 Working with DNA and Biotechnology"

Transcription

1 Part I: Working with DNA MCDB /15/13 Working with DNA and Biotechnology You work in a clinic doing prenatal testing and genetic counseling. You use PCR analysis combined with restriction enzyme digests to determine whether fetuses are affected by cystic fibrosis, caused by a mutation on both copies of chromosome 7, in the cystic fibrosis (CF) gene. Below is a region of DNA (from the middle of the CF gene). Sequence of normal CF gene: 5 ACGCCGCTACGT TAGACTTCGCTACAAGACGG 3 3 TGCGGCG ATGCAATCTGAAGCGATGTTCTGCC 5 Sequence of mutant CF gene 5 ACGCCGCTACGT TAGAATTCGCTACAAGACGG 3 3 TGCGGCG ATGCAATCTTAAGCGATGTTCTGCC 5 1. Circle the mutation in the sequence above. One of the restriction enzymes (R.E.) you can use cuts at the following sequence, at the stars: G*AATTC CTTAA*G 2. Mark on the sequence(s) above where this R.E. will cut the DNA. You have been charged with doing DNA analysis on three recently born babies. You determine that one child is normal (no mutations in the cystic fibrosis gene on chromosome 7), one is a carrier (one mutation), and one has cystic fibrosis (a mutation on each chromosome) see the diagram below. The line in the diagram indicates the site of the mutation within the CF gene that you just found in questions 8 and 9 above. The CF gene DNA is isolated from cells from the fetus cells by PCR, and is 10 KB in length. The restriction enzyme shown above cuts the mutant CF gene into two pieces (7 kb and 3 kb). You cut your samples of DNA from each fetus, and then run the DNA on the gel. normal Cystic fibrosis carrier

2 3. What would you expect to see when you run the gel? Draw the bands each child has. Make sure to indicate the correct intensity of each band (ie, more DNA, darker band). Child A is normal. Child B has cystic fibrosis Child C is a carrier A B C 12 KB 11 KB 10 KB 9 KB 6 KB 3 KB 1 KB 4. Below is a pedigree showing inheritance of an autosomal recessive disease. Carriers are marked. The gene being analyzed is 15 KB in length normally. The mutation is a deletion of 2 KB. For each individual, imagine you have done PCR to amplify just this gene sequence from their DNA. For each numbered individual, draw in the band(s) of DNA on the gel that would result from the PCR ladder

3 5. Let s say you are testing newborns to see if they have or are carriers of an X-linked recessive disease, hemophilia (due to a mutation in coagulation factor VIII also called F8 -- which results in failure of blood to clot properly). a. Using the white boards: make up a pedigree for three generations that shows unaffected, affected and carrier individuals in a pedigree for hemophilia. You can copy your pedigree into the space below, so you can refer back to it later. b. Say that the F8 gene is 15 KB in length. If you wanted to analyze whether individuals in a family had or carried hemophilia before they showed any symptoms, what kind of mutations would you be able to assay using just PCR and gel electrophoresis. What kind of mutations could you assay using PCR, restriction enzyme digests and gel electrophoresis? c. Imagine that the mutation you are assaying that leads to hemophilia is a single base change that removes a restriction enzyme site. If that site is normally at the 5 KB point of the gene, indicate what results would be expected for unaffected, affected and carrier individuals by drawing a gel and drawing the pattern on the gel expected for your analysis of each individual in the pedigree.

4 Part II Biotechnology: Genetically Modified Foods What is a genetically modified food? The U.S. is one of the primary producers of GMO foods in the world. The creation of GMOs involves using recombinant DNA technology to place genes from one organism into another of a different species to confer a useful trait. For example, the company Monsanto developed a pest-resistant potato plant by incorporating a gene from a soil bacterium into the genome of a potato plant: this gene produces a compound that kills the Colorado Potato Beetle. These potatoes are commercially grown in the U.S. The pesticide that used to be sprayed on the potatoes to fight the beetle is no longer necessary. How do you generate the recombinant DNA that is used to make a GMO? Let s take the creation of a product called golden rice as an example. Vitamin A deficiency is a problem in the developing world, especially for pregnant women and children. Nearly 400 million people in the world are at risk of a vitamin A deficiency, which can lead to blindness and an increase in the severity of infections in young children. Foods like carrots, sweet potatoes, and spinach contain β- carotene (precursor to vitamin A), but these foods are not always available in the developing world. By adding a gene called phytoene synthase (psy) from the daffodil plant, plus a promoter region that determines where the gene will be expressed, β- carotene will accumulate in the rice grain, and be converted into Vitamin A before being harvested. To make golden rice, we first need to generate recombinant DNA. To do this, we use the bacterial system described in class. We need to put different pieces of DNA together and then amplify them, which is why we use this technique as opposed to just PCR. The picture at right represents a piece of double- stranded DNA from daffodil. This DNA includes the daffodil phytoene synthase gene (psy), as well as additional sequences of E P B H B DNA. Each line represent 1 Kilobase (1KB). Each line represent 1 Kilobase (1KB). You can amplify this 12 KB This DNA sequence can be cut by 4 different restriction enzymes E=Eco RI P=Pst1 B=BglII H=HindIII). Below is a list of the nucleotide sequences that occur at two of these restriction enzyme sites, along with the actual names of the REs. The psy gene is between the E and H restriction enzyme sites. Letter on the DNA sequence Restriction Enzyme Recognition and cutting sequence Name of Restriction Enzyme E G* A A T T C Eco RI C T T A A *G H C T G C A*G G *A C G T C Hind III 1. In the strand of DNA shown below, find the restriction enzyme sites. TATAAGATTGCGATGCCCTGCAGCTATTCGGCTGCCTAAAATCGGCCCCTAAGAATTCTTATCG ATATTCTAACGCTACGGGACGTCGATAAGCCGACGGATTTTAGCCGGGGATTCTTAAGAATAGC If this sequence (above) of DNA were cut with both E and H restriction enzymes, how many pieces would be created?

5 2. Find the band (circle it) on the gel below that contains that should contain the psy gene of interest. E P B H H+E B+P Ladder(DNA of known sizes for referen ce) 12 KB 11 KB 10 KB 9 KB 6 KB 3 KB 1 KB 3. You cut the daffodil psy DNA band out of the gel and purify the DNA from the gel. Now you want to add another piece of DNA to this piece: the phyotene desaturase (crt 1) gene from a soil bacterium. These two genes together will allow for the rice seed to contain beta carotene. The crt1 gene is represented below, with letters to indicate the location of restriction enzyme sites (the lines no longer represent 1 KB, so just look at the location of the RE sites). E P B H B B P B E Crt gene. Coding sequence extends from P to E sites. If you want these two genes to be hooked in sequence, and put into the bacterial plasmid shown below, with the crt1 gene in front of the psy gene: a. What restriction enzymes should you use to cut out the crt gene? b. What restriction enzymes should you then use to cut the plasmid (you want to put BOTH genes into the plasmid to be replicated as a unit) 9:/$..$ %&'()&'*+,,'(-$.('*-"+(-$ (-/-01+2/-$*+"3-"$ 4#,5$...$ 60'$7.$ %(1$8$ 9:/$..$!"#$

6 4. Once you cut and piece all your DNA sequences back together, you ll have a plasmid that contains the crt and psy genes, and you can put this plasmid into bacteria to replicate. Later, when you want to isolate the DNA from the bacteria, you ll need to know what size the DNA is. If the plasmid is 3.5 KB in size, the psy DNA is 4 KB, and the crt1 is 1 KB, draw a gel below showing the plasmid WITH the two pieces of DNA, and in a separate lane, the result of cutting the plasmid with the enzymes HindIII and Pst1. uncut cut with H+P 9 KB Getting more copies of the recombinant DNA: The bacteria now replicate in culture, and the scientist selects the bacterial colonies that contain the recombinant DNA. 5. You might have noticed that instead of an antibiotic resistance selectable marker on the plasmid there is a phosphomannose isomerase selectable marker. Why might you want to use the phosphomannose isomerase selectable marker instead of the antibiotic resistance gene normally present in these plasmids? Creating the genetically modified plant In making transgenic plants, it is relatively easy to get the recombinant piece of DNA into the plant. The plasmid containing the recombinant DNA is incorporated into the genome of a bacterium called Agrobacteria. These bacteria naturally infect plant seeds. If the Agrobacteria are made to contain the gene of interest, as described above, then when the bacteria infects the plant, it transfers in this recombinant DNA. If the bacterial infection doesn't work, there is another technique in which the recombinant DNA is essentially injected into the plant seeds (called the "biolistic" method). 6. Your ultimate goal is to generate rice that expresses the psy gene from daffodil in the seed of the rice, where it will provide b- carotene to those eating it. Starting back from the beginning, outline the steps you should take to make a plasmid that contains the psy gene from daffodils.

7 In 2000, rice that contained daffodil phytoene synthase (psy) and bacterial phyotene desaturase (crt 1) was introduced to the world. This rice is called Golden Rice. Its introduction was met with praise from some groups and opposition from other groups (like Greenpeace). Members of Greenpeace are opposed to all genetically modified foods. China and India are starting to farm Golden Rice and researchers are now trying to figure out to add vitamins A and E, iron, and zinc into bananas, cassava, rice, and sorghum. Interestingly, 12 years later, the use of golden rice is still minimal. A lot of this has to do with politics. If you are interested, here are several links where you can read more about golden rice: Pro: Con: Right here in Boulder county, people have also debated the use of farm lands to grow genetically modified crops (beets in this case). The originally proposed ban was NOT upheld this past December, so such crops can still be grown in Boulder county. See these links for some interesting articles in the Boulder Daily Camera: Pro: Con:

8 MCDB 1041 Activity 7: to turn in to your LA as a group Your names: 1. Please copy here (from Part 1 #5), the pedigree and gel you created to identify people who were carriers or had hemophilia 2. You are in the grocery store in the US and you see a sale on golden rice. Presuming it tastes the same as regular rice, would you buy it and eat it? If you were taking a trip to a developing country and it was legal to do so, would you bring golden rice seed to the community? Why or why not? Please consider both science and politics!

MCDB 1041 Class 27. Making recombinant DNA and using it

MCDB 1041 Class 27. Making recombinant DNA and using it MCDB 1041 Class 27 Making recombinant DNA and using it Learning Goals Explain why and how bacteria can be easily used to make copies of human DNA. Compare the two methods for making lots of copies of DNA:

More information

The process of new DNA to another organism. The goal is to add one or more that are not already found in that organism.

The process of new DNA to another organism. The goal is to add one or more that are not already found in that organism. Genetic Engineering Notes The process of new DNA to another organism. The goal is to add one or more that are not already found in that organism. Selective Breeding Carefully choosing which plants and

More information

Genetics and Biotechnology 13.2 DNA Technology

Genetics and Biotechnology 13.2 DNA Technology Biotechnology Genetic Engineering Technology that involves manipulating the DNA of one organism in order to insert the DNA of another organism An electric current is used to separate DNA fragments according

More information

Unit 8.3: Biotechnology

Unit 8.3: Biotechnology Unit 8.3: Biotechnology Lesson Objectives Describe gene cloning and the polymerase chain reaction. Explain how DNA technology is applied in medicine and agriculture. Identify some of the ethical, legal,

More information

Genetic Engineering Challenge How can scientists develop a type of rice that could prevent vitamin A deficiency? 1

Genetic Engineering Challenge How can scientists develop a type of rice that could prevent vitamin A deficiency? 1 Genetic Engineering Challenge How can scientists develop a type of rice that could prevent vitamin A deficiency? 1 Vitamin A deficiency can result in blindness, severe infectious diseases, and even death,

More information

A Lot of Cutting and Pasting Going on Here Recombinant DNA and Biotechnology

A Lot of Cutting and Pasting Going on Here Recombinant DNA and Biotechnology A Lot of Cutting and Pasting Going on Here Recombinant DNA and Biotechnology How Are Large DNA Molecules Analyzed? Naturally occurring enzymes that cleave and repair DNA are used in the laboratory to manipulate

More information

15.3 Applications of Genetic Engineering

15.3 Applications of Genetic Engineering 15.3 Applications of Genetic Engineering Agriculture and Industry Almost everything we eat and much of what we wear come from living organisms. Researchers have used genetic engineering to try to improve

More information

NOTES - CH 15 (and 14.3): DNA Technology ( Biotech )

NOTES - CH 15 (and 14.3): DNA Technology ( Biotech ) NOTES - CH 15 (and 14.3): DNA Technology ( Biotech ) Vocabulary Genetic Engineering Gene Recombinant DNA Transgenic Restriction Enzymes Vectors Plasmids Cloning Key Concepts What is genetic engineering?

More information

At the end of this lesson you should be able to

At the end of this lesson you should be able to At the end of this lesson you should be able to 1. Define Genetic Engineering 2. Outline the process of genetic engineering involving some or all of the following: isolation, cutting, transformation, introduction

More information

Recombinant DNA recombinant DNA DNA cloning gene cloning

Recombinant DNA recombinant DNA DNA cloning gene cloning DNA Technology Recombinant DNA In recombinant DNA, DNA from two different sources, often two species, are combined into the same DNA molecule. DNA cloning permits production of multiple copies of a specific

More information

-Is the process of manipulating genes and genomes

-Is the process of manipulating genes and genomes Genetic Engineering -Is the process of manipulating genes and genomes Biotechnology -Is the process of manipulating organisms or their components for the purpose of making useful products Restriction Enzymes

More information

Researchers use genetic engineering to manipulate DNA.

Researchers use genetic engineering to manipulate DNA. Section 2: Researchers use genetic engineering to manipulate DNA. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the different tools and processes used in genetic

More information

Overview: The DNA Toolbox

Overview: The DNA Toolbox Overview: The DNA Toolbox Sequencing of the genomes of more than 7,000 species was under way in 2010 DNA sequencing has depended on advances in technology, starting with making recombinant DNA In recombinant

More information

Overview: The DNA Toolbox

Overview: The DNA Toolbox Overview: The DNA Toolbox Sequencing of the genomes of more than 7,000 species was under way in 2010 DNA sequencing has depended on advances in technology, starting with making recombinant DNA In recombinant

More information

Name Class Date. a. identify similarities and

Name Class Date. a. identify similarities and Chapter 13 enetic Engineering Chapter Test A Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. Selective breeding produces a. more offspring.

More information

Genetic Technologies.notebook March 05, Genetic Technologies

Genetic Technologies.notebook March 05, Genetic Technologies Genetic Testing Genetic Technologies Tests can be used to diagnose disorders and/or identify those individuals with an increased risk of inheriting a disorder. Prenatal Screening A fetus may be screened

More information

Genetically Modified Organisms. The Pros and Cons of GMOs

Genetically Modified Organisms. The Pros and Cons of GMOs Genetically Modified Organisms The Pros and Cons of GMOs Genetic Engineering Genetic recombination: Taking genes from one organism and inserting them into another. Transgenics: Organisms containing genes

More information

I. Gene Cloning & Recombinant DNA. Biotechnology: Figure 1: Restriction Enzyme Activity. Restriction Enzyme:

I. Gene Cloning & Recombinant DNA. Biotechnology: Figure 1: Restriction Enzyme Activity. Restriction Enzyme: I. Gene Cloning & Recombinant DNA Biotechnology: Figure 1: Restriction Enzyme Activity Restriction Enzyme: Most restriction enzymes recognize a single short base sequence, or Restriction Site. Restriction

More information

Genetics and Biotechnology. Section 1. Applied Genetics

Genetics and Biotechnology. Section 1. Applied Genetics Section 1 Applied Genetics Selective Breeding! The process by which desired traits of certain plants and animals are selected and passed on to their future generations is called selective breeding. Section

More information

Passing on characteristics

Passing on characteristics 1 of 50 Boardworks Ltd 2006 2 of 50 Boardworks Ltd 2006 Passing on characteristics 3 of 50 Boardworks Ltd 2006 What makes this baby human? What determines its gender? In all living things, characteristics

More information

DNA Function. DNA Heredity and Protein Synthesis

DNA Function. DNA Heredity and Protein Synthesis DNA Function DNA Heredity and Protein Synthesis 1 Review DNA made of Nucleotide bases Proteins made of Amino acids Describe how DNA is involved in protein synthesis DNA base sequence codes for amino acid

More information

BIOTECHNOLOGY. Understanding the Application

BIOTECHNOLOGY. Understanding the Application BIOTECHNOLOGY Understanding the Application GENETIC ENGINEERING Genetic engineering refers to any process in which man alters an organism s DNA Examples: cloning, genetically modified organisms (GMO),

More information

2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology

2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes

More information

13-1 Changing the Living World

13-1 Changing the Living World 13-1 Changing the Living World In the past, variation was limited to the variations already in nature or random variations that resulted from mutations. Now, scientists can change DNA and swap genes from

More information

Mission (Im)possible: Plasmid Mapping Student Materials

Mission (Im)possible: Plasmid Mapping Student Materials Mission (Im)possible: Plasmid Mapping Student Materials Introduction... 2 Pre-Lab Questions... 6 Lab Protocol... 7 Data Collection Worksheet... 11 Post-Lab Questions and Analysis... 12 Last updated: August

More information

Concept 13.1 Recombinant DNA Can Be Made in the Laboratory

Concept 13.1 Recombinant DNA Can Be Made in the Laboratory 13 Biotechnology Concept 13.1 Recombinant DNA Can Be Made in the Laboratory It is possible to modify organisms with genes from other, distantly related organisms. Recombinant DNA is a DNA molecule made

More information

CH 8: Recombinant DNA Technology

CH 8: Recombinant DNA Technology CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes

More information

BIOTECHNOLOGY. Understanding the Application

BIOTECHNOLOGY. Understanding the Application BELLRINGER-5/4/15 1. What method would you guess forensic scientists use to identify criminals at crime scenes? 2. What do you think we mean by the term biotechnology? BIOTECHNOLOGY Understanding the Application

More information

Unit 3.notebook June 03, Genetic Counseling. May 11 12:18 PM. Genetic Counseling

Unit 3.notebook June 03, Genetic Counseling. May 11 12:18 PM. Genetic Counseling Genetic Counseling Until recently, it was very difficult to determine the health of an unborn baby. Today, with new research and technology, information can be gathered during: > fetal development > before

More information

Copyright 2002 Pearson Education, Inc., publishing as Benjamin Cummings

Copyright 2002 Pearson Education, Inc., publishing as Benjamin Cummings Here s one thing genetic engineers do: Techniques for gene cloning enable scientists to prepare multiple identical copies of gene-sized pieces of DNA. Cloning means to make copies, in this case, copies

More information

Gene Splicing and Restriction Maps

Gene Splicing and Restriction Maps Gene Splicing and Restriction Maps Bacteria have a large circular chromosome as well as many smaller circular structures called plasmids. These plasmids are an important tool in gene splicing. 1 µm Bacteria

More information

Chapter 13: Biotechnology

Chapter 13: Biotechnology Chapter Review 1. Explain why the brewing of beer is considered to be biotechnology. The United Nations defines biotechnology as any technological application that uses biological system, living organism,

More information

Hybridization - the act or process of mating organisms of varieties or species to create a hybrid. Insecticide crops

Hybridization - the act or process of mating organisms of varieties or species to create a hybrid. Insecticide crops Genetic Engineering Genetic engineering is the alteration of genetic code by means, and is therefore different from traditional selective breeding. Only allowing desired characteristics to reproduce. Scorpion

More information

CHAPTER 9: GENETIC ENGINEERING DR. BERTOLOTTI

CHAPTER 9: GENETIC ENGINEERING DR. BERTOLOTTI CHAPTER 9: GENETIC ENGINEERING DR. BERTOLOTTI Essential Question How and why do scientists manipulate DNA in living cells? 1 What is selective breeding used for? Application of Genetic Engineering Video:

More information

BS 50 Genetics and Genomics Week of Nov 29

BS 50 Genetics and Genomics Week of Nov 29 BS 50 Genetics and Genomics Week of Nov 29 Additional Practice Problems for Section Problem 1. A linear piece of DNA is digested with restriction enzymes EcoRI and HinDIII, and the products are separated

More information

Revision Based on Chapter 15 Grade 10

Revision Based on Chapter 15 Grade 10 Revision Based on Chapter 15 Grade 10 Biology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Which of the following has the disadvantage of possibly bringing

More information

Genetics and Biotechnology Chapter 13

Genetics and Biotechnology Chapter 13 1 Genetics and Biotechnology Chapter 13 Selective breeding is used to produce organisms with desired traits. I. Applied Genetics A. Selective Breeding 1. Definedthe process by which desired traits of certain

More information

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology. PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?

More information

RFLP Method - Restriction Fragment Length Polymorphism

RFLP Method - Restriction Fragment Length Polymorphism RFLP Method - Restriction Fragment Length Polymorphism RFLP (often pronounced "rif lip", as if it were a word) is a method used by molecular biologists to follow a particular sequence of DNA as it is passed

More information

Chapter 13. Genetic Engineering

Chapter 13. Genetic Engineering Chapter 13 Genetic Engineering Selective Breeding Passing on desired characteristics to the next generation. Examples: different breeds of domestic and farm animals, different varieties of plants (corn,

More information

Unit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms

Unit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms Unit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms Duncanrig Secondary JHM&MHC 2015 Page 1 of 18 On completion of this

More information

Written Response #17: Are Genetically Modified Foods Safe?

Written Response #17: Are Genetically Modified Foods Safe? DNA Technology Written Response #17: Are Genetically Modified Foods Safe? Decide if you think GMO foods are safe. You will need to write whether you think they are safe or not and include 3 reasons for

More information

Kickstart Biology. Year 11 and Year 12

Kickstart Biology. Year 11 and Year 12 Kickstart Biology Year 11 and Year 12 Year 11 workshops From 2019, we will be offering Kickstart Biology for Year 11 syllabus content. Building a strong foundation for students at this stage can encourage

More information

Biotechnology. DNA Cloning Finding Needles in Haystacks. DNA Sequencing. Genetic Engineering. Gene Therapy

Biotechnology. DNA Cloning Finding Needles in Haystacks. DNA Sequencing. Genetic Engineering. Gene Therapy Biotechnology DNA Cloning Finding Needles in Haystacks DNA Sequencing Genetic Engineering Gene Therapy What is DNA Cloning? Set of methods that uses live cells to make many identical copies of a DNA fragment

More information

19 Biopharming Edible Vaccines As y o u r e a d in Activity 1, A Genetically Modified Solution? scientists

19 Biopharming Edible Vaccines As y o u r e a d in Activity 1, A Genetically Modified Solution? scientists 19 Biopharming Edible Vaccines As y o u r e a d in Activity 1, A Genetically Modified Solution? scientists have been using genetically modified E. coli for more than 30 years to manufacture proteins for

More information

Biology 3201 Genetics Unit #8

Biology 3201 Genetics Unit #8 Biology 3201 Genetics Unit #8 Diagnosis and Treatment of Genetic Disorders Genetic Engineering The Human Genome Project GMOs and GMFs Cloning Diagnosis of Genetic Disorders Detection of genetics disorders-

More information

A cross between dissimilar individuals to bring together their best characteristics is called

A cross between dissimilar individuals to bring together their best characteristics is called Ch 13 Game review A cross between dissimilar individuals to bring together their best characteristics is called A Genetic engineering B Inbreeding C Hybridization D Sequencing Ans: C Used to insert new

More information

DNA REPLICATION & BIOTECHNOLOGY Biology Study Review

DNA REPLICATION & BIOTECHNOLOGY Biology Study Review DNA REPLICATION & BIOTECHNOLOGY Biology Study Review DNA DNA is found in, in the nucleus. It controls cellular activity by regulating the production of, which includes It is a very long molecule made up

More information

Goal 3. Friday, May 10, 13

Goal 3. Friday, May 10, 13 Goal 3 Bio.3.1 Explain how traits are determined by the structure and function of DNA. Bio.3.2 Understand how the environment, and/or the interaction of alleles, influences the expression of genetic traits.

More information

GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.

GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two

More information

Human Genetic Diseases non mutation

Human Genetic Diseases non mutation Page 1 of 10 Human Genetic Diseases non mutation These are diseases that normally occur because of gene inheritance rather than mutations. 1. Autosomal Recessive Inheritance This is the inheritance of

More information

genetic engineering 2. Hybrids are often hardier tha~ either of their parents.

genetic engineering 2. Hybrids are often hardier tha~ either of their parents. Class: Date: ID: A genetic engineering Modified TrueLFalse Indicate whether the sentence or statement is true or false. -- 1. Without selective breeding: dogs today would probably be less similar. 2. Hybrids

More information

Chapter 12. DNA Technology. Lectures by Edward J. Zalisko

Chapter 12. DNA Technology. Lectures by Edward J. Zalisko Chapter 12 DNA Technology PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey, and Jane B. Reece

More information

Genetic Diagnosis. electrophoresis. During the lab, genetic testing was done for the cystic fibrosis gene in a young

Genetic Diagnosis. electrophoresis. During the lab, genetic testing was done for the cystic fibrosis gene in a young Meyers 1 Keya Meyers Genetic Diagnosis Abstract: In this lab two processes were observed: restriction fragment polymorphism and gel electrophoresis. During the lab, genetic testing was done for the cystic

More information

UNIT III: Genetics Chapter 9 Frontiers of Biotechnology

UNIT III: Genetics Chapter 9 Frontiers of Biotechnology UNIT III: Genetics Chapter 9 Frontiers of Biotechnology I. Manipulating DNA (9.1) A. Scientists use several techniques to manipulate DNA 1. DNA is a very large molecule 2. Still to small to see or work

More information

Genetic Engineering in Agriculture

Genetic Engineering in Agriculture Details Utah State University Engineering in This is a project resulting from the Engineering Workshop for Teachers to provide teaching materials for genetic engineering topics. Please direct any feedback

More information

How Can Pieces of DNA Solve a Puzzle?

How Can Pieces of DNA Solve a Puzzle? Introduction How Can Pieces of DNA Solve a Puzzle? One of the basic tools of modern biotechnology is DNA splicing: cutting DNA and linking it to other DNA molecules. The basic concept behind DNA splicing

More information

Biotechnology DNA technology

Biotechnology DNA technology Biotechnology Biotechnology is the manipulation of organisms or their components to make useful products The applications of DNA technology affect everything from agriculture, to criminal law, to medical

More information

Genetic Engineering 1.6

Genetic Engineering 1.6 Genetic Engineering 1.6 Genetic Engineering Learning Outcomes: 1.Genetic information can be transferred from one cell to another artificially 2.To understand the stages involved in genetic engineering

More information

Page 3. 18) The diagram below illustrates some key steps of a procedure in one area of biotechnology.

Page 3. 18) The diagram below illustrates some key steps of a procedure in one area of biotechnology. Name: 1117 1 Page 1 1) A small amount of DNA was taken from a fossil of a mammoth found frozen in glacial ice. Genetic technology can be used to produce a large quantity of identical DNA from this mammoth's

More information

Agenda (Monday-Wednesday)

Agenda (Monday-Wednesday) Agenda (Monday-Wednesday) Chapter 12 Recombinant DNA Technology Recombinant DNA Techniques DNA Fingerprinting and Forensic Science DNA Fingerprinting Techniques Pre-lab 8 activities Tomorrow: Day One of

More information

MCB 102 University of California, Berkeley August 11 13, Problem Set 8

MCB 102 University of California, Berkeley August 11 13, Problem Set 8 MCB 102 University of California, Berkeley August 11 13, 2009 Isabelle Philipp Handout Problem Set 8 The answer key will be posted by Tuesday August 11. Try to solve the problem sets always first without

More information

Lesson 1 Introduction to Restriction Analysis

Lesson 1 Introduction to Restriction Analysis Lesson 1 Introduction to Restriction Analysis Consideration 1. How Does DNA Become Fragmented Into Pieces? DNA consists of a series of nitrogenous base molecules held together by weak hydrogen bonds. These

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

7.012 Problem Set 5. Question 1

7.012 Problem Set 5. Question 1 Name Section 7.012 Problem Set 5 Question 1 While studying the problem of infertility, you attempt to isolate a hypothetical rabbit gene that accounts for the prolific reproduction of rabbits. After much

More information

Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, ; ; 330 PCR, ; 329.

Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, ; ; 330 PCR, ; 329. Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, 240-245; 286-87; 330 PCR, 270-274; 329. Take Home Lesson(s) from Lecture 2: 1. DNA is a double helix of complementary

More information

4. Analysing genes II Isolate mutants*

4. Analysing genes II Isolate mutants* .. 4. Analysing s II Isolate mutants* Using the mutant to isolate the classify mutants by complementation analysis wild type study phenotype of mutants mutant 1 - use mutant to isolate sequence put individual

More information

Name: Period: Date: 2) The procedures are often referred to as. 3) is the genetic material of all living organisms.

Name: Period: Date: 2) The procedures are often referred to as. 3) is the genetic material of all living organisms. Name: Period: Date: I. Selective Breeding 1) = The process by which desired traits of certain plants and animals are selected and passed on to their future generations. Breed only those plants or animals

More information

Genetic Engineering RESTRICTION ENDONUCLEASES

Genetic Engineering RESTRICTION ENDONUCLEASES Genetic Engineering 1977 Frederick Sanger discovered the complete base sequence for one type of virus, identified all 9 of its genes, and became the first to do so. This opened up a whole new world for

More information

UNIT 3: GENETICS Chapter 9: Frontiers of Biotechnology

UNIT 3: GENETICS Chapter 9: Frontiers of Biotechnology CORNELL NOTES Directions: You must create a minimum of 5 questions in this column per page (average). Use these to study your notes and prepare for tests and quizzes. Notes will be stamped after each assigned

More information

Manipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.

Manipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules

More information

Biotechnology (Chapter 20) Objectives

Biotechnology (Chapter 20) Objectives Biotechnology (Chapter 20) Objectives Understand the background science behind the technology applications Understand the tools and details of the technology Develop familiarity with performing the select

More information

Human Chromosomes Section 14.1

Human Chromosomes Section 14.1 Human Chromosomes Section 14.1 In Today s class. We will look at Human chromosome and karyotypes Autosomal and Sex chromosomes How human traits are transmitted How traits can be traced through entire families

More information

Essential Questions Real-World Reading Link Have you seen a handmade patchwork quilt? Patchwork quilts are

Essential Questions Real-World Reading Link Have you seen a handmade patchwork quilt? Patchwork quilts are 4.3.f 4.1.c 4.2.d DNA Technology Reading Preview Researchers use genetic engineering to manipulate DNA. Essential Questions Real-World Reading Link Have you seen a handmade patchwork quilt? Patchwork quilts

More information

What does the person being interviewed want to create?

What does the person being interviewed want to create? What does the person being interviewed want to create? Daan Roosegaarde Interview about creating glowing plants https://vimeo.com/89651857 What does BIO= Life TECHNOLOGY= The real life use/ application

More information

Molecular Scissors: Lambda Digest Student Materials

Molecular Scissors: Lambda Digest Student Materials Molecular Scissors: Lambda Digest Student Materials Introduction 2 Pre-Lab Questions. 5 Lab Protocol 6 Data Collection Worksheet. 9 Post-Lab Questions and Analysis.. 10 Plasmid Maps. 13 Last updated: August

More information

Molecular Biology (2)

Molecular Biology (2) Molecular Biology (2) Restriction endonucleases, RFLP, and gene cloning Mamoun Ahram, PhD Second semester, 2017-2018 Resources This lecture Cooper, pp 120-124 Endonucleases Enzymes that degrade DNA within

More information

12/31/16. I. Manipulating DNA (9.1) A. Scientists use several techniques to manipulate DNA. 1. DNA is a very large molecule

12/31/16. I. Manipulating DNA (9.1) A. Scientists use several techniques to manipulate DNA. 1. DNA is a very large molecule I. Manipulating DNA (9.1) A. Scientists use several techniques to manipulate DNA 1. DNA is a very large molecule 3. Led to many biotechnology applications- genetic engineering, DNA fingerprinting, cloning,

More information

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau 7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial

More information

BIOTECHNOLOGY : PRINCIPLES AND PROCESSES

BIOTECHNOLOGY : PRINCIPLES AND PROCESSES CHAPTER 11 BIOTECHNOLOGY : PRINCIPLES AND PROCESSES POINTS TO REMEMBER Bacteriophage : A virus that infects bacteria. Bioreactor : A large vessel in which raw materials are biologically converted into

More information

Concepts: What are RFLPs and how do they act like genetic marker loci?

Concepts: What are RFLPs and how do they act like genetic marker loci? Restriction Fragment Length Polymorphisms (RFLPs) -1 Readings: Griffiths et al: 7th Edition: Ch. 12 pp. 384-386; Ch.13 pp404-407 8th Edition: pp. 364-366 Assigned Problems: 8th Ch. 11: 32, 34, 38-39 7th

More information

dominance neither trait is dominant; in a hybrid condition, there is a blending in the phenotype.

dominance neither trait is dominant; in a hybrid condition, there is a blending in the phenotype. Genetics NAME Period Date dominance neither trait is dominant; in a hybrid condition, there is a blending in the phenotype. - a condition when both alleles show up in

More information

CHAPTER 21. Genetic engineering. What is Genetic Engineering? How is genetic engineering used? What are plasmids? DNA Technology Genomics.

CHAPTER 21. Genetic engineering. What is Genetic Engineering? How is genetic engineering used? What are plasmids? DNA Technology Genomics. CHAPTER 21 DNA Technology Genomics What is Genetic Engineering? Genetic engineering Moving genes from one organism to another Genes can be taken from one organism (plant, animal, virus, or bacteria) and

More information

TOPIC BIOTECHNOLOGY

TOPIC BIOTECHNOLOGY TOPIC 3.5 - BIOTECHNOLOGY 3.5 A Techniques & Profiling IB BIO 3.5 3 Understandings U1: Gel electrophoresis is used to separate proteins or fragments of DNA according to size. Gel electrophoresis is a technique

More information

Genetically Modified Organisms II. How are transgenic plants generated? The components of T DNA transfer. Plants

Genetically Modified Organisms II. How are transgenic plants generated? The components of T DNA transfer. Plants Genetically Modified Organisms II Plants How are transgenic plants generated? The bacterium Agrobacterium tumefaciens is a pathogen of plants that causes crown gall tumors. Crown gall tumor Agrobacterium

More information

Cell Biology. Sub-Topic (1.5) Genetic Engineering. On completion of this subtopic I will be able to state that

Cell Biology. Sub-Topic (1.5) Genetic Engineering. On completion of this subtopic I will be able to state that Cell Biology Sub-Topic (1.5) Genetic Engineering On completion of this subtopic I will be able to state that Genetic information can be transferred from one cell to another by genetic engineering. Bacteria

More information

Genetic Engineering in Agriculture

Genetic Engineering in Agriculture Details Utah State University Engineering in This is a project resulting from the Engineering Workshop for Teachers to provide teaching materials for genetic engineering topics. Please direct any feedback

More information

DNA Technology. B. Using Bacteria to Clone Genes: Overview:

DNA Technology. B. Using Bacteria to Clone Genes: Overview: DNA Technology A. Basic Vocabulary: is DNA from 2 different sources that is combined. is the direct manipulation of genes for practical purposes. literally means or in a test tube or flask. is the manipulation

More information

HOW OUR FOOD IS GROWN

HOW OUR FOOD IS GROWN OPEN TO YOUR QUESTIONS ABOUT HOW OUR FOOD IS GROWN Genetically modified organisms (GMOs) are a major topic of discussion today. Across our society, media and the Internet, a growing number of people have

More information

Genetic Engineering : (page 613)

Genetic Engineering : (page 613) Genetic Engineering : (page 613) 1977 - Frederick Sanger - discovered the complete base sequence for one type of virus, identified all 9 of its genes, first to do so...opening a new world for genetic procedures

More information

Biotechnology. Chapter 13

Biotechnology. Chapter 13 Biotechnology Chapter 13 Genetic Changes Humans have been changing the genetics of other species for thousands of years Artificial selection of plants and animals Tomato plants look nothing like their

More information

STUDY GUIDE SECTION 13-1 DNA Technology

STUDY GUIDE SECTION 13-1 DNA Technology STUDY GUIDE SECTION 13-1 DNA Technology Name Period Date Multiple Choice-Write the correct letter in the blank. 1. To cut DNA molecules into pieces at specific sequences of nucleotides, genetic engineers

More information

Biosc10 schedule reminders

Biosc10 schedule reminders Biosc10 schedule reminders Review of molecular biology basics DNA Is each person s DNA the same, or unique? What does DNA look like? What are the three parts of each DNA nucleotide Which DNA bases pair,

More information

Chapter 11: Applications of Biotechnology

Chapter 11: Applications of Biotechnology Chapter 11: Applications of Biotechnology Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 11-1 Why Biotechnology Works 11-2 Biotechnology

More information

Practice Test #3. Multiple Choice Identify the choice that best completes the statement or answers the question.

Practice Test #3. Multiple Choice Identify the choice that best completes the statement or answers the question. Practice Test #3 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists would be _. a.

More information

TOPIC 5: DNA & CHROMOSOMES

TOPIC 5: DNA & CHROMOSOMES TOPIC 5: DNA & CHROMOSOMES I Can Describe the role and relationship of chromosomes, genes and DNA Distinguish between mitosis and meiosis Provide examples of genetic technologies and identify questions

More information

Genetic Engineering and Other Aspects of Biotechnology

Genetic Engineering and Other Aspects of Biotechnology Genetic Engineering and Other Aspects of Biotechnology IB Biology Outcomes 4.4.1 Outline the use of polymerase chain reaction (PCR) to copy and amplify minute quantities of DNA. 4.4.2 State that, in gel

More information

1. Each strand of DNA is polarized, having 5 and a 3 end. Explain how two strands of DNA assemble into the double stranded DNA form:

1. Each strand of DNA is polarized, having 5 and a 3 end. Explain how two strands of DNA assemble into the double stranded DNA form: BIOS10191, Fall 2017, Midterm Exam Name: I UNDERSTAND THAT I MUST COMPLY WITH THE UNIVERSITY OF NOTRE DAME HONOR CODE WHEN EXECUTING THIS EXAMINATION. Part 1. Multiple Choice and Fill-in Blanks. Signed:

More information

Guided Notes Unit 5: Molecular Genetics

Guided Notes Unit 5: Molecular Genetics Name: Date: Block: Chapter 8: From DNA to Protein I. Concept 8.4: Transcription a. Central Dogma of Molecular Biology i. Information flows in one direction: ii. How? Guided Notes Unit 5: Molecular Genetics

More information

Problem Set 4

Problem Set 4 2006 7.012 Problem Set 4 Due before 5 PM on FRIDAY, October 27, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. You are studying a specific gene in yeast,

More information