Annex to the Accreditation Certificate D PL according to DIN EN ISO/IEC 17025:2005

Size: px
Start display at page:

Download "Annex to the Accreditation Certificate D PL according to DIN EN ISO/IEC 17025:2005"

Transcription

1

2

3 Deutsche Akkreditierungsstelle GmbH German Accreditation Body Annex to the Accreditation Certificate D PL according to DIN EN ISO/IEC 17025:2005 Period of validity: to Holder of certificate: Eurofins Medigenomix GmbH Anzinger Str. 7a, Ebersberg Tests in the fields: Veterinary Medicine / Pharmaceuticals; Food, Commodities and Animal Feed; Health Care (medical laboratory testing in the context of clinical studies; genetic diagnostics) Testing areas: Genetics (molecular genetics, parentage certificates); food including the necessary raw s, molecular biological testing of pharmaceuticals, human genetic (molecular human genetic) Testing methods: Molecular testing methods (amplification); spectrometry (Mass Spectrometry (MALDI TOF MS)) The laboratory is permitted within the testing area(s) marked with *), without being required to inform and obtain prior approval from DAkkS the modification, development and refinement of test methods. The listed test methods are exemplary. The laboratory maintains a current list of all test methods in a flexible scope of accreditation. This document is a translation. The definitive version is the original German annex to the accreditation certificate. 1/1

4 Test field: Veterinary Medicine / Pharmaceuticals Testing area: Genetics (molecular genetics, parentage certificates) Sequence specific detection of amplification products, qualitative, by DNA Sequencing SOP_APG_PRPS_ Prion protein genotyping in sheep Single plex PCR with PrP gene specific primers. Sequencing of PCR products and sequence comparison Genomic sheep DNA from whole blood or tissue with ovine cell SOP_APG_Species_Qualitativ_ PCR amplification of species specific gene loci with species specific primers. Sequencing of PCR products and database sequence comparison. Mitochondrial DNA isolated from meat or fish (native or (processed) SOP_APG_Species_Qualitativ_ SOP_APG_PKD1_5.0 PCR amplification of species specific gene loci with species specific primers. Sequencing of PCR products and database sequence comparison. Detection of Polycystic Kidney Disease in cats PCR amplification of PKD1 gene. Sequencing of PCR products and sequence comparison. Genomic and plastid DNA isolated from animal or plant tissues, fungi or bacteria Genomic cat DNA buccal swabs with feline SOP_APG_SLS_ Spider Lamb Syndrome (SLS) genotyping in sheep PCR amplification of FGFR3 gene. Sequencing of PCR products and sequence comparison. Genomic sheep DNA ear tissue with ovine Detection of amplification products by microsatellite analysis (fragment length analysis) SOP_APG_GenoHund_ , SOP_APG_GenoHund22_2.0 PCR with dog specific micro satellite marker with PCR with 22 In House designed dog specific micro satellite marker. Capillary electrophoresis (CE) of PCR products. Genomic dog DNA buccal scrapes or trace samples with canine Period of validity: to Translation 2/2

5 SOP_APG_GenotypKatze_3.0 SOP_APG_GenotypRind_4.0, SOP_APG_MultiQ_3.0 SOP_APG_GenotypPferd_3.0 SOP_APG_GenotypSchaf_2.0 PCR with cat specific micro satellite marker with PCR with cattle specific micro satellite marker with PCR with MultiQ In House designed cattle specific micro satellite marker with subsequent electrophoresis and allelic mapping of PCR products PCR with horse specific micro satellite marker with PCR with sheep specific micro satellite marker with Genomic cat DNA buccal scrapes or trace samples with feline Genomic cattle DNA buccal scrapes or trace samples with bovine Genomic horse DNA hairs or trace samples with equine cell Genomic sheep DNA buccal scrapes or trace samples with ovine Sequence specific detection of amplification products, qualitative, by SNP SOP_APG_ScrapieZiegeLC480_ SNP or Double SNP analysis on Roche Light Cycler with fluorescence labeled PCR primer and subsequent melting curve analysis Genomic goat DNA isolated from whole blood or ear tissue with ovine cell Test methods: Spectrometry (Mass Spectrometry (MALDI TOF MS)) Matrix Assisted Laser Desorption Ionization Time of Flight Mass Spectrometry (MALDI TOF MS) SOP_P_PRPS_MALDI_V Genotyping of PRP1 gene in sheep Multiplex PCR with PrP gene specific primer, analysis of five SNP s. Mass spectrometry of PCR products Genomic sheep DNA isolated from whole blood or ear tissue with ovine cell Period of validity: to Translation 3/3

6 SOP_APG_PRPZ_MALDI_ SOP_APG_Rind_Merial_ Genotyping of PRP1 gene in goat Singleplex PCR with PrP gene specific primer, analysis of two SNP s. Mass spectrometry of PCR products Genotyping of cattle for parental or diagnostic tests Single or multiplex PCR with cattle specific primer. Mass spectrometry of PCR products Genomic goat DNA isolated from whole blood or ear tissue with ovine cell Genomic cattle / bovine DNA isolated from whole blood or ear tissue with bovine Testing area: Molecular biological testing of pharmaceuticals Sequence specific detection of amplification products, quantitative, by Real Time PCR SOP_APG_DNAprozProd_ Detection of trace amounts of DNA in highly processed sample. Pharmaceutical intermediate and end products Test field: Food, Commodities and Animal Feed Testing area: Food including the necessary raw s Detection of amplification products by microsatellite analysis (fragment length analysis) SOP_P_GenoReis_V Genotyping of genomic DNA from rice grains by means of microsatellite analyis for determination of purity of variety. (Multiplex PCR with rice specific DNA markers, capillary electrophoresis of PCR products and quantification of allele proportions.) Rice grains and rice flour Period of validity: to Translation 4/4

7 Detection of amplification products by sequence analysis SOP_APG_Species_Qualitativ Qualitative species detection in biological sample _V2.0 by DNA sequencing analysis of genomic, mitochondrial, chromosomal, or plastid DNA strands. Comparison of obtained sequence data with data entries in the BLAST data base of the NCBI PV Spezies_Pilz_V01 PV Spezies_16sRNA_V01 PV Spezies_Ente_V01 Detection of fungi in scrapes, food or cultures by DNA double strand sequencing of the 28s Gene. Comparison of obtained Sequence data with data entries in the BLAST Data base of the NCBI. Detection of vertebrates in tissue samples, blood samples, feathers, hairs of animal origin by DNA double strand sequencing of the ribosomal 16s gene Comparison of obtained Sequence data with data entries in the BLAST Data base of the NCBI. Detection of duck in meet by DNA double strand sequencing of thepre proinsulin gene. Comparison of obtained Sequence data with data entries in the BLAST Data base of the NCBI. processed s of animals, plants, fungi or bacteria processed s processed s processed s Sequence specific detection of amplification products, quantitative by RealTime PCR SOP_APG_Species_Quantitati Quantitative species detection in biological sample v_3.0 by DNA sequencing analysis of genomic, mitochondrial, chromosomal, or plastid DNA strands. (RealTime PCR amplification of species specific Gene loci with species specific primer pairs (literature)). PV QuantiSpecies_Rind Schwein_V01 Detection of bovine and pork in blood or meat samples or processed meat products by RealTime PCR analysis. processed s of animals, plants, fungi or bacteria processed s Test field: Healthcare (Medical laboratory testing in the context of clinical studies) Testing area: Human genetic (molecular human genetic) Genotyping of human DNA by PCR and subsequent DNA Sequencing SOP_PGX_GENOTYP_ Analysis of genetic variants in human genes by amplification and sequencing of defined gene loci. PV_Genotyp_CYP2D6_chaba_ Analysis of genetic variants in the human gene CYP2D6 by amplification and sequencing of gene loci chaba. Period of validity: to Translation 5/5

8 PV_Genotyp_FCGR2A_FCGR2 A_E04_1.0 Analysis of genetic variants in the human gene FCGR2A by amplification and sequencing of gene loci FCGR2A E04. Genotyping of human DNA by PCR and subsequent fragment length analysis SOP_APG_HSA CAG Analyis of CAG repeats in exon 1 of the human Repeat_1.0 Androgen Receptor by fragment length analysis SOP_APG_RS _ SOP_APG_RS _ Analysis of humanen SNP RS by fragment length analysis. Analysis of human SNP RS by fragment length analysis. Test field: Healthcare (genetic diagnostics) Testing area: Human genetic (molecular human genetic) Genotyping of human DNA by PCR and subsequent DNA Sequencing SOP_SEQ_VR SALC PW Sequencing of DNA by Sanger Sequencing Pipet_ , SOP_SEQ_E Sequence_VR_ , SOP_SEQ_Auswertung_1.0 SOP_SEQ_PCRundRe Seq_ SOP_SEQ_Bearbeitung PW&GLP_ , SOP_SEQ_GLP SEQ_ PCR amplification and re sequencing (= exon sequencing) Sequencing by primer walking (PW) Plasmid DNA and related constructs. PCR products, cdna Plasmid DNA and related constructs. PCR products, cdna Plasmid DNA and related constructs. PCR products, cdna Period of validity: to Translation 6/6

9 SOP_GEN_SampleReceipt_1.0 SOP_GEN_EQC DNA_1.0 SOP_GEN_EQC RNA_3.0 SOP_GEN_SG Illu_1.0 SOP_GEN_mRNA Illu_1.0 SOP_GEN_Pooling+QC_1.0 SOP_GEN_IlluminaSeq_1.0 SOP_GEN_DataManagement_ 1.0 SOP_GEN_DataGeneration_1. 0 SOP_GEN_DataQC_1.0 SOP_GEN_IlluminaRawData_1.0 SOP_GEN_ProjectReport_1.0 SOP_GEN_DataShipment_1.0 SOP_GEN_DiscPublisher_1.0 SOP_GEN_SampleReceipt_1.0 SOP_GEN_EQC DNA_1.0 SOP_GEN_EQC RNA_3.0 SOP_GEN_SG Tit_1.0 SOP_GEN_SG FLX_1.0 SOP_GEN_Pooling+QC_1.0 SOP_GEN_GS454Seq_1.0 SOP_GEN_DataManagement_ 1.0 SOP_GEN_DataGeneration_1. 0 SOP_GEN_DataQC_1.0 SOP_GEN_FLXRawData_1.0 SOP_GEN_ProjectReport_1.0 SOP_GEN_DataShipment_1.0 SOP_GEN_DiscPublisher_1.0 Sequencing by Next Generation Sequencing (NGS) (Illumina) Sequencing by Next Generation Sequencing (NGS) (Roche 454) DNA, RNA DNA, RNA Period of validity: to Translation 7/7

Twisted Intercalating Nucleic Acid (TINA) a novel group of molecules with improved performance in PCR and qpcr applications

Twisted Intercalating Nucleic Acid (TINA) a novel group of molecules with improved performance in PCR and qpcr applications Twisted Intercalating Nucleic Acid (TINA) a novel group of molecules with improved performance in PCR and qpcr applications Dr. Rainer Schubbert, Eurofins Medigenomix 19.03.2013 www.eurofins.de Topics

More information

Page 1. AMPTask Force on MLS Molecular Pathology Curriculum Dear Molecular Diagnostics Laboratory Manager,

Page 1. AMPTask Force on MLS Molecular Pathology Curriculum Dear Molecular Diagnostics Laboratory Manager, AMPTask Force on MLS Molecular Pathology Curriculum Dear Molecular Diagnostics Laboratory Manager, Recently the Association for Molecular Pathology (AMP) has decided to develop a suggested curriculum in

More information

Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze

Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering,

More information

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY. !! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which

More information

Applications and Uses. (adapted from Roche RealTime PCR Application Manual)

Applications and Uses. (adapted from Roche RealTime PCR Application Manual) What Can You Do With qpcr? Applications and Uses (adapted from Roche RealTime PCR Application Manual) What is qpcr? Real time PCR also known as quantitative PCR (qpcr) measures PCR amplification as it

More information

SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM

SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM SNP GENOTYPING Accurate, sensitive, flexible MassARRAY System SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM Biomarker validation Routine genetic testing Somatic mutation profiling Up to 400

More information

Lecture 12. Genomics. Mapping. Definition Species sequencing ESTs. Why? Types of mapping Markers p & Types

Lecture 12. Genomics. Mapping. Definition Species sequencing ESTs. Why? Types of mapping Markers p & Types Lecture 12 Reading Lecture 12: p. 335-338, 346-353 Lecture 13: p. 358-371 Genomics Definition Species sequencing ESTs Mapping Why? Types of mapping Markers p.335-338 & 346-353 Types 222 omics Interpreting

More information

SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM

SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM SNP GENOTYPING Accurate, sensitive, flexible MassARRAY System SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM Biomarker validation Routine genetic testing Somatic mutation profiling Up to 400

More information

MassARRAY Genetic Analysis System. Genotyping Methylation Analysis Molecular Typing Somatic Mutation Profiling Quantitative Gene Expression (QGE)

MassARRAY Genetic Analysis System. Genotyping Methylation Analysis Molecular Typing Somatic Mutation Profiling Quantitative Gene Expression (QGE) MassARRAY Genetic Analysis System Genotyping Methylation Analysis Molecular Typing Somatic Mutation Profiling Quantitative Gene Expression (QGE) MassARRAY Genetic Analysis System * Overview Next-generation

More information

Genetic Identity. Steve Harris SPASH - Biotechnology

Genetic Identity. Steve Harris SPASH - Biotechnology Genetic Identity Steve Harris SPASH - Biotechnology Comparison of Organisms ORGANISM GENES BASE PAIRS Lambda Phage 40 50,000 E.coli 400 5,000,000 Yeast 13,000 15,000,000 Human 20,000 3,000,000,000 (3 billion)

More information

Artifacts Identified Post-Developmental Validation: AmpFLSTR Identifiler Plus PCR Amplification Kit

Artifacts Identified Post-Developmental Validation: AmpFLSTR Identifiler Plus PCR Amplification Kit March 29, 2018 TECHNICAL NOTE Artifacts Identified Post-Developmental Validation: AmpFLSTR Identifiler Plus PCR Amplification Kit The purpose of this document is to assist with data interpretation by providing

More information

Roche Molecular Biochemicals Technical Note No. LC 10/2000

Roche Molecular Biochemicals Technical Note No. LC 10/2000 Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce

More information

CONTENTS. Introduction to Sequenom Overview MassARRAY System. Publications xR Sequenom Bioscience. All rights reserved.

CONTENTS. Introduction to Sequenom Overview MassARRAY System. Publications xR Sequenom Bioscience. All rights reserved. CONTENTS Introduction to Sequenom Overview MassARRAY System iplex Biochemistry Publications Sequenom GmbH - brief history Founded in 1994 as Sequenom GmbH in Hamburg (DE) By Hubert Köster and Charles Cantor

More information

FUTURE PROSPECTS IN MOLECULAR INFECTIOUS DISEASES DIAGNOSIS

FUTURE PROSPECTS IN MOLECULAR INFECTIOUS DISEASES DIAGNOSIS FUTURE PROSPECTS IN MOLECULAR INFECTIOUS DISEASES DIAGNOSIS Richard L. Hodinka, Ph.D. University of South Carolina School of Medicine Greenville Greenville Health System, Greenville, SC hodinka@greenvillemed.sc.edu

More information

SolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze

SolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze SolCAP Solanaceae Coordinated Agricultural Project Supported by the National Research Initiative Plant Genome Program of USDA CSREES for the Improvement of Potato and Tomato Executive Commitee : David

More information

Microsatellite markers

Microsatellite markers Microsatellite markers Review of repetitive sequences 25% 45% 8% 21% 13% 3% Mobile genetic elements: = dispersed repeat included: transposition: moving in the form of DNA by element coding for transposases.

More information

Incorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows

Incorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows Incorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows Stephen Jackson, Ph.D 27 May 2017 The world leader in serving science Key Applications for Genome Editing Research

More information

Contact us for more information and a quotation

Contact us for more information and a quotation GenePool Information Sheet #1 Installed Sequencing Technologies in the GenePool The GenePool offers sequencing service on three platforms: Sanger (dideoxy) sequencing on ABI 3730 instruments Illumina SOLEXA

More information

LightCycler 480 qpcr Tools. Meeting the Challenge of Your Research

LightCycler 480 qpcr Tools. Meeting the Challenge of Your Research LightCycler 480 qpcr Tools Meeting the Challenge of Your Research Find the Optimal LightCycler 480 Reagents for Your Research Application: Are you analyzing DNA DNA Nucleic acid isolation Manual processing

More information

Biotechnology Chapter 20

Biotechnology Chapter 20 Biotechnology Chapter 20 DNA Cloning DNA Cloning AKA Plasmid-based transformation or molecular cloning First off-let s sum up what happens. A plasmid is taken from a bacteria A gene is inserted into the

More information

Sequencing a North American yak genome

Sequencing a North American yak genome Sequencing a North American yak genome Presentation for the annual meeting of the International Yak association Denver Colorado, January 24, 2014 Mike Heaton, Ph.D. USDA Meat Animal Research Center (USMARC),

More information

BENG 183 Trey Ideker. Genotyping. To be covered in one 1.5 hr lecture

BENG 183 Trey Ideker. Genotyping. To be covered in one 1.5 hr lecture BENG 183 Trey Ideker Genotyping To be covered in one 1.5 hr lecture Genetic variation: Some basic definitions Allele Alternative form of a genetic locus inherited separately from each parent Polymorphism

More information

* Custom assays developed based on customer requirements. * Rigorous QC process to ensure test performance and accuracy

* Custom assays developed based on customer requirements. * Rigorous QC process to ensure test performance and accuracy Price List 2012-13 About Scigenom * Genomics focused R & D organization * Expertise in rapid and accurate DNA test development * Several DNA based tests readily available * Custom assays developed based

More information

Next Generation Sequencing of HLA: Challenges and Opportunities in the era of Precision Medicine. Dr. Paul Keown, 2016

Next Generation Sequencing of HLA: Challenges and Opportunities in the era of Precision Medicine. Dr. Paul Keown, 2016 Next Generation Sequencing of HLA: Challenges and Opportunities in the era of Precision Medicine Dr. Paul Keown, 2016 Statement of Conflict & Collaboration Therapeutics collaborations Novartis, Roche,

More information

What is DNA? Deoxyribonucleic Acid The inherited genetic material that makes us what we are

What is DNA? Deoxyribonucleic Acid The inherited genetic material that makes us what we are DNA Basic Genetics What is DNA? DNA is Deoxyribonucleic Acid The inherited genetic material that makes us what we are DNA in the Cell Human Genome ~3 billion base pairs of DNA 30,000-35,000 genes Population-each

More information

BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)

BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) BIOLOGY 207 - Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) Required readings and problems: Reading: Open Genetics, Chapter 8.1 Problems: Chapter 8 Optional Griffiths (2008) 9

More information

MRC-Holland MLPA. Description version 11; 20 November 2015

MRC-Holland MLPA. Description version 11; 20 November 2015 SALSA MLPA probemix P310-B2 TCOF1 Lot B2-0614, B2-0511. As compared to version B1 (lot B1-0110), the 88 and 96 nt control fragments have been replaced (QDX2). Treacher Collins-Franceschetti 1 syndrome

More information

Could modern methods of genetics improve the disease resistance in farm animals?

Could modern methods of genetics improve the disease resistance in farm animals? Could modern methods of genetics improve the disease resistance in farm animals? (introductory lecture) A. Kuznetsov Content Innate immune response Adaptive immune response Breeding programs Transgenesis

More information

Overview. Background ~30 min. Lab activity ~50 min. DNA profiling Polymerase Chain Reaction (PCR) Gel Electrophoresis PCR

Overview. Background ~30 min. Lab activity ~50 min. DNA profiling Polymerase Chain Reaction (PCR) Gel Electrophoresis PCR Overview Day 1: Tuesday Introduction to DNA profiling How do we use DNA to solve crimes? Background Polymerase Chain Reaction (PCR) Gel Electrophoresis Set up PCR Day 2: Wednesday Make and Run Agarose

More information

Optimizing Multiplex qpcr for Detecting Infectious Diseases

Optimizing Multiplex qpcr for Detecting Infectious Diseases Optimizing Multiplex qpcr for Detecting Infectious Diseases Aurita Menezes Ph.D, qpcr Product Manager Integrated DNA Technologies Agenda Establishing robust multiplex assays In the context of Gene expression

More information

Report of Analyzing Short Tandem Repeats for Parentage Testing

Report of Analyzing Short Tandem Repeats for Parentage Testing 1 Alex Michael Tseng Department of Forensic Medicine, College of Medicine, National Taiwan University Report of Analyzing Short Tandem Repeats for Parentage Testing Introduction In the three billion letter

More information

FORENSIC GENETICS. DNA in the cell FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS. Sources of biological evidence

FORENSIC GENETICS. DNA in the cell FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS. Sources of biological evidence FORENSIC GENETICS FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS Establishing human corpse identity Crime cases matching suspect with evidence Paternity testing, even after

More information

Targeted Sequencing of Leukemia-Associated Genes Using 454 Sequencing Systems

Targeted Sequencing of Leukemia-Associated Genes Using 454 Sequencing Systems Sequencing Application Note March 2012 Targeted Sequencing of Leukemia-Associated Genes Using 454 Sequencing Systems GS GType TET2/CBL/KRAS and RUNX1 Primer Sets for the GS Junior and GS FLX Systems. Introduction

More information

Biosc10 schedule reminders

Biosc10 schedule reminders Biosc10 schedule reminders Review of molecular biology basics DNA Is each person s DNA the same, or unique? What does DNA look like? What are the three parts of each DNA nucleotide Which DNA bases pair,

More information

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS. !! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,

More information

B. Incorrect! Ligation is also a necessary step for cloning.

B. Incorrect! Ligation is also a necessary step for cloning. Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease

More information

DNA Analysis Students will learn:

DNA Analysis Students will learn: DNA Analysis Students will learn: That DNA is a long-chain polymer found in nucleated cells, which contain genetic information. That DNA can be used to identify or clear potential suspects in crimes. How

More information

Index. Index 377. ASH, see Allele-specific hybridization

Index. Index 377. ASH, see Allele-specific hybridization Index 377 Index A Allele-specific hybridization (ASH), genotyping principles, 14, 15 Amplification refractory mutation system-polymerase chain reaction (ARMS-PCR), cystic fibrosis diagnosis, amplification,

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

GeneSeek, Inc. a Neogen Company, was founded in Neogen Corporate Profile

GeneSeek, Inc. a Neogen Company, was founded in Neogen Corporate Profile GeneSeek, Inc. a Neogen Company, was founded in 1998 and has developed into a comprehensive agricultural biotechnology service provider. Gene Seek s corporate headquarters are in a large custom-built laboratory

More information

13-1 Changing the Living World

13-1 Changing the Living World 13-1 Changing the Living World In the past, variation was limited to the variations already in nature or random variations that resulted from mutations. Now, scientists can change DNA and swap genes from

More information

SNPs - GWAS - eqtls. Sebastian Schmeier

SNPs - GWAS - eqtls. Sebastian Schmeier SNPs - GWAS - eqtls s.schmeier@gmail.com http://sschmeier.github.io/bioinf-workshop/ 17.08.2015 Overview Single nucleotide polymorphism (refresh) SNPs effect on genes (refresh) Genome-wide association

More information

Chapter 10 Genetic Engineering: A Revolution in Molecular Biology

Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical

More information

Authors: Vivek Sharma and Ram Kunwar

Authors: Vivek Sharma and Ram Kunwar Molecular markers types and applications A genetic marker is a gene or known DNA sequence on a chromosome that can be used to identify individuals or species. Why we need Molecular Markers There will be

More information

Emerging Focus. Nutrigenomics. Department of Nutritional Sciences Faculty of Life Sciences

Emerging Focus. Nutrigenomics. Department of Nutritional Sciences Faculty of Life Sciences Emerging Focus Nutrigenomics Emerging Focus Nutrigenomics The Emerging Focus Nutrigenomics A New Research Group at the of the University of Vienna Overview Nutrigenomics is the study of the response of

More information

SYSTEMS. MassARRAY System. Uncompromised Molecular Testing. For Research Use Only. Not for use in diagnostic procedures.

SYSTEMS. MassARRAY System. Uncompromised Molecular Testing. For Research Use Only. Not for use in diagnostic procedures. SYSTEMS MassARRAY System Uncompromised Molecular Testing For Research Use Only. Not for use in diagnostic procedures. The MassARRAY System Challenges in Molecular Testing Are you tired of managing trade-offs

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information

TECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298

TECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298 DIAGNOSTICS BUSINESS ANALYSIS SERIES: TECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298 By ADAMS BUSINESS ASSOCIATES March 2017. March 2017 ABA 298 1 Technologies, Products & Services

More information

The Polymerase Chain Reaction. Chapter 6: Background

The Polymerase Chain Reaction. Chapter 6: Background The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for

More information

Explain why the scientists used the same restriction endonuclease enzymes on each DNA sample

Explain why the scientists used the same restriction endonuclease enzymes on each DNA sample Q1.Some populations of flies are becoming resistant to insecticides intended to kill them. Scientists developed a method for finding out whether a fly was carrying a recessive allele, r, that gives resistance

More information

Pharmacogenetics: A SNPshot of the Future. Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001

Pharmacogenetics: A SNPshot of the Future. Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001 Pharmacogenetics: A SNPshot of the Future Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001 1 I. What is pharmacogenetics? It is the study of how genetic variation affects drug response

More information

PowerPlex. Y System Validation

PowerPlex. Y System Validation PowerPlex Y System Validation By Patricia M. Fulmer, Dawn Rabbach, Kimberly Huston, Curtis Knox and Cynthia Sprecher, Promega Corporation Abstract We have improved the manufacturing process for the PowerPlex

More information

Methods that do not require growth in laboratory PCR

Methods that do not require growth in laboratory PCR Methods that do not require growth in laboratory PCR Nucleotide sequencing MLST/MLVST Profiles Microarrays Polymerase Chain Reaction [PCR] Use to find a rare sequence in a pool of many different sequences

More information

Genetic Technologies

Genetic Technologies Genetic Technologies Distinguish the terms biotechnology, recombinant DNA technology, transgenic organisms, genetic engineering Understand the two basic techniques to obtain selective fragments of DNA

More information

MassARRAY System MASSARRAY SYSTEM ACCELERATING RESEARCH

MassARRAY System MASSARRAY SYSTEM ACCELERATING RESEARCH SENSITIVITY ACCELERATING RESEARCH SPEED SPECIFICITY ACCURACY No compromise MASSARRAY SYSTEM Genotyping Somatic mutation profiling Methylation analysis Quantitative gene expression and copy number variant

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

LATE-PCR. Linear-After-The-Exponential

LATE-PCR. Linear-After-The-Exponential LATE-PCR Linear-After-The-Exponential A Patented Invention of the Laboratory of Human Genetics and Reproductive Biology Lab. Director: Lawrence J. Wangh, Ph.D. Department of Biology, Brandeis University,

More information

ngs metagenomics target variation amplicon bioinformatics diagnostics dna trio indel high-throughput gene structural variation ChIP-seq mendelian

ngs metagenomics target variation amplicon bioinformatics diagnostics dna trio indel high-throughput gene structural variation ChIP-seq mendelian Metagenomics T TM storage genetics assembly ncrna custom genotyping RNA-seq de novo mendelian ChIP-seq exome genomics indel ngs trio prediction metagenomics SNP resequencing bioinformatics diagnostics

More information

Human genetic variation

Human genetic variation Human genetic variation CHEW Fook Tim Human Genetic Variation Variants contribute to rare and common diseases Variants can be used to trace human origins Human Genetic Variation What types of variants

More information

Selected Techniques Part I

Selected Techniques Part I 1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative

More information

UF Center for Pharmacogenomics. Explanation of Services. UF Center for Pharmacogenomics Services

UF Center for Pharmacogenomics. Explanation of Services. UF Center for Pharmacogenomics Services UF Center for Pharmacogenomics Explanation of Services Services are provided either as a price per sample or price per project, depending on the specific needs of the researcher. Basic a la carte services,

More information

Application of Biotechnology in DNA Fingerprinting and Forensic Analysis. Copyright 2009 Pearson Education, Inc.

Application of Biotechnology in DNA Fingerprinting and Forensic Analysis. Copyright 2009 Pearson Education, Inc. Application of Biotechnology in DNA Fingerprinting and Forensic Analysis Introduction to DNA Fingerprinting and Forensics Forensic science intersection of law and science Historic examples Early 1900s

More information

HLA-Typing Strategies

HLA-Typing Strategies HLA-Typing Strategies Cologne, 13.5.2017 Joannis Mytilineos MD, PhD Department of Transplantation Immunology Institute for Clinical Transfusion Medicine and Immunogenetics German Red Cross Blood Transfusion

More information

Thermo Scientific Direct PCR

Thermo Scientific Direct PCR Thermo Scientific Direct PCR Amplify without purification Amplify without prior DNA purification The Thermo Scientific Direct PCR approach offers outstanding convenience for DNA amplification by allowing

More information

DESIGNER GENES SAMPLE TOURNAMENT

DESIGNER GENES SAMPLE TOURNAMENT DESIGNER GENES SAMPLE TOURNAMENT PART ONE- GENETICS PROBLEMS In dogs, the inheritance of hair color involves a gene (B) for black hair and a gene (b) for brown hair. A dominant (C) is also involved. It

More information

A Crash Course in NGS for GI Pathologists. Sandra O Toole

A Crash Course in NGS for GI Pathologists. Sandra O Toole A Crash Course in NGS for GI Pathologists Sandra O Toole The Sanger Technique First generation sequencing Uses dideoxynucleotides (dideoxyadenine, dideoxyguanine, etc) These are molecules that resemble

More information

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s

More information

SYSTEMS. MassARRAY System. Uncompromised Molecular Testing. For Research Use Only. Not for use in diagnostic procedures.

SYSTEMS. MassARRAY System. Uncompromised Molecular Testing. For Research Use Only. Not for use in diagnostic procedures. SYSTEMS MassARRAY System Uncompromised Molecular Testing For Research Use Only. Not for use in diagnostic procedures. The MassARRAY System Challenges in Molecular Testing Are you tired of managing trade-offs

More information

Illumina Genome Analyzer. Progenika Experience. - Susana Catarino -

Illumina Genome Analyzer. Progenika Experience. - Susana Catarino - Illumina Genome Analyzer Progenika Experience - Susana Catarino - Who are we? 2000 PROGENIKA BIOPHARMA Development, production and commercialization of new genomic tools for diagnosis, prognosis and drug-response

More information

MassARRAY System MASSARRAY SYSTEM ACCELERATING RESEARCH

MassARRAY System MASSARRAY SYSTEM ACCELERATING RESEARCH SENSITIVITY ACCELERATING RESEARCH SPEED SPECIFICATY ACCURACY No compromise MASSARRAY SYSTEM Genotyping Somatic mutation profiling Methylation analysis Quantitative gene expression and copy number variant

More information

Thermo Scientific Equine Genotypes Panel 1.1

Thermo Scientific Equine Genotypes Panel 1.1 Thermo Scientific Equine Genotypes Panel 1.1 F- 850S 100 reactions F- 850L 500 reactions Technical Manual Product Description Parentage testing and individual identification using short tandem repeat (STR)

More information

Proteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer.

Proteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer. Proteomics And Cancer Biomarker Discovery Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar Overview Proteomics Cancer Aims Tools Data Base search Challenges Summary 1 Overview

More information

Outline. General principles of clonal sequencing Analysis principles Applications CNV analysis Genome architecture

Outline. General principles of clonal sequencing Analysis principles Applications CNV analysis Genome architecture The use of new sequencing technologies for genome analysis Chris Mattocks National Genetics Reference Laboratory (Wessex) NGRL (Wessex) 2008 Outline General principles of clonal sequencing Analysis principles

More information

Sample to Insight. Dr. Bhagyashree S. Birla NGS Field Application Scientist

Sample to Insight. Dr. Bhagyashree S. Birla NGS Field Application Scientist Dr. Bhagyashree S. Birla NGS Field Application Scientist bhagyashree.birla@qiagen.com NGS spans a broad range of applications DNA Applications Human ID Liquid biopsy Biomarker discovery Inherited and somatic

More information

Society for Wildlife Forensic Science Develop Wildlife Forensic Science into a comprehensive, integrated and mature discipline.

Society for Wildlife Forensic Science Develop Wildlife Forensic Science into a comprehensive, integrated and mature discipline. Wildlife Genetics Proficiency Testing Program Test # 022013 Consensus Report 05/03/2013 Test Start Date -02/20/2013 Test Due Date -04/26/2013 This document reports the results of the Wildlife Genetics

More information

BIO NEWS. Food Diagnostics Special. Genomic DNA from food and feed for GMO detection / quantification and animal species differentiation

BIO NEWS. Food Diagnostics Special. Genomic DNA from food and feed for GMO detection / quantification and animal species differentiation BIO NEWS Food Diagnostics Special Genomic DNA from food and feed for GMO detection / quantification and animal species differentiation NucleoSpin Food NucleoSpin Food Purification of genomic DNA from food

More information

Introducing: 3Zomy Aneuploidity Test

Introducing: 3Zomy Aneuploidity Test Introducing: 3Zomy Aneuploidity Test QF-PCR Life Technologies (India) Pvt. Ltd. 306, Aggarwal City Mall, Opposite M2K Pitampura, Delhi 110034 (INDIA). Ph: +91-11-42208000, 4220811, 42208222 Mobile: +91-9810521400

More information

Development of quantitative targeted RNA-seq methodology for use in differential gene expression

Development of quantitative targeted RNA-seq methodology for use in differential gene expression Development of quantitative targeted RNA-seq methodology for use in differential gene expression Dr. Jens Winter, Market Development Group Biological Biological Research Content EMEA QIAGEN Universal Workflows

More information

Pioneering Clinical Omics

Pioneering Clinical Omics Pioneering Clinical Omics Clinical Genomics Strand NGS An analysis tool for data generated by cutting-edge Next Generation Sequencing(NGS) instruments. Strand NGS enables read alignment and analysis of

More information

4.1. Genetics as a Tool in Anthropology

4.1. Genetics as a Tool in Anthropology 4.1. Genetics as a Tool in Anthropology Each biological system and every human being is defined by its genetic material. The genetic material is stored in the cells of the body, mainly in the nucleus of

More information

Next-generation sequencing technologies

Next-generation sequencing technologies Next-generation sequencing technologies Illumina: Summary https://www.youtube.com/watch?v=fcd6b5hraz8 Illumina platforms: Benchtop sequencers https://www.illumina.com/systems/sequencing-platforms.html

More information

Amplicon size (bp) E ± SD

Amplicon size (bp) E ± SD Development of a probe-based qpcr assay for the detection of constitutional and somatic deletions in the NF1 gene. Application to genetic testing and tumor analysis. Terribas E, Garcia-Linares C, Lázaro

More information

Methods in virus diagnosis PCR techniques

Methods in virus diagnosis PCR techniques Methods in virus diagnosis PCR techniques 450 MBIO PRACTICAL LESSON 5 Molecular Methods Methods based on the detection of viral genome are also commonly known as molecular methods. It is often said that

More information

IMGM Laboratories GmbH. Sales Manager

IMGM Laboratories GmbH. Sales Manager IMGM Laboratories GmbH Dr. Jennifer K. Kuhn Sales Manager About IMGM Laboratories IMGM Laboratories was founded in 2001 IMGM operates as professional provider of advanced genomic services from research

More information

HELINI Hepatitis B virus [HBV] Real-time PCR Kit (Genotype A to H)

HELINI Hepatitis B virus [HBV] Real-time PCR Kit (Genotype A to H) HELINI Hepatitis B virus [HBV] Real-time PCR Kit (Genotype A to H) Quantitative In vitro diagnostics Instruction manual Cat. No: 8001-25/50/100 tests Compatible with: Agilent, Bio-Rad, Applied Bio systems

More information

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis 1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

High-Resolution Melting analysis as a tool for rapid and sensitive detection of genotypes in cattle population

High-Resolution Melting analysis as a tool for rapid and sensitive detection of genotypes in cattle population Research and Development Station for Bovine, Arad, Romania High-Resolution Melting analysis as a tool for rapid and sensitive detection of genotypes in cattle population Daniela Elena Ilie, Ada Cean, Ioan

More information

Capabilities & Services

Capabilities & Services Capabilities & Services Accelerating Research & Development Table of Contents Introduction to DHMRI 3 Services and Capabilites: Genomics 4 Proteomics & Protein Characterization 5 Metabolomics 6 In Vitro

More information

Genomic resources. for non-model systems

Genomic resources. for non-model systems Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing

More information

Contents. 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA Introduction Principle...

Contents. 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA Introduction Principle... Contents 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA... 1 Introduction... 1 Principle... 1 Reagents Required and Their Role... 2 Procedure... 3 Observation... 4 Result

More information

Explain why the scientists used the same restriction endonuclease enzymes on each DNA sample

Explain why the scientists used the same restriction endonuclease enzymes on each DNA sample Q1.Some populations of flies are becoming resistant to insecticides intended to kill them. Scientists developed a method for finding out whether a fly was carrying a recessive allele, r, that gives resistance

More information

Real-Time PCR (qpcr), a performing method to check. for the presence of banned. substances. Renaville R. Progenus sa Gembloux, Belgium

Real-Time PCR (qpcr), a performing method to check. for the presence of banned. substances. Renaville R. Progenus sa Gembloux, Belgium Real-Time PCR (qpcr), a performing method to check for the presence of banned substances Renaville R. Progenus sa Gembloux, Belgium What do we know? The product market is moving to a worldwide market The

More information

B. Sc. III SEMESTER V BTT- 501: MOLECULAR BIOLOGY (CORE)

B. Sc. III SEMESTER V BTT- 501: MOLECULAR BIOLOGY (CORE) B. Sc. III SEMESTER V BTT- 501: MOLECULAR BIOLOGY (CORE) Unit I: Genome Structure:Watson and Crick model of DNA; Genome organization with specific reference to prokaryotic and eukaryotic genomes; Genome

More information

SEQUENCING. M Ataei, PhD. Feb 2016

SEQUENCING. M Ataei, PhD. Feb 2016 CLINICAL NEXT GENERATION SEQUENCING M Ataei, PhD Tehran Medical Genetics Laboratory Feb 2016 Overview 2 Background NGS in non-invasive prenatal diagnosis (NIPD) 3 Background Background 4 In the 1970s,

More information

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis 1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

PCR. What is PCR? What is PCR? Why chain? What is PCR? Why Polymerase?

PCR. What is PCR? What is PCR? Why chain? What is PCR? Why Polymerase? What is PCR? PCR the swiss army knife Claudia Stäubert, Institute for biochemistry PCR is an exponentially progressing synthesis of the defined target DNA sequences in vitro. It was invented in 1983 by

More information

AmpFlSTR Identifiler PCR Amplification Kit

AmpFlSTR Identifiler PCR Amplification Kit Product Bulletin Human Identification AmpFlSTR Identifiler PCR Amplification Kit Fifteen STR (short tandem repeat) loci and Amelogenin co-amplified in a single tube Incorporation of the same proven, reliable

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID PARK2 co-regulated PACRG Human This gene encodes a protein that is conserved across

More information

Polymerase chain reaction: advantages and drawbacks

Polymerase chain reaction: advantages and drawbacks Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch Year: 2015 Polymerase chain reaction: advantages and drawbacks Favrot, C Posted at

More information

1

1 1 2 3 4 5 Cosmids are plasmid vectors that contain cos sites. The cos site is the only requirement for DNA to be packaged into a phage particle 6 7 8 9 10 11 12 13 14 15 16 For de novo sequencing using

More information